Cancer Research 2010 AACR Elections Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Batra, R. K.
Right arrow Articles by Dubinett, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Batra, R. K.
Right arrow Articles by Dubinett, S. M.
[Cancer Research 63, 642-646, February 1, 2003]
© 2003 American Association for Cancer Research

Immunology

Non-Small Cell Lung Cancer-derived Soluble Mediators Enhance Apoptosis in Activated T Lymphocytes through an I{kappa}B Kinase-dependent Mechanism1

Raj K. Batra2, Ying Lin2, Sherven Sharma, Mariam Dohadwala, Jie Luo, Mehis Pold and Steven M. Dubinett3

Department of Medicine and The Lung Cancer Research Program [R. K. B., Y. L., S. S., M. D., J. L., M. P., S. M. D.], Jonsson Comprehensive Cancer Center [R. K. B., S. M. D.], University of California at Los Angeles and Veterans Administration-Greater Los Angeles Health Care System, Los Angeles, California 90095


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
T lymphocyte survival is critical for the development and maintenance of an effective host antitumor immune response; however, the tumor environment can negatively impact T-cell survival. Lymphocytes exposed to tumor supernatants (TSNs) were evaluated for apoptosis after mitogen stimulation. TSN was observed to significantly enhance phorbol 12-myristate 13-acetate/ionomycin- and anti-CD3-stimulated lymphocyte apoptosis. Enhanced lymphocyte apoptosis was associated with an impairment of nuclear factor {kappa}B nuclear translocation and diminished I{kappa}B{alpha} degradation. In lymphocytes stimulated after exposure to TSNs, cytoplasmic I{kappa}B{alpha} persisted as a result of alterations in I{kappa}B kinase (IKK) activity. Accordingly, although there were no apparent differences in IKK component concentrations, lymphocytes preexposed to TSNs exhibited markedly reduced IKK activity. We conclude that non-small cell lung cancer-derived soluble factors promote apoptosis in activated lymphocytes by an IKK-dependent pathway.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lung cancer is the leading cause of cancer-related death in the United States in both men and women. The tumors’ capacity to avert host antitumor responses may be an important determinant contributing to the morbidity and mortality incurred by this disease. A number of mechanisms whereby tumors evade the immune system have been described (1, 2, 3, 4, 5, 6) , including those that directly abrogate effector cell function by limiting lymphocyte survival (7, 8, 9, 10) . Our preliminary studies suggested that normal donor lymphocytes exposed to NSCLC4 tumor cell supernatant exhibited increased apoptosis, and we proceeded to model and investigate the mechanisms responsible for this effect. Because tumor-induced alterations in T-cell NF-{kappa}B activation resulted in the induction of T-lymphocyte apoptosis by renal cell carcinoma (8, 9, 10) , and because NF-{kappa}B has been implicated as an important inhibitor of apoptosis (11 , 12) , we hypothesized that a similar process may be operative in NSCLC.

Transcription factors of the NF-{kappa}B family mediate signal transduction into the nucleus after exposure to a variety of endogenous and exogenous stimuli including tumor necrosis factor {alpha}, interleukin 1, lipopolysaccharide, ionizing/UV irradiation, viral infections, and CD3 ligation (13, 14, 15) . In the nucleus, these proteins selectively bind oligomeric DNA consensus sites in the regulatory regions of a variety of immune/inflammatory response genes to induce the transcription of an array of cytokines, growth factors, and adhesion molecules. In most cell types, NF-{kappa}B nuclear translocation requires a release from inhibitory (I{kappa}B) proteins that sequester NF-{kappa}B in the cytoplasm (16 , 17) . I{kappa}B{alpha}, which interacts with the RelA/p65 subunit, is a major regulator of NF-{kappa}B activity (14 , 17 , 18) . For NF-{kappa}B release, I{kappa}B{alpha} is inducibly phosphorylated at specific serine sites, which prompts its ubiquination and proteosomal degradation (16 , 19) . Thus, inducible phosphorylation is a key regulatory step, and is mediated by a large (Mr 900,000) protein kinase complex termed IKK (20, 21, 22) . Whereas IKK activation is rapid in response to diverse stimuli (22) , prompt deactivation is probably just as important to limit kinase activation after removal of an activating stimulus. This deactivation of IKK is mediated, at least in part, by an autoregulatory mechanism that serves to autophosphorylate the IKKß subunit of IKK (23) .

In this study, we investigated the fate of T cells after activation in the tumor environment. The effects of A549 TSNs on Jurkat T-cell apoptosis were investigated. We found that TSNs strongly inhibited T-cell NF-{kappa}B activation and, as a result, markedly enhanced T-cell apoptosis after activation. The decreases in NF-{kappa}B activation and I{kappa}B{alpha} degradation in the Jurkat T cells could be attributed to TSN-mediated inhibition of IKK activity. Thus, this report is the first documentation of tumor-induced lymphocyte apoptosis through a mechanism that involves impaired IKK activity.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
Purified mouse anti-human CD3 (PharMingen, San Diego, CA), the phorbol esters PMA and tetradecanoyl phorbol acetate (Life Technologies, Inc., Grand Island, NY), and ionomycin (Sigma, St. Louis, MO) were used for lymphocyte activation. 7-AAD (Sigma) was used to detect lymphocyte apoptosis using flow cytometry.

