Cancer Research Cancer Health Disparities Conference 2009 SU2C
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krishnan, J.
Right arrow Articles by Sleeman, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krishnan, J.
Right arrow Articles by Sleeman, J. P.
[Cancer Research 63, 713-722, February 1, 2003]
© 2003 American Association for Cancer Research

Tumor Biology

Differential in Vivo and in Vitro Expression of Vascular Endothelial Growth Factor (VEGF)-C and VEGF-D in Tumors and Its Relationship to Lymphatic Metastasis in Immunocompetent Rats1

Jaya Krishnan, Vladimir Kirkin, Anja Steffen, Martin Hegen, Debbie Weih, Stanislav Tomarev, Jörg Wilting and Jonathan P. Sleeman2

Forschungszentrum Karlsruhe, Institute of Genetics, D-76021 Karlsruhe, Germany [J. K., V. K., A. S., M. H., D. W., J. P. S.]; Laboratory of Molecular and Developmental Biology, National Eye Institute, NIH, Bethesda, Maryland 20892 [S. T.]; and Kinderklinik und Poliklinik Göttingen, 37075 Göttingen, Germany [J. W.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The presence of metastases in regional lymph nodes is a strong indicator of poor patient survival. A number of clinical and experimental studies suggest that tumor-induced lymphangiogenesis driven by vascular endothelial growth factor (VEGF)-C- and/or VEGF-D-induced activation of VEGF receptor (VEGFR)-3 may promote metastasis to regional lymph nodes. Here we show that constitutive VEGF-C and VEGF-D expression by tumor cells of diverse origin grown in tissue culture does not correlate with metastatic potential in vivo. However, tumors derived from cell lines that do not constitutively express VEGF-C or VEGF-D in tissue culture can nevertheless express one or both of these factors. We demonstrate that both tumor and stromal cells can contribute to this expression, suggesting that tumor cell-host interactions determine tumor expression of VEGF-C and VEGF-D. Using immunocompetent rat mammary tumor models, we show in two ways that this expression can promote metastasis via the lymphatics. Firstly, ectopic expression of a soluble VEGFR-3 receptor globulin protein in MT-450 tumor cells that are highly metastatic via the lymphatics blocked VEGF-C and VEGF-D activity and suppressed metastasis formation in both the regional lymph nodes and the lungs. Secondly, ectopic expression in the weakly metastatic NM-081 cell line of a mutant form of VEGF-C that is only able to activate VEGFR-3 strongly promoted metastasis of these cells to the regional lymph nodes and lung. These data show that expression of VEGF-C and VEGF-D in tissue culture does not reflect expression in vivo and that activation of VEGFR-3 in the absence of VEGFR-2 activation is sufficient to promote tumor-induced lymphangiogenesis and metastasis, and they support the notion that blockade of VEGFR-3 activation will be useful as a novel form of cancer therapy.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clinically, the most critical point in tumor progression is the acquisition of metastatic potential. The majority of human carcinomas show a predilection for metastasizing at least initially via the lymphatic system (reviewed in Ref. 1 ). Whether or not a tumor has disseminated to regional lymph nodes has a strong influence on the prognosis of cancer patients, and assessment of regional lymph node status is very important in determining the course of cancer therapy. Despite this, most experimental work addressing systemic tumor dissemination has focused on hematogenic spread. Little is known about the mechanism by which tumor cells enter, interact with, and are transported within lymphatic vessels.

Study of the lymphatic system has recently been promoted by the identification of molecules that act as markers of the lymphatic endothelium (reviewed in Ref. 2 ). One of these molecules is a fms-like tyrosine kinase receptor called VEGFR-3.3 VEGFR-3 is activated in response to its ligands, VEGF-C and VEGF-D, causing stimulation of lymphangiogenesis, the new growth of lymphatic vessels.

VEGF-C and VEGF-D are progressively processed during their biosynthesis to remove the NH2- and COOH-terminal ends of the protein, leaving the central VEGF homology domain (3 , 4) . This processing progressively increases the affinity of VEGF-C for VEGFR-3. The fully processed forms are also able to activate VEGFR-2 and therefore have the potential to induce both angiogenesis and lymphangiogenesis. However, mutation of a cysteine residue in the central VEGF homology domain ablates the ability of fully processed VEGF-C to activate VEGFR-2, making this mutated protein a specific activator of VEGFR-3 (5 , 6) .

Whereas the presence or absence of lymphatic vessels inside tumors remains controversial (7) , many studies have demonstrated that an increased density of lymphatic vessels is found in the stromal tissue at the periphery of tumors (8, 9, 10, 11, 12) . Recent studies stress the importance of functional lymphatics at the periphery of tumors (13) . The invasive external margin of tumors is the site where invasion of lymphatic vessels is likely to occur. Thus, the entry of tumor cells into the lymphatic system may be potentiated by the growth of lymphatic vessels in the vicinity of the tumor, which would serve to increase the number of potential entry sites for disseminating tumor cells. If tumors are able to produce VEGF-C and/or VEGF-D, they are therefore likely to be able to promote their entry into the lymphatic system by stimulating lymphangiogenesis in their vicinity. In support of this notion, some studies of clinical material have shown that expression of VEGF-C and/or VEGF-D in primary tumors correlates with their ability to form lymph node metastases [see, for example, the review by Pepper (7) ]. However, some of these studies based their conclusions on cultured tumor cells. It remains unclear whether expression of VEGF-C and VEGF-D in culture accurately represents the in vivo situation.

A number of animal studies using cell lines (14, 15, 16, 17, 18, 19, 20) and transgenic mice (21) have been conducted in an attempt to demonstrate functionally that VEGF-C or VEGF-D overexpression is able to promote tumor metastasis. Whereas these studies indeed show that in some cases expression and activity of these growth factors can be required for metastasis to lymph nodes, a number of open questions remain to be addressed. The forms of VEGF-C and VEGF-D used in the published animal studies had the potential to activate VEGFR-2 in addition to VEGFR-3, and thus it could not be determined whether or not VEGFR-3 activation was specifically responsible for the observed effects on metastasis. Furthermore, virtually all of the animal studies to date used immunocompromised animals, and thus these experiments lacked a major modifier of tumor growth and metastasis that would be found in human patients. From the point of view of possible applications in cancer therapy, it is vital to determine whether blocking the activity of endogenous VEGF-C and VEGF-D in naturally metastatic tumors can inhibit metastasis formation in immunocompetent animals. The aim of the study presented in this paper was to address these issues.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Culture Cell Lines.
The culture conditions and properties of the following cell lines are described in Refs. 22 and 23 : MTLN2; MTLN3; MTC; MTLy; MTPA; AT1; AT2.1; AT3.1; AT6.1; MatLu; MatLyLu; G; ASML; 10AS; 1AS; CREF and its derivatives; NM-081; MT-450; RFS; and BDX2. ARIP, 13762 MAT B III, AR42J, RBA, BRL3A, and L6 were obtained from American Type Culture Collection. RG2 is a rat glioma cell line (24) , RTE2 is a rat tongue epithelial cell line (25) , and NID2 is a neu-transformed rat Schwannoma cell line (26) . Certain passages of tumor cells used in this paper showed altered metastatic potential compared with previously published data (22 , 23) , and this metastatic potential is indicated in Fig. 1Citation . PAE cells expressing VEGFR-3 have been described previously (6) .



View larger version (69K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Northern blot analysis of the expression of VEGF-C and VEGF-D in a panel of rat tumor cell lines grown in tissue culture. GAPDH expression is shown as a loading control. The metastatic potential of each cell line is indicated. Metastasis is graded according to spontaneous metastasis assays as follows: -, no metastases; +, <25% of animals had metastases; ++, 25–75% of animals had metastases; and +++, >75% of animals had metastases. N, no data. RNA molecular size markers are indicated (kb).