Cell Cultures.
The human lung adenocarcinoma cell line A549 and human Jurkat T cells were obtained from American Type Culture Collection (Manassas, VA). Human Jurkat T cells are human CD4- T cells that constitutively proliferate and can be induced (by activation with concanavalin A, phytohemagglutinin, or PMA plus a calcium ionophore) to produce interleukin 2. These cells were maintained at 37°C in a 5% CO2 atmosphere in air, in tissue culture flasks containing RPMI 1640 supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (0.1 mg/ml), and 2 mM glutamine (R-10 complete medium; JRH Biosciences, Lenexa, KS). TSNs were generated by culturing 1 x 106 A549 NSCLC cells for 24 h in 1 ml of R-10 complete medium. Jurkat T-cell cultures (6 x 105 cells) were exposed to 1 ml of TSN or control R-10 complete medium for 18 h in parallel, before activation with anti-CD3 or PMA/ionomycin. Similarly, normal donor PBLs were cultured in RPMI 1640 and 10% fetal bovine serum or TSN for 18 h, activated with PMA/ionomycin for 24 h, and evaluated for apoptotic fractions by flow cytometry.

Measurement of Apoptosis.
7-AAD staining, which can be used to identify the characteristic pattern of DNA damage that accompanies apoptosis, was used to distinguish apoptotic from live cells (24) . Twenty-four h after activation, aliquots of 105 Jurkat cells were washed with PBS and incubated for 20 min at room temperature with 10 µg/ml 7-AAD (Sigma). At least 104 cells were evaluated by FACScan flow cytometer (Becton Dickinson, San Jose, CA) in the University of California Los Angeles Jonsson Cancer Center Flow Cytometry Core Facility. Between 5,000 and 15,000 gated events were collected and analyzed using Cell Quest software (Becton Dickinson), and live cells were distinguished from apoptotic cells as described previously (25) .

Western Blot Analysis.
Jurkat cells, stimulated with PMA (40 nM) and ionomycin (1 µg/ml) in culture medium or TSNs, were sedimented at predetermined time points, the culture medium was aspirated, and the cells were washed with PBS. The cells were then lysed in 10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, and 0.6% NP40 (cell lysis buffer), and 20 µg of protein from the lysates were separated by 10% SDS-PAGE and transferred to Hybond ECL nitrocellulose (Amersham Pharmacia Biotech, Piscataway, NJ). The membrane was blocked using 5% nonfat milk in PBS and probed with 0.2 µg/ml rabbit anti-I{kappa}B antibody (Santa Cruz Biotechnology, Santa Cruz, CA). After rinsing, the blot was labeled with a 1:3000 dilution of horseradish peroxidase-coupled anti-rabbit antibody (Santa Cruz Biotechnology) and developed by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech) according to the manufacturer’s instructions.

Preparation of Nuclear Extracts.
After culture and activation as described, Jurkat T cells (1 x 107) were collected and washed twice with cold PBS, and the cell pellet was suspended in 40 µl of cell lysis buffer for 10 min on ice. Nuclei were extracted by sedimentation (microcentrifugation at 6,500 rpm) for 10 min at 4°C. The nuclear pellet was then suspended in 15 µl of extraction buffer C [20 mM HEPES (pH 7.9), 25% glycerol, 0.4 M NaCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM DTT, and 1 mM PMSF] and incubated for 10 min at 4°C with brief intermittent mixing. The mixture was microcentrifuged (14,000 rpm for 10 min at 4°C), and the nuclear protein was resuspended in 60 µl of extraction buffer D [20 mM HEPES (pH 7.9), 25% glycerol, 50 mM NaCl, 1.5 mM KCl, 0.2 mM EDTA, 1 mM DTT, and 1 mM PMSF].

Electrophoretic Mobility Shift Assay.
Ten µg of nuclear extract were preincubated in 20 µl (total reaction volume) of 1x binding buffer containing 20 mM HEPES (pH 7.9) 80 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 1 mM PMSF, 8% glycerol, and 2 µg of poly(dI-DC) (Amersham Pharmacia Biotech) for 15 min at 4°C. The reaction mixture was then incubated with 1 x 105 cpm of [{gamma}-32P]ATP (3000 Ci/mM)-labeled double-stranded NF-{kappa}B consensus binding oligonucleotide (AGTTGAGGGGACTTTCCCAGGG; Santa Cruz Biotechnology) for 20 min at room temperature. The samples were then resolved by nondenaturing 6% PAGE in 0.5x Tris-borate EDTA buffer, dried, and analyzed by autoradiography.