 
Tumor Experiments in Vivo.
Syngeneic rats received s.c. injection with 5 x 105 cells in PBS. Animals were monitored regularly until their tumors grew to the German legal limit (50 mm in one dimension), or until they became moribund, at which time they were killed, and an autopsy was performed. For the MT-450 VEGFR-3-Rg experiment in Fig. 5Citation , all of the animals in the different experimental groups were sacrificed and analyzed on the same day. At autopsy, the size of the primary tumor was measured, and the number, size, and location of metastases in the draining lymph nodes and other organs were assessed. Where required, primary tumors were excised carefully and trimmed to remove all of the surrounding tissues, and then chunks of tumor were snap frozen for RNA preparation or cryosectioning. Alternatively, primary tumor material, together with the surrounding tissue, was fixed in 4% paraformaldehyde for paraffin embedding.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Expression of VEGFR-3-Rg decreases the metastatic potential of tumors derived from MT-450 cells. Clones of MT-450 cells stably transfected with either pcDNA3.1 (Control #1 and Control #2) or pcDNA3.1 driving expression of rat VEGFR-3-Rg (VEGFR-3-Rg#1 and VEGFR-3-Rg#2) were injected s.c. into Wistar Furth rats (8 rats/clone). Tumors were allowed to grow for 37 days, and then the animals were killed, and an autopsy was performed. The mean volume of the primary tumor is shown, together with the SE. The mean volume of the axillary lymph nodes (Ax LN) draining the tumors is presented as a measure of metastatic burden in the regional lymph nodes, together with the SE. The number of lung nodules greater than 1 mm in diameter is also shown.

 
Metastasis was defined as lymph nodes of >=10 mm in diameter or lung nodules of >=1 mm in diameter. When these conditions were not met, the lymph nodes and/or lungs were disaggregated and placed into tissues culture in selection medium. If tumor cells grew out of these cultures, the corresponding tissue was classified as having metastases. The lymph nodes and lungs were also analyzed histologically in parallel to determine the presence of metastases. Statistical significance of the results was determined using the Mann-Whitney rank test.

Preparation of a Single Cell Suspension from Tumors.
Tumor-bearing animals were killed by cervical dislocation. All subsequent processing of the tumors was performed at 4°C using ice-cold solutions. Tumors were excised and trimmed, cut into small pieces, and then washed thoroughly in PBS. The tumor pieces were then passed through a stainless steel tissue sieve (Sigma) into PBS. The resulting brei was then passed through a nylon cell strainer with a 40-µm pore size (Falcon). The cell suspension was then washed once in PBS and twice in PEB. The PEB was degassed extensively before use. The cells were then examined and counted under a light microscope. More than 97% of the cells were single cells. The cells were >90% viable, as determined by trypan blue exclusion. The single cell suspension was used immediately for sorting.

Sorting of Tumor Cells from Stromal Cells.
Single cell suspensions of tumor cells from a single tumor were resuspended in 10 ml of PEB (1 x 107 cells/ml) and labeled on ice with primary antibody (10 µg/ml). After washing in ice-cold PEB, the cells were incubated at 4°C with antimouse IgG MACS beads (Miltenyi) and phycoerythrin-labeled antimouse IgG antibodies (Dako) and then separated on a VS+ MACS column (Miltenyi) as described in the manufacturer’s instructions. The bulk of sorted and nonsorted cells were immediately snap frozen in liquid nitrogen and stored until nonfrozen aliquots were subjected to FACS analysis using a Becton Dickinson FACStarPlus machine to check the sorting efficiency. The frozen cells were then used for RNA preparation and RT-PCR analysis.

Semiquantitative RT-PCR Analysis of VEGF-C and VEGF-D Expression.
Sorted and nonsorted tumor cells and corresponding cultured tumor cells were used for total RNA preparation and first-strand cDNA synthesis using Superscript II reverse transcriptase (Life Technologies, Inc.) according to the manufacturer’s instructions. Preliminary RT-PCR experiments were performed to determine linear amplification conditions for the different targets. For VEGF-C, the final cycle parameters used were 94°C, 15 s and 68°C, 4 min (35 cycles). For VEGF-D, the cycle parameters were 95°C, 5 s; 68°C, 15 s; and 72°C, 1 min (32 cycles). For GAPDH, the cycle parameters were 94°C, 1 min; 62°C, 1.5 min; and 72°C, 3 min (30 cycles). The following primer pairs were used: (a) RVEGFCF (GCGAATTCGGACCGGCCTCCTCGCTCCC) and RVEGFCR (GCACCGGTGTTCAGATGTGGTCTTTTCCAATATG) [amplifies nucleotides 54–1332 of rat VEGF-C, GenBank accession number AY032729]; (b) RVEGFDSF (CATCCCTACTCAATTATCAGAAGATCC) and RVEGFDSR (GGCAACAGCTTTCCAGACTTTCTTTGC) [amplifies nucleotides 651–963 of rat VEGF-D, GenBank accession number AY032728]; and (c) GAPDHF (AGACAGCCGCATCTTCTTGTGC) and GAPDHR (CTCCTGGAAGATGGTGATGG) [amplifies nucleotides 23–302 of rat GAPDH, GenBank accession number X02231].

RNA Preparation and Northern Blots.
Tissue culture cells were harvested, washed in PBS, pelleted, and then snap frozen. Polyadenylated RNA was prepared from snap-frozen cells and tumors (27) . Northern blots using 1% agarose-formaldehyde gels and 5 µg of polyadenylated RNA were performed as described previously (27) . Blots were probed sequentially at high stringency using VEGF-C (partial rat VEGF-C cDNA, GenBank accession number AF010302), VEGF-D (complete coding sequence, GenBank accession number AY032728), and GAPDH [PstI fragment of plasmid pGAPDH (28) ] probes. In between each probing, the blots were stripped in 0.1% SDS at 100°C and then exposed to film to ensure complete removal of the probe. To permit the equilibration of signal intensity from one blot to another, identical positive control samples (RNA from BRL3A cells and mammary tissue) were included on each blot.

Cloning of VEGFR-3-Rg and {Delta}N{Delta}C/VEGF-C/Cys152Ser Expression Constructs.
The extracellular portion of rat VEGFR-3 was amplified by PCR from rat spleen cDNA using primers encompassing bases 1–2310 of full-length rat VEGFR-3 (GenBank accession number AF402785).4 The forward and reverse primers used were 5'-atgcagccgggcgctgcgctgaaccggc-3' and 5'-tcttccgagccttctacggccacgctggcggagg-3'. The resulting PCR product was flanked by BamHI and NheI sites for subsequent cloning. The IgG2a heavy chain fragment was amplified by PCR from rat spleen cDNA with the following primers: 5'-ggactgtgaagagttcagagaacc-3' and 5'-ggatccttggccaggaagaggggtaaggg-3'. The resulting PCR product was flanked by NheI and EcoRI sites and encompassed the hinge and the CH2 and CH3 constant heavy chain domains of rat IgG2a. The two fragments were then ligated to the BamHI and EcoRI sites of the pcDNA 3.1+ (Invitrogen) vector in a three-fragment ligation. The resulting rat VEGFR-3/IgG2a heavy chain fusion construct (VEGFR-3-Rg) was sequenced to ensure no PCR artifacts had been introduced.

The {Delta}N{Delta}C/VEGF-C/Cys152Ser insert was cut out of plasmid pAc5.1/His/BiP/{Delta}N{Delta}C/VEGF-C/Cys152Ser (6) and cloned into pSecTag (Invitrogen).

Transfections.
MT-450 and NM-081 cells were stably transfected with the appropriate expression constructs using Tfx50 (Promega) according to the manufacturer’s instructions. For controls, cells were stably transfected with the pcDNA3.1 or pSecTag vectors as appropriate. Stably transfected clones were checked for expression of the transfected expression construct by Western blotting. Clones showing the highest levels of expression were selected for additional experiments.

Generation of Antirat VEGFR-3 Antibodies.
The third and fourth Ig domains of mouse VEGFR-3 were cloned by PCR using mouse spleen cDNA as a template with the following primers: 5'-gcgggatcccagaatgacctgggcccc-3' and 5'-gcgaattcgacgaccacacacttgtac-3'. The resulting PCR fragment corresponding to amino acids 301–530 of SwissProt sequence P35917 was cloned into the pGEX-2T vector, and the construct was used to make VEGFR-3-glutathione S-transferase fusion protein (29) . This fusion protein was used to immunize rabbits according to standard protocols. The resulting bleeds (2622 and 2631) were shown to cross-react with rat and mouse VEGFR-3 in a number of immunoassays.

VEGFR-3 Autophosphorylation Assays.
PAE cells expressing VEGFR-3 were stimulated either in the presence of 200 ng/ml VEGF-C in conditioned medium from mock-transfected cells or in the presence of 200 ng/ml VEGF-C in conditioned medium from cells expressing VEGFR-3-Rg protein. Ligand-induced phosphorylation of VEGFR-3 was then assessed as described previously (6) .

Evan’s Blue Visualization of Lymphatic Vessels in Vivo.
Tumor cells (1 x 106) were injected into the skin of the flank between the inguinal and axillary lymph nodes. After the tumors had grown to between 0.5 and 2 cm in diameter, the rats were sacrificed, and the tumors in the skin of the flank were exposed. Evan’s Blue dye (2.5 mg/ml in PBS) was injected at multiple sites into the skin on the inguinal side of the tumor. Dye injection sites were approximately 1.5 cm removed from the tumor, and 20–50 µl of dye were injected per site. Dye injection was continued along the span of the afferent lymphatics entering the tumor until lymphatic channels draining from the inguinal to the axillary region were marked that did not impinge on the tumor. Lymphatic vessels impinging on the tumor were counted, and the tumor volume was measured. Statistical significance of the results was determined using the Mann-Whitney rank test.

Immunostaining.
Polyclonal anti-Prox1 antibodies were used to stain frozen tumor sections as described previously (30) . Briefly, 20-µm-thick cryosections fixed for 10 min in 100% methanol were incubated for 1 h with Prox1 antiserum diluted 1:500. The secondary Cy3-conjugated goat antirabbit antibody (Dianova, Hamburg, Germany) was applied at a dilution of 1:200 for 1 h. Sections were viewed under a fluorescence microscope.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Proclivity of Lymphatic Metastasis Does Not Correlate with the Constitutive Expression of VEGF-C or VEGF-D by Tumor Cells in Tissue Culture.
To determine whether constitutive VEGF-C or VEGF-D expression in tumor cells in culture reflects the ability of tumor cells to metastasize via the lymphatics in vivo, the expression of VEGF-C and VEGF-D mRNA was examined in a panel of 34 rat tumor cell lines grown in tissue culture (Fig. 1)Citation . VEGF-C is constitutively expressed at relatively high levels in more than 50% of the cell lines. The expression of VEGF-C in the cell lines did not correlate with their metastatic proclivity as assessed by in vivo passaging. VEGF-D was expressed strongly in only one cell line, the pancreatic carcinoma ARIP. Weak VEGF-D expression was observed in a few other cell lines such as BRL3A and CREF. For both VEGF-C and VEGF-D, the size of the transcript expressed by the tumor cells corresponds to the size of the major transcript expressed in nonneoplastic tissues (data not shown). These data demonstrate that lymphangiogenic factors are constitutively expressed in tissue culture by numerous tumor cells of diverse origins, although this expression does not always correlate with the metastatic behavior of the cells. Furthermore, it should be borne in mind that the processing status and thus the activity of the VEGF-C/D protein produced by cells expressing the corresponding mRNA are not addressed in these studies.

VEGF-C and VEGF-D Expression Is Up-Regulated in Certain Rat Tumor Cells in Vivo.
An unexpected finding was that certain tumor cell lines such as MT-450 and MTLN3 that are highly metastatic via the lymphatics in vivo did not express significant amounts of VEGF-C or VEGF-D in culture. However, in situ hybridization analysis demonstrated that tumors derived from these tumor cells exhibit enhanced numbers of VEGFR-3-positive lymphatic vessels at their periphery (data not shown). These observations prompted us to examine whether the expression profile of VEGF-C and VEGF-D in tumor cells grown in tissue culture is maintained in tumors derived from these cells. To this end, a number of the tumor cell lines analyzed in Fig. 1Citation were s.c. injected into syngeneic animals. Primary tumors from these animals were then used for RNA preparation and Northern blot analysis. Surprisingly, we observed up-regulated VEGF-C and VEGF-D expression in some of these tumors. For example, Fig. 2Citation shows VEGF-C and VEGF-D mRNA expression in a selection of mammary carcinoma cell lines passaged in vivo. MTPa and MTC express VEGF-C in tissue culture, but VEGF-D is not significantly expressed (see Fig. 1Citation ), and this pattern is maintained in vivo (Fig. 2)Citation . Similarly, MTLy expresses barely detectable levels of VEGF-C and VEGF-D in tissue culture, and these factors are only weakly detectable in tumors derived from these cells (Figs. 1Citation and 2Citation ). However, MT-450 cells express almost no VEGF-C or VEGF-D in tissue culture, but in MT-450 tumors, VEGF-C expression is moderately up-regulated, and VEGF-D expression is strongly up-regulated (Fig. 2)Citation . Moreover, MTLN3 tumors express VEGF-C and VEGF-D, despite the fact that MTLN3 cells express virtually none of these factors in tissue culture (Figs. 1Citation and 2Citation ).



View larger version (89K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. The expression of VEGF-C and VEGF-D at the RNA level in a panel of mammary tumors. MT-450 cells, MT-450 cells grown in tissue culture; Mammary, mammary gland mRNA. GAPDH expression is shown as a loading control.

 
Tumor Cells and Host-derived Stromal Cells Both Contribute to VEGF-C and VEGF-D Expression in Tumors.
The VEGF-C and VEGF-D we observed to be expressed in tumors derived from cell lines that do not express these factors at significant levels in culture could be derived from up-regulation in the tumor cells themselves or from host-derived stromal cells that constitute part of the tumor. To differentiate between these possibilities, we performed in situ hybridization analysis to look at the cells expressing VEGF-C/D in tumors. Variable levels of hybridization to both tumor cells and stromal components could be observed, with focal areas of the tumors showing stronger expression than others (data not shown). To substantiate these results, we disaggregated MT-450 and MTLN3 tumors into single cell suspensions and used antibodies specific for the tumor cells to separate the tumor cells from the host-derived stromal cells using MACS. The anti-CD44v6 antibody 1.1ASML binds specifically to MTLN3 cells and not to stromal components (Ref. 31 ; data not shown), whereas the M-N#1 antibody binds specifically to MT-450 tumor cells and not to stromal cells (23) . Aliquots of sorted cells were checked by FACS analysis to determine the sorting efficiency (Fig. 3A)Citation . RNA was extracted from the remaining cells and subjected to semiquantitative RT-PCR analysis to determine in which compartment VEGF-C and VEGF-D are expressed (Fig. 3B)Citation . These data demonstrate that both tumor and stromal components contribute to the VEGF-C/D expression seen in the tumors, in stark contrast to the lack of expression observed in the corresponding cultured tumor cells. Similar results were obtained in three independent experiments.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. VEGF-C and VEGF-D are expressed in both tumor and stromal cells. A, disaggregated cells from MTLN3 tumors and MT-450 tumors were incubated with 1.1ASML and M-N#1 antibodies, respectively. MACS sorting was then used to separate the positively stained tumor cells from the nonstained stromal cells. FACS analysis was performed to show the antibody staining characteristics of the cell populations before (Total stained cells) and after (Negative stromal cells, Positive tumor cells) MACS sorting. Plots of relative fluorescence intensity (abscissa, log scale) against cell number (ordinate, linear scale) are shown. The open trace represents background staining (secondary reagent only), whereas the shaded trace represents staining with the indicated reagent. B, RT-PCR analysis of VEGF-C, VEGF-D, and GAPDH expression in the sorted cell populations. Tumor cells grown in culture (Culture) and unsorted tumor cells (Tumor) were analyzed together with sorted positively stained tumor cells (+ ve) and nonstained stromal cells (- ve). A negative control RT-PCR reaction was also performed (H2O), in which water was added to the PCR reaction instead of cDNA.