Immune Complex Protein Kinase Assays.
Eighty µg of cytoplasmic protein from Jurkat T cells were incubated with 1 µg of rabbit anti-IKKß antibody (Santa Cruz Biotechnology) for 1 h at 4°C. Immune complexes were precipitated using protein A/G plus agarose (20 µl, coincubation overnight at 4°C under gentle agitation). The immunoprecipitates were collected by sedimenting the agarose (2,500 rpm, 5 min, 4°C). The pellets were washed four times with 1.0 ml of PBS and resuspended in 20 µl of protein kinase assay buffer (50 mM HEPES, 0.1 mM EDTA, 0.01% Brij 35, 0.1 mg/ml BSA, 0.1% ß-mercaptoethanol, and 0.15 M NaCl). One hundred ng of I{kappa}B{alpha} protein (Santa Cruz Biotechnology) and 10 µl of ATP mix [930 µl of protein kinase buffer, 6 µl of 50 mM ATP, 20 µl of 2.0 M MgCl2, and 44 µl of [{gamma}-32P]ATP (10 mCi/ml)] were added per sample. After a 20-min incubation at room temperature, the kinase reaction was terminated by adding 2x SDS-PAGE sample buffer and then boiling samples for 3 min. The agarose beads were then sedimented (14,000 rpm for 30 s), the supernatant was separated in SDS-PAGE, and the results were analyzed by autoradiography.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
TSN (A549 NSCLC) Enhances Apoptosis of CD3-activated Jurkat T Cells.
Normal donor lymphocytes exposed to TSNs exhibited greater apoptosis after PMA and ionomycin stimulation than PBLs stimulated under control conditions (Fig. 1A)Citation . These results prompted us to model and investigate the mechanisms responsible for this effect. To determine whether factors released from NSCLC cells influence T cell survival, Jurkat T cells were exposed to TSNs and stimulated with anti-CD3 for 24 h, and the fraction undergoing apoptosis was measured by 7-AAD staining and flow cytometry. After exposure to TSNs, Jurkat T cells exhibited a marked increase (38% compared with 2%) in the apoptotic fraction after anti-CD3 stimulation (Fig. 1B)Citation , as compared with cells exposed to medium alone. In contrast, the fraction of unstimulated Jurkat T cells undergoing apoptosis did not vary between the control and TSN-exposed groups (Fig. 1B)Citation . Thus, soluble factors within A549 TSNs are contributing to apoptosis in Jurkat T cells upon anti-CD3 stimulation. Similar results were obtained after PMA and ionomycin stimulation of Jurkat cells (data not shown).



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. A, A549 TSNs enhance PBL apoptosis after PMA and ionomycin activation. Normal donor lymphocytes cultured in control medium (RPMI 1640) or A549 TSNs were stimulated with PMA (40 ng/ml) plus ionomycin (1 µg/ml; P + I) for 24 h. Induced cell death was measured by flow cytometry after 7-AAD (20 µg/ml) staining. Representative flow cytometry data and the corresponding graphical display of apoptotic cell death are presented in the left and right panels, respectively. Exposure to TSNs enhanced activated PBL cell death. B, A549 TSNs enhance Jurkat T-cell death after anti-CD3 activation. Jurkat T cells, cultured in control medium or TSNs, were activated with anti-CD3 (1 µg/ml) for 24 h. Induced cell death was measured by flow cytometry after 7-AAD (20 µg/ml) staining. As described above, representative flow data are presented, and apoptotic cell death is graphically displayed in the adjacent panel. Exposure to TSNs enhanced anti-CD3-activated Jurkat cell death.

 
Nuclear Extracts from Jurkat T Cells Exposed to TSNs Display Altered {kappa}B-specific Binding.
To determine the role of NF-{kappa}B-dependent apoptosis in lymphocytes cultured and activated in TSNs, Jurkat T cells were activated using PMA plus ionomycin after culture in either medium or A549 TSNs, and nuclear extracts were evaluated for {kappa}B-specific binding. The results of the electrophoretic mobility shift assays indicated a prompt (within 10 min) maximal and sustained (up to 1 h) NF-{kappa}B nuclear translocation in control cells (Fig. 2)Citation . In contrast, a marked decrease in NF-{kappa}B nuclear translocation was evident after PMA plus ionomycin activation in the group of Jurkat T cells cultured in TSNs (Fig. 2)Citation . These data suggest that A549 TSNs contain elements capable of inhibiting NF-{kappa}B nuclear translocation in T cells, thereby promoting their activation-induced cell death.



View larger version (96K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. A549 TSNs inhibit NF{kappa}B translocation induced by PMA plus ionomycin in Jurkat T cells. Jurkat T cells, cultured in either control medium or A549 TSNs, were stimulated with PMA (40 ng/ml) plus ionomycin (1 µg/ml) for the given time points, and nuclear protein was extracted. Nuclear extracts (10 µg) from these cells were admixed with the labeled {kappa}B consensus sequence (5'-AGTTGAGGGACTTTCCCAGGC-3'), and the mixture was resolved by 6% nondenaturing PAGE for determination of NF-{kappa}B translocation. NF-{kappa}B activation (p65/p50) was inhibited in the presence of NSCLC TSNs.