 
Blockade of VEGF-C and VEGF-D Activity in MT-450 Tumors Inhibits Their Ability to Metastasize.
Several studies show that fusion of the extracellular portion of growth factor receptors with IgG heavy chains enforces dimerization of the receptor, resulting in a soluble protein that binds with high affinity to its cognate ligand. These Rg molecules can therefore be used to block activation of the corresponding cellular receptor by sequestering the ligand (e.g., Ref. 32 ). Such an approach with VEGFR-3 has recently been published, and it shows that blockade of VEGFR-3 activation inhibits lymphangiogenesis during embryogenesis (33) and in tumors grown on the avian chorioallantois (34) .

We took a similar approach to block VEGF-C/D-induced activation of VEGFR-3 in the context of tumors to determine what effect this has on tumor-induced lymphangiogenesis and tumor metastasis in immunocompetent rats. We created a construct in which the extracellular portion of rat VEGFR-3 is fused with the rat IgG2a heavy chain. Expression of this construct in cells resulted in the secretion of a dimeric molecule that was very effectively in blocking VEGF-C/D-induced activation of VEGFR-3 in cellular assays (Fig. 4)Citation .



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Characterization of rat VEGFR-3-Rg proteins. A, dimerization of VEGFR-3-Rg. Conditioned medium from mock-transfected cells (Mock) or cells transfected with VEGFR-3-Rg was subjected to SDS-PAGE under reducing (Red.) and nonreducing (Non-red) conditions and then Western blotted. Blots were probed with 2631 anti-VEGFR-3 antibodies. B, VEGFR-3-Rg blocks VEGF-C-induced phosphorylation of VEGFR-3. PAE cells expressing VEGFR-3 were incubated with conditioned medium from mock-transfected cells (VEGF-C) or cells expressing VEGFR-3-Rg (VEGF-C/Rg). Recombinant VEGF-C (200 ng/ml) was added, and after 15 min, the cells were harvested and immunoprecipitated with VEGFR-3 antibodies. Immunoprecipitates were Western blotted and probed with anti-phosphotyrosine antibodies. Blots were then stripped and reprobed with VEGFR-3 for a loading control.

 
Stably transfected clones of MT-450 cells expressing the VEGFR-3-Rg protein were s.c. injected into the flank of syngeneic animals, and tumors were allowed to develop. Animals were sacrificed after 37 days, and the tumor volume and number of metastases were analyzed in comparison with those of animals receiving vector control-transfected MT-450 cells (Fig. 5)Citation . The growth of the primary tumor was not affected by expression of VEGFR-3-Rg. However, the size of the tumors in the draining axillary lymph nodes (P < 0.001) and the number of metastatic nodules in the lung (P < 0.001) were significantly reduced.

Expression of VEGFR-3-Rg in MT-450 Tumors Reduces the Number of Peritumor Lymphatic Vessels.
One explanation for the data in Fig. 5Citation would be that expression of VEGFR-3-Rg neutralized the activity of tumor-produced VEGF-C/D and that tumor-induced lymphangiogenesis was thereby suppressed, decelerating the rate of onset of lymphatic metastasis. To determine whether this is indeed the case, we looked directly at the number of lymphatic vessels in the periphery of MT-450 tumors expressing or not expressing VEGFR-3-Rg.

Due to the possible unreliability of certain markers of the lymphatic endothelium in the context of tumors (2) , we chose first to directly visualize lymphatic vessels afferent to the tumors. The rationale of this approach is that the number of these vessels will increase in proportion to the activity of lymphangiogenic factors in and around the tumor. To this end, we s.c. injected MT-450 cells expressing or not expressing VEGFR-3-Rg into the flank between the inguinal and axillary lymph nodes. After they had grown, the tumors in the skin of the flank were exposed. Evan’s Blue dye was injected at multiple sites into the skin on the inguinal side of the tumor to delineate the lymphatic vessels impinging upon the tumor and enable them to be counted. Dye injection sites were approximately 1.5 cm removed from the tumor, forming a line spanning the complete afferent lymphatics able to impinge upon the tumor. This was ensured by continuing injecting above and below the tumor until lymphatic channels draining from the inguinal to the axillary region that did not impinge on the tumor were marked (see Figs. 6Citation and 8Citation ). Several observations demonstrate that lymphatic vessels and not blood vessels were delineated by this method: (a) dye always entered vessels draining in the inguinal-axillary direction and not in the reverse direction, as would be expected for blood vessels; (b) blood vessels around the tumor could be clearly seen and were never filled with dye, and dye-filled vessels often ran along side and parallel to blood vessels (see Fig. 8Citation ); and (c) dye-filled vessels drained directly to the axillary lymph node and stained it blue (see Fig. 8Citation ).



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Expression of VEGFR-3-Rg decreases the number of lymphatic vessels impinging on MT-450 tumors. Clones of MT-450 cells stably transfected with either pcDNA3.1 (Control #1 and Control #2) or pcDNA3.1 driving expression of rat {Delta}N{Delta}C/VEGF-C/Cys152Ser (VEGFR-3-Rg#1 and VEGFR-3-Rg#2) were injected s.c. into Wistar Furth rats. The resulting tumors were allowed to grow to 0.5–2 cm in diameter. They were then exposed, and Evan’s Blue dye was injected as described in the text to delineate lymphatic vessels. A, example of an Evan’s Blue dye injection experiment to identify lymphatic vessels impinging on a tumor derived from MT-450 cells transfected with the empty pcDNA3.1 vector. B, typical field of view of Prox1 staining of sections of MT-450 tumors at the tumor (T)-host (H) interface. White arrowheads indicate some of the lymphatic vessels with Prox1-positive nuclei. C, example of an Evan’s Blue dye injection experiment to identify lymphatic vessels impinging on tumors derived from MT-450 cells ectopically expressing rat VEGFR-3-Rg. D, typical field of view of Prox1 staining of sections of MT-450-VEGFR-3-Rg tumors at the tumor (T)-host (H) interface, demonstrating the much reduced lymphatic vessel density in these tumors. The white arrowhead indicates a lymphatic vessel with Prox1-positive nuclei. The blue arrowheads point to Prox1-negative blood vessels. E, quantification of lymphatic vessels impinging on tumors derived from the different NM-081 clones (vessel number) compared with the volume of the tumors. Values shown are the mean and SE of the number of lymphatic vessels counted. The number of tumors analyzed is indicated. Bar (B and D), 100 µm.

 


View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 8. Expression of {Delta}N{Delta}C/VEGFC/Cys152Ser increases the number of lymphatic vessels impinging on NM-081 tumors. Clones of NM-081 cells stably transfected with either pSecTag (Control #1 and Control #2) or pSecTag driving expression of rat {Delta}N{Delta}C/VEGF-C/Cys152Ser (VEGF-C Cys#1 and VEGF-C Cys#2) were injected s.c. into Wistar Furth rats. The resulting tumors were allowed to grow to 0.5–2 cm in diameter. They were then exposed, and Evan’s Blue dye was injected as described in the text to delineate lymphatic vessels. A, example of an Evan’s Blue dye injection experiment to identify lymphatic vessels impinging on NM-081 cells transfected with the empty pSecTag vector. The black arrowhead shows the axillary lymph node that drains the tumor and is stained blue with the Evan’s Blue dye. B, typical field of view of Prox1 staining of sections of NM-081 tumors at the tumor (T)-host (H) interface. C, example of an Evan’s Blue dye injection experiment to identify lymphatic vessels impinging on NM-081 cells ectopically expressing rat {Delta}N{Delta}C/VEGF-C/Cys152Ser. The black arrowhead indicates lymphatic vessels running in parallel with blood vessels. The lymphatic vessels specifically take up the Evan’s Blue dye, whereas the blood vessels do not. D, typical field of view of Prox1 staining of sections of NM-081-{Delta}N{Delta}C/VEGF-C/Cys152Ser tumors at the tumor (T)-host (H) interface, demonstrating the much increased lymphatic vessel density in these tumors. White arrowheads indicate some of the lymphatic vessels with Prox1-positive nuclei. E, quantification of lymphatic vessels impinging on tumors derived from the different NM-081 clones (vessel number) compared with the volume of the tumors. The mean and SE of the number of lymphatic vessels counted are shown. The number of tumors analyzed is indicated. Bar (B and D), 100 µm.

 
Preliminary experiments showed that the number of lymphatic vessels draining tumors is proportional to the size of the tumor. We therefore carefully matched the sizes of the tumors measured in the different groups to ensure that no bias was introduced into the measurements. In experiments with larger numbers of tumors, expression of VEGFR-3-Rg in MT-450 tumors clearly reduced the number of afferent lymphatic vessels (Fig. 6, A, C, and E)Citation , suggesting that the VEGFR-3-Rg had indeed neutralized lymphangiogenic factors in the peritumoral region (P < 0.001).

To verify the data obtained in the experiments with Evan’s Blue dye, we took sections of MT-450 tumors expressing or not expressing VEGFR-3-Rg and immunohistochemically stained them with antibodies against Prox1, a marker of the lymphatic endothelium (30 , 35) . In tumors derived from empty vector-transfected MT-450 cells, a high density of Prox1-positive lymphatic vessels was observed at the periphery of the tumors (Fig. 6B)Citation . It was often possible to see Prox1-positive lymphatic vessels filled with tumor cells (data not shown). Prox1-positive lymphatic vessels were only observed at the periphery of the tumors and were not observed intratumorally. Expression of VEGFR-3-Rg depressed the number of lymphatic vessels that could be detected in the vicinity of MT-450 tumors (Fig. 6D)Citation , consistent with findings from the Evan’s Blue dye injections.

Activation of VEGFR-3 Is Sufficient to Promote Lymphangiogenesis and Lymphatic Metastasis.
We have previously reported a fully processed form of rat VEGF-C ({Delta}N{Delta}C/VEGF-C/Cys152Ser) that has a cysteine to serine mutation and is able to activate VEGFR-3 but not VEGFR-2 (6) . To address whether specific activation of VEGFR-3 is sufficient in the context of a tumor to promote tumor metastasis, we set out to overexpress rat {Delta}N{Delta}C/VEGF-C/Cys152Ser in weakly metastatic NM-081 mammary carcinoma cells and determine what effect this had on metastasis formation. These cells do not endogenously express VEGF-C or VEGF-D (Fig. 1)Citation .

We stably expressed rat {Delta}N{Delta}C/VEGF-C/Cys152Ser in NM-081 cells. Clones expressing {Delta}N{Delta}C/VEGF-C/Cys152Ser were injected s.c. into syngeneic animals, and tumors were allowed to develop. Animals were sacrificed when they became moribund, or when the size of their primary tumor reached the legal limit. Autopsy was then performed, and the number of metastases was analyzed in comparison with animals receiving vector control-transfected NM-081 cells. All animals bearing tumors expressing {Delta}N{Delta}C/VEGF-C/Cys152Ser had lymph node and lung metastases. Only one animal from the control groups had a lymph node metastasis, and no animal had lung metastases. Correspondingly, expression of {Delta}N{Delta}C/VEGF-C/Cys152Ser dramatically increased the size of lymph node metastases (P < 0.001) and the number of lung nodules (P < 0.001; Fig. 7Citation ).



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 7. Expression of {Delta}N{Delta}C/VEGF-C/Cys152Ser increases the metastatic potential of tumors derived from NM-081 cells. Clones of NM-081 cells stably transfected with either pSecTag (Control #1 and Control #2) or pSecTag driving expression of rat {Delta}N{Delta}C/VEGF-C/Cys152Ser (VEGF-C Cys#1 and VEGF-C Cys#2) were injected s.c. into Wistar Furth rats (8 rats/clone). Tumors were allowed to grow until they reached the German legal limit, or until the rats became moribund. At this point, the animals were killed, and an autopsy was performed. The mean volume of the axillary lymph nodes (Ax LN) draining the tumors is presented as a measure of metastatic burden in the regional lymph nodes, together with the SE. The number of lung nodules greater than 1 mm in diameter is also shown, together with the SE.

 
To determine whether {Delta}N{Delta}C/VEGF-C/Cys152Ser expression also increases the number of peritumoral lymphatic vessels, we performed Evan’s Blue dye injection experiments and immunohistochemistry for Prox1 as described above. Indeed, the number of afferent lymphatic vessels is strongly promoted by the expression of {Delta}N{Delta}C/VEGFC/Cys152Ser in NM-081 tumors (Fig. 8, A, B, and ECitation ; P < 0.001). Whereas it was rare to see Prox1-positive vessels at the periphery of control NM-081 tumors, significant numbers of Prox1-positive lymphatic vessels were observed at the periphery of {Delta}N{Delta}C/VEGF-C/Cys152Ser-expressing tumors (Fig. 8, C and D)Citation . Again, Prox1-positive lymphatic vessels were only observed at the periphery of the tumors and were not observed intratumorally. VEGF-C overexpression has been reported in some instances to induce lymphatic hyperplasia, resulting in the formation of lymphatic lacunae (21 , 36) . However, we saw little evidence of this in the Prox1-stained histological sections; rather, we saw increased numbers of capillaries. Thus, specific activation of VEGFR-3 alone by tumor-derived {Delta}N{Delta}C/VEGF-C/Cys152Ser suffices to induce lymphangiogenesis and lymphatic metastasis.


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The lymphatic endothelium that forms or lines lymphatic vessels has loose intercellular junctions that readily permit the passage of large biological macromolecules, pathogens, and migrating cells, and lymphatic capillaries have no or at best only an incomplete basement membrane (reviewed in Ref. 2 ). These features make the lymphatic system an easily available target for tumor cell entry into the circulatory system compared with blood capillaries. Tumor-induced lymphangiogenesis would increase the density of potential entry sites for tumor cells to access the lymphatic system and is thus one mechanism by which the metastasis of tumor cells could be potentiated. In support of this notion, we show here using immunocompetent rat tumor models that the activity of the lymphangiogenic factors VEGF-C and VEGF-D in tumors promotes tumor metastasis to regional lymph nodes and at the same time stimulates an increase in peritumoral lymphatic vessels. Specifically, expression of a VEGF-C mutant that is only capable of activating VEGFR-3 is sufficient to promote both peritumoral lymphangiogenesis and lymphatic metastasis, whereas neutralization of endogenous VEGF-C and VEGF-D activity in tumors inhibits both tumor metastasis and the formation of peritumoral lymphatic vessels. We provide evidence that tumor cell-host interactions can determine the expression levels of VEGF-C and VEGF-D in tumors.