 
Jurkat T Cells Exposed to TSNs Display Altered I{kappa}B{alpha} Degradation.
Because I{kappa}B degradation is a prerequisite for NF-{kappa}B nuclear translocation, we assessed cytoplasmic concentrations of I{kappa}B{alpha} in activated Jurkat T cells after exposure to TSNs and compared these levels to cells activated after growth in control medium. Western blot analyses using an anti-I{kappa}B{alpha} antibody were performed on the cellular lysates from these groups. As indicated in Fig. 3Citation , Jurkat T cells grown in medium exhibited prompt I{kappa}B{alpha} degradation after PMA plus ionomycin stimulation, and cytoplasmic I{kappa}B{alpha} concentrations were rapidly restored to baseline under control conditions. In contrast, I{kappa}B{alpha} degradation was not induced upon stimulation in Jurkat T cells exposed to TSNs, even up to 90 min after PMA/ionomycin exposure. As a result, whereas control Jurkat T cells exhibited a normal pattern of I{kappa}B{alpha} autoregulation (i.e., degradation of I{kappa}B{alpha} led to NF-{kappa}B translocation and transcriptional activation of I{kappa}B{alpha} gene; Ref. 26 ), this autoregulation was not evident in cells exposed to A549 TSNs.



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. A549 TSNs inhibit I{kappa}B{alpha} degradation induced by PMA plus ionomycin in Jurkat T cells. Jurkat T cells, cultured in either control medium or A549 TSNs, were stimulated with PMA (40 ng/ml) plus ionomycin (1 µg/ml) for the given time points. Cytoplasmic protein extract (20 µg) from these cells was separated by SDS-PAGE and probed with an anti-I{kappa}B{alpha} antibody. Western blotting for I{kappa}B{alpha} is shown under control and test conditions over a 90-min time interval. The corresponding densitometry analyses of these bands are shown on the bottom panel (abscissa, time in minutes; ordinate, relative densitometry).

 
Jurkat T Cells Exposed to A549 TSNs Display Altered IKK Activity.
Because I{kappa}B phosphorylation (by IKK) precedes its degradation, we sought to determine whether the intracellular IKK concentrations or IKK activity was impacted in the activated Jurkat T cells after growth in TSNs. As described recently, IKK is a multicomponent complex comprised of related yet distinct subunit kinases termed IKK{alpha} and IKKß and a regulatory subunit, IKK{gamma} (27) . The reported kinetics of IKK activity suggests rapid activation with prompt deactivation after stimulus transduction (20 , 21 , 28) . For these studies, activated Jurkat T cells were grown in medium or TSNs, stimulated with PMA plus ionomycin, and lysed. First, cell lysates were examined for IKK{alpha} and IKKß by Western blot analysis after SDS-PAGE separation. The results, as depicted in Fig. 4Citation , suggest that the cytoplasmic concentrations of IKK complexes (as gauged by the presence of IKK{alpha} and IKKß components) were not altered after exposure of Jurkat T cells to TSNs. These data suggest that A549 TSNs do not impact IKK component expression and led us to consider whether tumor factors interfered with the formation of the IKK complex and/or its activity.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. A549 TSNs do not alter the expression of IKK components. Jurkat T cells, cultured in medium or A549 TSNs, were stimulated with PMA plus ionomycin for the given time points and lysed. Cell lysates (80 µg) were examined for IKK{alpha} and IKKß by Western blot analysis after SDS-PAGE separation. Cellular concentrations of IKK complexes, as gauged by the presence of IKK{alpha} (top panel) and IKKß (bottom panel), did not differ between the two groups of Jurkat T cells.

 
To determine whether TSNs impacted IKK activity, the IKKß component was immunoprecipitated from cell lysates, and the specific IKK activity was measured by assessing recombinant I{kappa}B{alpha} phosphorylation. As shown in Fig. 5Citation , Jurkat T cells in control conditions possess normal IKK activity, exhibiting prompt cyclical activation and deactivation after phorbol ester stimulation. In contrast, however, IKK activity is not evident in Jurkat cells that have been exposed to TSNs. These data indicate that A549 TSNs contain factors that interfere with the formation of the IKK complex and/or its activity. This interference prohibits signal-induced I{kappa}B degradation, resulting in the inhibition of NF-{kappa}B nuclear translocation, thus predisposing activated T cells in the tumor milieu to apoptosis.