In the animal experiments presented in this paper, blockade of VEGF-C/D activity reduced the size of lymph nodes metastases, whereas ectopic expression of {Delta}N{Delta}C/VEGF-C/Cys152Ser had the reverse effect. It is unlikely that the modulation of metastatic proclivity caused by changes in VEGF-C/D activity is caused by differences in the growth rates of the tumor cells. The matched cell clones used in these experiments, which either expressed recombinant protein or were transfected with empty vector, proliferated equivalently in culture, and we observed no consistent changes in onset of tumor formation or size of tumors developing from these matched cell clones. For example, in Fig. 5Citation , expression or nonexpression of VEGFR-3-Rg in MT-450 cells had no significant effect on the growth of primary tumors derived from these cells. Thus, the observation that VEGFR-3-Rg reduced the size of metastases in the draining lymph node suggests that as reduction in VEGF-C/D activity by VEGFR-3-Rg decreased peritumoral lymphatic vessel density, disseminating MT-450 tumor cells were at least temporally retarded from entering the lymphatics, and thus the onset of metastasis was slowed, resulting in smaller metastases at autopsy. Conversely, the enhanced peritumoral lymphatic vessel density caused by expression of {Delta}N{Delta}C/VEGF-C/Cys152Ser in NM-081 tumors suggests that the greatly increased numbers and size of regional lymph node metastases were facilitated by enhanced entry of tumor cells into the lymphatics.

Modulation of VEGF-C/D activity also influenced the number of metastatic lung colonies that developed. Lymph node metastases grow to a significant size before lung nodules can be detected macroscopically or histologically in the MT-450 and NM-081 models (data not shown), suggesting that lung metastases are seeded from lymph node metastases that shed tumor cells into the blood. This notion is supported by two other observations: (a) NM-081 tumors did not give rise to lung metastases in the absence of lymph node metastases; and (b) MT-450 lung metastasis formation was blocked by VEGFR-3-Rg expression. We therefore suggest that the number of lung metastases that develop in these animal models is directly related to the ability of the primary tumor to give rise to lymph node metastases, which in turn is dependent on the activity of VEGF-C/D in the tumors.

While this paper was under review, He et al. (20) published results similar to ours in which they showed that VEGFR-3-Rg was able to reduce the metastasis of a human lung carcinoma cell line from a s.c. site to regional lymph nodes in immunocompromised mice. However, in contrast to our results, lung metastasis formation was not affected by VEGFR-3-Rg. A possible explanation for this difference is as follows. In the case of our experiments, we propose that lymph node metastases act as bridgeheads for the formation of lung metastases (see Ref. 1 ). For a variety of reasons, it is easier for tumor cells to form metastases in lymph nodes than in organs such as the lung. Primary tumors are comprised of a heterogenous population of tumor cells, few of which have the ability to successfully form metastases. Lymph nodes metastases represent expanded populations of tumor cells selected on the basis of their ability to metastasize. These cells therefore have at least some of the properties required for further successful metastasis to organs such as the lung. Most of the cells directly entering the bloodstream from the primary tumor do not have these properties, and therefore lung metastasis is much more likely to occur when lymph node metastases have already formed and are seeding cells into the bloodstream. Thus, in our experiments, inhibition of lymph node metastasis formation also inhibited lung metastasis formation. On the other hand, He et al. (20) used lung carcinoma cells in their experiments. The cellular origin of the tumor cells may have meant that circulating tumor cells were able to grow selectively in their native environment of the lung, and thus lung metastases formed without the need for preceding lymph node metastases. Thus, in this case, VEGFR-3-Rg-mediated inhibition of lymph node metastasis did not inhibit lung metastasis formation.

He et al. (20) also ectopically expressed VEGF-C in weakly metastatic lung carcinoma cells. Whereas this resulted in increased peritumor lymphangiogenesis, metastasis to lymph nodes was not enhanced, as was also reported by Karparnen et al. (17) using mammary carcinoma cells. However, several other publications agree with our finding that tumor-induced lymphangiogenesis is able to promote metastasis to lymph nodes (14, 15, 16, 17, 18, 19) . One explanation for these differences is that some tumor lines need to acquire additional cellular properties before being able to metastasize via an expanded lymphatic capillary bed.

Several studies have examined VEGF-C or VEGF-D expression in cultured human cell lines and made conclusions on this basis about the relevance of these factors to metastasis formation and patient prognosis. Our data clearly show, however, that expression of these factors in tissue culture often has no bearing on their in vivo expression or on the metastatic competence of the tumor cells. Furthermore, host cells may contribute to or are responsible for VEGF-C/D production in some tumors. Therefore, expression of these growth factors in tissue culture cannot be reliably extrapolated to the in vivo situation.

In addition to stimulating lymphangiogenesis, VEGF-C and VEGF-D may also contribute to angiogenesis. The fully processed forms of VEGF-C and VEGF-D have the ability to activate VEGFR-2, although they are bound with lower affinity by VEGFR-2 compared with VEGFR-3 (3 , 4) . VEGFR-2 plays an important role in tumor angiogenesis (37 , 38) , and the secretion by tumors of VEGF-C and VEGF-D could therefore also play a part in tumor angiogenesis. However, VEGF-C and VEGF-D do not always induce angiogenesis. For example, transgenic expression of VEGF-C in the skin of mice stimulated lymphangiogenesis in the dermis but did not result in new blood vessel growth (39) . Moreover, when recombinant VEGF-C was placed on the chick chorioallantoic membrane, lymphangiogenesis was stimulated far more efficiently than hemangiogenesis (40) . On the other hand, VEGF-C induces angiogenesis in the context of tissue ischemia (41) , in the cornea (42) , and in an in vitro angiogenesis assay (43) . Thus the context of expression of VEGF-C and VEGF-D may be critical in determining the angiogenic response, in addition to the processing status.

VEGFR-3 can be expressed on blood capillaries in the tumor context (44) . Furthermore, it has been shown that VEGF-C/D expression promotes angiogenesis in the context of some tumors (e.g., Refs. 16 and 45 ), but not others (e.g., Ref. 21 ). Using PECAM-1 staining, we were unable to observe any significant difference in intratumor blood vessel density between tumors expressing VEGFR-3-Rg (MT-450) or VEGF-C/Cys152Ser (NM-081) and the respective parental tumors (data not shown).

Like VEGF-C and VEGF-D, VEGF, a pivotal inducer of tumor angiogenesis, is also expressed in tumors by both tumor and stromal cells (reviewed in Ref. 46 ). The expression of these factors in stromal cells suggests that the cellular makeup of the tumor stroma has an influence on the lymphangiogenic (and angiogenic) response of the host to the tumor. Because fibroblasts constitute a major component of the intratumor stromal cell population, our finding that stromal cells can contribute to the expression of VEGF-C and VEGF-D in tumors is perhaps not surprising. VEGF-D was first identified in murine fibroblasts as figf, a gene induced by the proto-oncogene c-fos (47) . Moreover, we see constitutive VEGF-C expression in rat embryonic fibroblasts (CREF, Fig. 4Citation ) and in murine 3T3 cells (data not shown). Furthermore, it was recently shown that tumor-associated macrophages can express VEGF-C/D (48) . Our observation that tumor cells may not express VEGF-C/VEGF-D in culture but do so within tumors also suggests that the molecular constituents of the tumor microenvironment may be critical in determining the expression of these factors. It has been shown, for example, that the pro-inflammatory cytokine interleukin 1ß, which is expressed in certain tumors (49) , can up-regulate VEGF-C expression (50) .