View larger version (91K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. A549 TSNs inhibit Jurkat cell IKK activity. Jurkat T cells, cultured in control medium or A549 TSNs, were stimulated with PMA plus ionomycin, and IKK activity was compared at the designated time points (ranging from 10–40 min) after stimulation. To assay for IKK activity, the IKKß component was immunoprecipitated from cell lysates, and the kinase activity was measured by assessing recombinant I{kappa}B{alpha} phosphorylation. The cyclical activation and deactivation after phorbol ester stimulation seen under control conditions was absent in Jurkat cells that had been exposed to A549 TSNs.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Complex interactions between the tumor and the host immune system contribute to the development of immunosuppressive networks within the tumor milieu. Immune disarmament occurs (a) by the induction of local and systemic lymphocyte apoptosis or immune non-responsiveness in effector lymphocytes (5 , 8, 9, 10 , 29, 30, 31, 32, 33, 34) , (b) by decreased numbers and function of antigen-presenting cells in the tumor milieu (35, 36, 37, 38) , and (c) by tumor secretion of suppressive cytokines/prostanoids or other soluble factors, as well as by tumor induction of immunosuppressive cytokine secretion by surrounding stroma (37 , 39, 40, 41) . Although these immunosuppressive mechanisms are categorized discretely, the clinically observed deficits that arise are characteristically interrelated. For example, induction of selective cell apoptosis or signaling defects may eventuate in abnormalities in paracrine cytokine secretion. The importance of these cumulative defects is reflected by a predictable poor prognosis in cancer patients who harbor such defects (42)

The molecular and cellular defects underlying clinical tumor-mediated immunosuppression are being gradually unveiled. Tumor-derived factors can subvert effective antitumor cell-mediated immunity (37 , 39, 40, 41) and incapacitate cytotoxic T-cell mediators of cell death (34) through induced apoptosis or signaling defects. A novel mechanism of tumor-derived immunosuppression, one that impairs T-cell survival in the tumor milieu by inhibiting effector cell NF-{kappa}B activation, has recently been described (8, 9, 10) . The renal cell cancer-induced alterations in T-cell NF-{kappa}B activation also appear to be mediated by soluble factors and provided a rationale to investigate whether similar alterations were present in lung cancer. The role of NF-{kappa}B as a survival factor has been extensively described (11 , 12) , and this ubiquitous factor has been implicated in the transcriptional regulation of many inhibitors of apoptosis (43 , 44) .

Preliminary studies suggested that A549 TSNs could induce apoptosis in activated normal donor lymphocytes. To investigate the basis for this observation, we stimulated Jurkat T cells in the presence of tumor cell supernatant as a model for lung cancer-induced alterations in lymphocyte apoptosis. Our data indicate that Jurkat T cells are indeed predisposed to apoptosis after phorbol ester stimulation in the presence of A549 TSNs. Whereas Jurkat T cells under control conditions exhibit predictable kinetics in terms of NF-{kappa}B activation, I{kappa}B degradation, and IKK activity, NF-{kappa}B activation is impaired in the presence of TSNs. Thus, increased T-cell apoptosis after mitogen stimulation is a result of inhibition of NF-{kappa}B activation in the tumor milieu. These data are consistent with those of Uzzo et al. (9 , 10) , as well as with a recent report that incriminates NF-{kappa}B activation as a necessary survival factor for the mitogenic effects of PMA on Jurkat T cells (45) . Furthermore, our studies indicate that the impairment in NF-{kappa}B nuclear translocation is a downstream result of impaired IKK activity, suggesting that factors secreted by NSCLC cells either (a) disable IKK complex formation or (b) directly or indirectly (through signal-mediated events) inhibit IKK activity. The mechanism of IKK inactivation has not yet been elucidated, and it may involve regulatory autophosphorylation or dephosphorylation by activated phosphatases, as suggested by the ability of okadaic acid to activate IKK in mammalian cells (20) .

In summary, these results suggest that tumor-derived soluble factors interfere with IKK activation or regulation in lymphocytes, and this may contribute to enhanced activation-induced T-cell apoptosis in the tumor environment. As such, this is the first report of tumor-mediated enhancement of lymphocyte apoptosis implicating defects in IKK activity, and additional studies are necessary to isolate and define the specific tumor-derived products responsible.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the University of California at Los Angeles-Specialized Programs of Research Excellence in Lung Cancer (NIH Grant P50-90388), NIH Grant R01-CA78654, the Veterans Administration Medical Research Funds, NIH Grant RO1-CA71818, The VA Research Enhancement Award Program in Cancer Gene Medicine, and the University of California at Los Angeles-Jonsson Comprehensive Cancer Center. Back

2 These authors contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at University of California at Los Angeles Lung Cancer Research Program, 37-131 CHS, Division of Pulmonary and Critical Care Medicine, David Geffen School of Medicine at University of California at Los Angeles, 10833 LeConte Avenue, Los Angeles, CA 90095-1690. Phone: (310) 794-6566; Fax: (310) 267-2829; E-mail: sdubinett{at}mednet.ucla.edu Back

4 The abbreviations used are: NSCLC, non-small cell lung cancer; TSN, tumor supernatant; PMA, phorbol 12-myristate 13-acetate; 7-AAD, 7-amino actinomycin; NF-{kappa}B, nuclear factor {kappa}B; IKK, I{kappa}B kinase; PBL, peripheral blood lymphocyte; PMSF, phenylmethylsulfonyl fluoride. Back