Our data and that of others suggest that expression of VEGF-C and VEGF-D promotes tumor metastasis. We have demonstrated with our VEGFR-3-Rg experiments in immunocompetent animals that blockade of the activity of these factors might have therapeutic potential for cancer. Such therapies would have the potential to reduce the incidence of metastasis after the onset of treatment, although it is unlikely that the growth of preexisting metastases would be affected. Chronic blockade of VEGFR-3 activation may also be useful for several types of slow-growing, relatively benign tumors, where no clinical intervention is made in cases in which it is not clear whether the potential dangers and costs associated with intervention are justified. The risk of this type of decision is that the tumor progresses and metastasizes, which has a serious implication for the prognosis of the patient. In the case of stage T1a prostate tumors, for example, progression rates of 16–25% at 8–10 years have been reported in cases where no treatment is given (51) . Chronic administration of inhibitors of tumor metastasis may therefore be of use in treating these and similar tumor types.

In conclusion, our data demonstrate that the secretion of the lymphangiogenic factors VEGF-C and VEGF-D can induce lymphangiogenesis and that this is one mechanism whereby metastasis via the lymphatic system can be potentiated. Other mechanisms that could also contribute to lymphatic metastasis include chemotactic or chemokinetic stimulation of tumor cells to enter the lymphatics and the passive transport of tumor cells into the lymphatics through interstitial fluid flow. Future work will be directed at functionally determining the contribution of each of these mechanisms to lymphatic metastasis.


   ACKNOWLEDGMENTS
 
We thank Monika Pech for excellent technical assistance, Norma Howells and Andrea D’ercole for animal care, and Hartmut Richter for the kind gift of RTE2 cells. The assistance of Markus Breig with animal photography is gratefully acknowledged.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Deutsche Forschungsgemeinschaft (to J. P. S.) under the auspices of Schwerpunktprogramm 1069 (Angiogenese). Back

2 To whom requests for reprints should be addressed, at Forschungszentrum Karlsruhe, Institute of Genetics, P. O. Box 3640, D-76021 Karlsruhe, Germany. Phone: 49-7247-82-6089; Fax: 49-7247-82-3354; E-mail sleeman{at}itg.fzk.de Back

3 The abbreviations used are: VEGFR, vascular endothelial growth factor receptor; VEGF, vascular endothelial growth factor; Rg, receptor globulin; FACS, fluorescence-activated cell-sorting; MACS, magnetic cell sorting; PEB, PBS, 2 mM EDTA, and 0.5% BSA; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