Received 7/29/02. Accepted 11/25/02.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Zier K. S., Gansbacher B. The impact of gene therapy on T cell function in cancer. Hum. Gene Ther., 6: 1259-1264, 1995.[Medline]
  2. Kavanaugh D., Carbone D. Immunologic dysfunction in cancer. Hematol. Oncol. Clin. N. Am., 10: 927-951, 1996.[Medline]
  3. Antonia S. J., Extermann M., Flavell R. A. Immunologic nonresponsiveness to tumors. Crit. Rev. Oncog., 9: 35-41, 1998.[Medline]
  4. von Bernstorff W., Voss M., Freichel S., Schmid A., Vogel I., Johnk C., Henne-Bruns D., Kremer B., Kalthoff H. Systemic and local immunosuppression in pancreatic cancer patients. Clin. Cancer Res., 7: 925s-932s, 2001.
  5. Woo E. Y., Yeh H., Chu C. S., Schlienger K., Carroll R. G., Riley J. L., Kaiser L. R., June C. H. Regulatory T cells from lung cancer patients directly inhibit autologous T cell proliferation. J. Immunol., 168: 4272-4276, 2002.[Abstract/Free Full Text]
  6. Woo E. Y., Chu C. S., Goletz T. J., Schlienger K., Yeh H., Coukos G., Rubin S. C., Kaiser L. R., June C. H. Regulatory CD4(+)CD25(+) T cells in tumors from patients with early-stage non-small cell lung cancer and late-stage ovarian cancer. Cancer Res., 61: 4766-4772, 2001.[Abstract/Free Full Text]
  7. Williams N. Tumor cells fight back to beat immune system. Science (Wash. DC), 274: 1302 1996.[Free Full Text]
  8. Ng C. S., Novick A. C., Tannenbaum C. S., Bukowski R. M., Finke J. H. Mechanisms of immune evasion by renal cell carcinoma: tumor-induced T-lymphocyte apoptosis and NF{kappa}B suppression. Urology, 59: 9-14, 2002.
  9. Uzzo R. G., Kolenko V., Froelich C. J., Tannenbaum C., Molto L., Novick A. C., Bander N. H., Bukowski R., Finke J. H. The T cell death knell: immune-mediated tumor death in renal cell carcinoma. Clin. Cancer Res., 7: 3276-3281, 2001.[Abstract/Free Full Text]
  10. Uzzo R. G., Clark P. E., Rayman P., Bloom T., Rybicki L., Novick A. C., Bukowski R. M., Finke J. H. Alterations in NF{kappa}B activation in T lymphocytes of patients with renal cell carcinoma. J. Natl. Cancer Inst. (Bethesda), 91: 718-721, 1999.[Free Full Text]
  11. Van Antwerp D. J., Martin S. J., Kafri T., Green D. R., Verma I. M. Suppression of TNF-{alpha}-induced apoptosis by NF-{kappa}B. Science (Wash. DC), 274: 787-789, 1996.[Abstract/Free Full Text]
  12. Liu Z. G., Hsu H., Goeddel D. V., Karin M. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell, 87: 565-576, 1996.[Medline]
  13. Molitor J. A., Walker W. H., Doerre S., Ballard D. W., Greene W. C. NF-{kappa}B: a family of inducible and differentially expressed enhancer-binding proteins in human T cells. Proc. Natl. Acad. Sci. USA, 87: 10028-10032, 1990.[Abstract/Free Full Text]
  14. Baldwin A. S. J. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol, 14: 649-683, 1996.[Medline]
  15. Baeuerle P. A., Henkel T. Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol., 12: 141-179, 1994.[Medline]
  16. Henkel T., Machleidt T., Alkalay I., Kronke M., Ben-Neriah Y., Baeuerle P. A. Rapid proteolysis of I{kappa}B-{alpha} is necessary for activation of transcription factor NF-{kappa}B. Nature (Lond.), 365: 182-185, 1993.[Medline]
  17. Haskill S., Beg A. A., Tompkins S. M., Morris J. S., Yurochko A. D., Sampson-Johannes A., Mondal K., Ralph P., Baldwin A. S., Jr. Characterization of an immediate-early gene induced in adherent monocytes that encodes I{kappa}B-like activity. Cell, 65: 1281-1289, 1991.[Medline]
  18. Verma I. M., Stevenson J. K., Schwarz E. M., Van Antwerp D., Miyamoto S. Rel/NF-{kappa}B/I{kappa}B family: intimate tales of association and dissociation. Genes Dev., 9: 2723-2735, 1995.[Free Full Text]
  19. Brown K., Gerstberger S., Carlson L., Franzoso G., Siebenlist U. Control of I{kappa}B-{alpha} proteolysis by site-specific, signal-induced phosphorylation. Science (Wash. DC), 267: 1485-1488, 1995.[Abstract/Free Full Text]
  20. DiDonato J. A., Hayakawa M., Rothwarf D. M., Zandi E., Karin M. A cytokine-responsive I{kappa}B kinase that activates the transcription factor NF-{kappa}B. Nature (Lond.), 388: 548-554, 1997.[Medline]
  21. Mercurio F., Zhu H., Murray B. W., Shevchenko A., Bennett B. L., Li J., Young D. B., Barbosa M., Mann M., Manning A., Rao A. IKK-1 and IKK-2: cytokine-activated I{kappa}B kinases essential for NF-{kappa}B activation. Science (Wash. DC), 278: 860-866, 1997.[Abstract/Free Full Text]
  22. Zandi E., Karin M. Bridging the gap: composition, regulation, and physiological function of the I{kappa}B kinase complex. Mol. Cell. Biol., 19: 4547-4551, 1999.[Free Full Text]
  23. Delhase M., Hayakawa M., Chen Y., Karin M. Positive and negative regulation of I{kappa}B kinase activity through IKKß subunit phosphorylation. Science (Wash. DC), 284: 309-313, 1999.[Abstract/Free Full Text]
  24. Philpott N. J., Turner A. J., Scopes J., Westby M., Marsh J. C., Gordon-Smith E. C., Dalgleish A. G., Gibson F. M. The use of 7-amino actinomycin D in identifying apoptosis: simplicity of use and broad spectrum of application compared with other techniques. Blood, 87: 2244-2251, 1996.[Abstract/Free Full Text]
  25. Schmid I., Uittenbogaart C. H., Keld B., Giorgi J. V. A rapid method for measuring apoptosis and dual-color immunofluorescence by single laser flow cytometry. J. Immunol. Methods, 170: 145-157, 1994.[Medline]
  26. Ghosh S., May M. J., Kopp E. B. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16: 225-260, 1998.[Medline]
  27. DiDonato J. A. Assaying for I{kappa}B kinase activity. Methods Enzymol., 322: 393-400, 2000.[Medline]
  28. Zandi E., Rothwarf D. M., Delhase M., Hayakawa M., Karin M. The I{kappa}B kinase complex (IKK) contains two kinase subunits, IKK{alpha} and IKKß, necessary for I{kappa}B phosphorylation and NF-{kappa}B activation. Cell, 91: 243-252, 1997.[Medline]
  29. Whiteside T. L. Signaling defects in T lymphocytes of patients with malignancy. Cancer Immunol. Immunother., 48: 346-352, 1999.[Medline]
  30. Whiteside T. L., Rabinowich H. The role of Fas/FasL in immunosuppression induced by human tumors. Cancer Immunol. Immunother., 46: 175-184, 1998.[Medline]
  31. Walker P. R., Saas P., Dietrich P. Y. Role of Fas ligand (CD95L) in immune escape: the tumor cell strikes back. J. Immunol., 158: 4521-4524, 1997.[Abstract]
  32. Yoshino I., Yano T., Murata M., Ishida T., Sugimachi K., Kimura G., Nomoto K. Tumor-reactive T-cells accumulate in lung cancer tissues but fail to respond due to tumor cell-derived factor. Cancer Res., 52: 775-781, 1992.[Abstract/Free Full Text]
  33. Sakaguchi S. Regulatory T cells: key controllers of immunologic self-tolerance. Cell, 101: 455-458, 2000.[Medline]
  34. Bladergroen B. A., Meijer C. J., ten Berge R. L., Hack C. E., Muris J. J., Dukers D. F., Chott A., Kazama Y., Oudejans J. J., van Berkum O., Kummer J. A. Expression of the granzyme B inhibitor, protease inhibitor 9, by tumor cells in patients with non-Hodgkin and Hodgkin lymphoma: a novel protective mechanism for tumor cells to circumvent the immune system?. Blood, 99: 232-237, 2002.[Abstract/Free Full Text]
  35. Gabrilovich D. I., Chen H. L., Girgis K. R., Cunningham H. T., Meny G. M., Nadaf S., Kavanaugh D., Carbone D. P. Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells [published erratum appears in Nat. Med., 2: 1267, 1996]. Nat. Med., 2: 1096-1103, 1996.[Medline]
  36. Huang M., Sharma S., Mao J. T., Dubinett S. M. Non-small cell lung cancer-derived soluble mediators and prostaglandin E2 enhance peripheral blood lymphocyte IL-10 transcription and protein production. J. Immunol., 157: 5512-5520, 1996.[Abstract]
  37. Huang M., Stolina M., Sharma S., Mao J., Zhu L., Miller P., Wollman J., Herschman H., Dubinett S. Non-small cell lung cancer cyclooxygenase-2-dependent regulation of cytokine balance in lymphocytes and macrophages: up-regulation of interleukin 10 and down-regulation of interleukin 12 production. Cancer Res., 58: 1208-1216, 1998.[Abstract/Free Full Text]
  38. Alleva D. G., Burger C. J., Elgert K. D. Tumor-induced regulation of suppressor macrophage nitric oxide and TNF-{alpha} production: role of tumor-derived IL-10, TGF-ß and prostaglandin E2. J. Immunol., 153: 1674-1686, 1994.[Abstract]
  39. Stolina M., Sharma S., Lin Y., Dohadwala M., Gardner B., Luo J., Zhu L., Kronenberg M., Miller P. W., Portanova J., Lee J. C., Dubinett S. M. Specific inhibition of cyclooxygenase 2 restores antitumor reactivity by altering the balance of IL-10 and IL-12 synthesis. J. Immunol., 164: 361-370, 2000.[Abstract/Free Full Text]
  40. Sharma S., Stolina M., Lin Y., Gardner B., Miller P. W., Kronenberg M., Dubinett S. M. T cell-derived IL-10 promotes lung cancer growth by suppressing both T cell and APC function. J. Immunol., 163: 5020-5028, 1999.[Abstract/Free Full Text]
  41. Sulitzeanu D. Immunosuppressive factors in human cancer. Adv. Cancer Res., 60: 247-267, 1993.[Medline]
  42. Whiteside T. L. Immunobiology and immunotherapy of head and neck cancer. Curr. Oncol. Rep., 3: 46-55, 2001.[Medline]
  43. Goyal L. Cell death inhibition: keeping caspases in check. Cell, 104: 805-808, 2001.[Medline]
  44. Deveraux Q. L., Reed J. C. IAP family proteins: suppressors of apoptosis. Genes Dev., 13: 239-252, 1999.[Free Full Text]
  45. Busuttil V., Bottero V., Frelin C., Imbert V., Ricci J. E., Auberger P., Peyron J. F. Blocking NF-{kappa}B activation in Jurkat leukemic T cells converts the survival agent and tumor promoter PMA into an apoptotic effector. Oncogene, 21: 3213-3224, 2002.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
A. Andersson, S.-C. Yang, M. Huang, L. Zhu, U. K. Kar, R. K. Batra, D. Elashoff, R. M. Strieter, S. M. Dubinett, and S. Sharma
IL-7 Promotes CXCR3 Ligand-Dependent T Cell Antitumor Reactivity in Lung Cancer
J. Immunol., June 1, 2009; 182(11): 6951 - 6958.
[Abstract] [Full Text] [PDF]

Home page
 Exp Biol MedHome page
V. C. Taveira, M. R. C. G. Novaes, M. dos Anjos Reis, and M. F. da Silva
Hematologic and Metabolic Effects of Dietary Supplementation with Agaricus sylvaticus Fungi on Rats Bearing Solid Walker 256 Tumor
Exp Biol Med, November 1, 2008; 233(11): 1341 - 1347.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S.-C. Yang, R. K. Batra, S. Hillinger, K. L. Reckamp, R. M. Strieter, S. M. Dubinett, and S. Sharma
Intrapulmonary Administration of CCL21 Gene-Modified Dendritic Cells Reduces Tumor Burden in Spontaneous Murine Bronchoalveolar Cell Carcinoma.
Cancer Res., March 15, 2006; 66(6): 3205 - 3213.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
G. T. Stathopoulos, Z. Zhu, M. B. Everhart, I. Kalomenidis, W. E. Lawson, S. Bilaceroglu, T. E. Peterson, D. Mitchell, F. E. Yull, R. W. Light, et al.
Nuclear Factor-{kappa}B Affects Tumor Progression in a Mouse Model of Malignant Pleural Effusion
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 142 - 150.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Sharma, L. Zhu, S. C. Yang, L. Zhang, J. Lin, S. Hillinger, B. Gardner, K. Reckamp, R. M. Strieter, M. Huang, et al.
Cyclooxygenase 2 Inhibition Promotes IFN-{gamma}-Dependent Enhancement of Antitumor Responses
J. Immunol., July 15, 2005; 175(2): 813 - 819.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Sharma, S.-C. Yang, L. Zhu, K. Reckamp, B. Gardner, F. Baratelli, M. Huang, R. K. Batra, and S. M. Dubinett
Tumor Cyclooxygenase-2/Prostaglandin E2-Dependent Promotion of FOXP3 Expression and CD4+CD25+ T Regulatory Cell Activities in Lung Cancer
Cancer Res., June 15, 2005; 65(12): 5211 - 5220.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Broderick, S. J. Yokota, J. Reineke, E. Mathiowitz, C. C. Stewart, M. Barcos, R. J. Kelleher Jr., and R. B. Bankert
Human CD4+ Effector Memory T Cells Persisting in the Microenvironment of Lung Cancer Xenografts Are Activated by Local Delivery of IL-12 to Proliferate, Produce IFN-{gamma}, and Eradicate Tumor Cells
J. Immunol., January 15, 2005; 174(2): 898 - 906.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Batra, R. K.
Right arrow Articles by Dubinett, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Batra, R. K.
Right arrow Articles by Dubinett, S. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online