4 J. Krishnan and J. Sleeman, unpublished observations. Back

Received 6/17/02. Accepted 12/ 2/02.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sleeman J. P. The lymph node as a bridgehead in the metastatic dissemination of tumors. Recent Results Cancer Res., 157: 55-81, 2000.[Medline]
  2. Sleeman J. P., Krishnan J., Kirkin V., Baumann P. Markers for the lymphatic endothelium: in search of the holy grail?. Microsc. Res. Tech., 55: 61-69, 2001.[Medline]
  3. Joukov V., Sorsa T., Kumar V., Jeltsch M., Claesson-Welsh L., Cao Y., Saksela O., Kalkkinen N., Alitalo K. Proteolytic processing regulates receptor specificity and activity of VEGF-C. EMBO J., 16: 3898-3911, 1997.[Medline]
  4. Achen M. G., Jeltsch M., Kukk E., Makinen T., Vitali A., Wilks A. F., Alitalo K., Stacker S. A. Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4). Proc. Natl. Acad. Sci. USA, 95: 548-553, 1998.[Abstract/Free Full Text]
  5. Joukov V., Kumar V., Sorsa T., Arighi E., Weich H., Saksela O., Alitalo K. A recombinant mutant vascular endothelial growth factor-C that has lost vascular endothelial growth factor receptor-2 binding, activation, and vascular permeability activities. J. Biol. Chem., 273: 6599-6602, 1998.[Abstract/Free Full Text]
  6. Kirkin V., Mazitschek R., Krishnan J., Steffen A., Waltenberger J., Pepper M. S., Giannis A., Sleeman J. P. Characterization of indolinones which preferentially inhibit VEGF-C- and VEGF-D-induced activation of VEGFR-3 rather than VEGFR-2. Eur. J. Biochem., 268: 5530-5540, 2001.[Medline]
  7. Pepper M. S. Lymphangiogenesis and tumor metastasis: myth or reality?. Clin. Cancer Res., 7: 462-468, 2001.[Abstract/Free Full Text]
  8. Hartveit E. Attenuated cells in breast stroma: the missing lymphatic system of the breast. Histopathology, 16: 533-543, 1990.[Medline]
  9. Lubach D., Berens von Rautenfeld D., Kaiser H. E. The possible role of the initial lymph vessels of the skin during metastasis of malignant tumors. In Vivo, 6: 443-450, 1992.[Medline]
  10. Yoshizawa M., Shingaki S., Nakajima T., Saku T. Histopathological study of lymphatic invasion in squamous cell carcinoma (O-1N) with high potential of lymph node metastasis. Clin. Exp. Metastasis, 12: 347-356, 1994.[Medline]
  11. Jussila L., Valtola R., Partanen T. A., Salven P., Heikkila P., Matikainen M. T., Renkonen R., Kaipainen A., Detmar M., Tschachler E., Alitalo R., Alitalo K. Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor-3. Cancer Res., 58: 1599-1604, 1998.[Abstract/Free Full Text]
  12. Leu A. J., Berk D. A., Lymboussaki A., Alitalo K., Jain R. K. Absence of functional lymphatics within a murine sarcoma: a molecular and functional evaluation. Cancer Res., 60: 4324-4327, 2000.[Abstract/Free Full Text]
  13. Padera T. P., Kadambi A., di Tomaso E., Carreira C. M., Brown E. B., Boucher Y., Choi N. C., Mathisen D., Wain J., Mark E. J., Munn L. L., Jain R. K. Lymphatic metastasis in the absence of functional intratumor lymphatics. Science (Wash. DC), 296: 1883-1886, 2002.[Abstract/Free Full Text]
  14. Skobe M., Hamberg L. M., Hawighorst T., Schirner M., Wolf G. L., Alitalo K., Detmar M. Concurrent induction of lymphangiogenesis, angiogenesis, and macrophage recruitment by vascular endothelial growth factor-C in melanoma. Am. J. Pathol., 159: 893-903, 2001.[Abstract/Free Full Text]
  15. Skobe M., Hawighorst T., Jackson D. G., Prevo R., Janes L., Velasco P., Riccardi L., Alitalo K., Claffey K., Detmar M. Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat. Med., 7: 192-198, 2001.[Medline]
  16. Stacker S. A., Caesar C., Baldwin M. E., Thornton G. E., Williams R. A., Prevo R., Jackson D. G., Nishikawa S., Kubo H., Achen M. G. VEGF-D promotes the metastatic spread of tumor cells via the lymphatics. Nat. Med., 7: 186-191, 2001.[Medline]
  17. Karpanen T., Egeblad M., Karkkainen M. J., Kubo H., Yla-Herttuala S., Jaattela M., Alitalo K. Vascular endothelial growth factor C promotes tumor lymphangiogenesis and intralymphatic tumor growth. Cancer Res., 61: 1786-1790, 2001.[Abstract/Free Full Text]
  18. Yanai Y., Furuhata T., Kimura Y., Yamaguchi K., Yasoshima T., Mitaka T., Mochizuki Y., Hirata K. J. Vascular endothelial growth factor C promotes human gastric carcinoma lymph node metastasis in mice. Exp. Clin. Cancer Res., 20: 419-428, 2001.[Medline]
  19. Mattila M. M., Ruohola J. K., Karpanen T., Jackson D. G., Alitalo K., Harkonen P. L. VEGF-C-induced lymphangiogenesis is associated with lymph node metastasis in orthotopic MCF-7 tumors. Int. J. Cancer, 98: 946-951, 2002.[Medline]
  20. He Y., Kozaki K., Karpanen T., Koshikawa K., Yla-Herttuala S., Takahashi T., Alitalo K. Suppression of tumor lymphangiogenesis and lymph node metastasis by blocking vascular endothelial growth factor receptor 3 signaling. J. Natl. Cancer Inst. (Bethesda), 94: 819-825, 2002.[Abstract/Free Full Text]
  21. Mandriota S. J., Jussila L., Jeltsch M., Compagni A., Baetens D., Prevo R., Banerji S., Huarte J., Montesano R., Jackson D. G., Orci L., Alitalo K., Christofori G., Pepper M. S. Vascular endothelial growth factor-C-mediated lymphangiogenesis promotes tumor metastasis. EMBO J., 20: 672-682, 2001.[Medline]
  22. Sleeman J. P., Arming S., Moll J. F., Hekele A., Rudy W., Sherman L. S., Kreil G., Ponta H., Herrlich P. Hyaluronate-independent metastatic behavior of CD44 variant-expressing pancreatic carcinoma cells. Cancer Res., 56: 3134-3141, 1996.[Abstract/Free Full Text]
  23. Sleeman J. P., Kim U., LePendu J., Howells N., Coquerelle T., Ponta H., Herrlich P. Inhibition of MT-450 rat mammary tumour growth by antibodies recognising subtypes of blood group antigen B. Oncogene, 18: 4485-4494, 1999.[Medline]
  24. Wechsler W., Ramadan M. A., Gieseler A. Isogenic transplantation of ethylnitrosourea-induced tumors of the central and peripheral nervous system in two different inbred rat strains. Naturwissenschaften, 59: 474 1972.[Medline]
  25. Richter K. H., Jepsen A., Marks F. A system for the study of epidermal G1-chalone in cell culture. The rat tongue epithelial cell line RTE2. Exp. Cell Res., 150: 68-76, 1984.[Medline]
  26. Sherman L., Sleeman J. P., Hennigan R. F., Herrlich P., Ratner N. Overexpression of activated neu/erbB2 initiates immortalization and malignant transformation of immature Schwann cells in vitro. Oncogene, 18: 6692-6699, 1999.[Medline]
  27. Hofmann M., Fieber C., Assmann V., Gottlicher M., Sleeman J., Plug R., Howells N., von Stein O., Ponta H., Herrlich P. Identification of IHABP, a 95 kDa intracellular hyaluronate binding protein. J. Cell Sci., 111: 1673-1684, 1998.[Abstract]
  28. Fort P., Marty L., Piechaczyk M., el Sabrouty S., Dani C., Jeanteur P., Blanchard J. M. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res., 13: 1431-1442, 1985.[Abstract/Free Full Text]
  29. Smith D. B., Johnson K. S. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene (Amst.), 67: 31-40, 1988.[Medline]
  30. Papoutsi M., Tomarev S. I., Eichmann A., Prols F., Christ B., Wilting J. Endogenous origin of the lymphatics in the avian chorioallantoic membrane. Dev. Dyn., 222: 238-251, 2001.[Medline]
  31. Gunthert U., Hofmann M., Rudy W., Reber S., Zoller M., Haussmann I., Matzku S., Wenzel A., Ponta H., Herrlich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65: 13-24, 1991.[Medline]
  32. Ferrara N., Chen H., Davis-Smyth T., Gerber H. P., Nguyen T. N., Peers D., Chisholm V., Hillan K. J., Schwall R. H. Vascular endothelial growth factor is essential for corpus luteum angiogenesis. Nat. Med., 4: 336-340, 1998.[Medline]
  33. Makinen T., Jussila L., Veikkola T., Karpanen T., Kettunen M. I., Pulkkanen K. J., Kauppinen R., Jackson D. G., Kubo H., Nishikawa S., Yla-Herttuala S., Alitalo K. Inhibition of lymphangiogenesis with resulting lymphedema in transgenic mice expressing soluble VEGF receptor-3. Nat. Med., 7: 199-205, 2001.[Medline]
  34. Papoutsi M., Siemeister G., Weindel K., Tomarev S. I., Kurz H., Schachtele C., Martiny-Baron G., Christ B., Marme D., Wilting J. Active interaction of human A375 melanoma cells with the lymphatics in vivo. Histochem. Cell Biol., 114: 373-385, 2000.[Medline]
  35. Wilting J., Papoutsi M., Christ B., Nicolaides K. H., von Kaisenberg C. S., Borges J., Stark G. B., Alitalo K., Tomarev S. I., Niemeyer C., Rossler J. The transcription factor Prox1 is a marker for lymphatic endothelial cells in normal and diseased human tissues. FASEB J., 16: 1271-1273, 2002.[Abstract/Free Full Text]
  36. Veikkola T., Jussila L., Makinen T., Karpanen T., Jeltsch M., Petrova T. V., Kubo H., Thurston G., McDonald D. M., Achen M. G., Stacker S. A., Alitalo K. Signalling via vascular endothelial growth factor receptor-3 is sufficient for lymphangiogenesis in transgenic mice. EMBO J., 20: 1223-1231, 2001.[Medline]
  37. Millauer B., Shawver L. K., Plate K. H., Risau W., Ullrich A. Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant. Nature (Lond.), 367: 576-579, 1994.[Medline]
  38. Millauer B., Longhi M. P., Plate K. H., Shawver L. K., Risau W., Ullrich A., Strawn L. M. Dominant-negative inhibition of Flk-1 suppresses the growth of many tumor types in vivo. Cancer Res., 56: 1615-1620, 1996.[Abstract/Free Full Text]
  39. Jeltsch M., Kaipainen A., Joukov V., Meng X., Lakso M., Rauvala H., Swartz M., Fukumura D., Jain R. K., Alitalo K. Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science (Wash. DC), 276: 1423-1425, 1997.[Abstract/Free Full Text]
  40. Oh S. J., Jeltsch M. M., Birkenhager R., McCarthy J. E., Weich H. A., Christ B., Alitalo K., Wilting J. VEGF and VEGF-C: specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane. Dev. Biol., 188: 96-109, 1997.[Medline]
  41. Witzenbichler B., Asahara T., Murohara T., Silver M., Spyridopoulos I., Magner M., Principe N., Kearney M., Hu J. S., Isner J. M. Vascular endothelial growth factor-C (VEGF-C/VEGF-2) promotes angiogenesis in the setting of tissue ischemia. Am. J. Pathol., 153: 381-394, 1998.[Abstract/Free Full Text]
  42. Cao Y., Linden P., Farnebo J., Cao R., Eriksson A., Kumar V., Qi J. H., Claesson-Welsh L., Alitalo K. Vascular endothelial growth factor C induces angiogenesis in vivo. Proc. Natl. Acad. Sci. USA, 95: 14389-14394, 1998.[Abstract/Free Full Text]
  43. Pepper M. S., Mandriota S. J., Jeltsch M., Kumar V., Alitalo K. Vascular endothelial growth factor (VEGF)-C synergizes with basic fibroblast growth factor and VEGF in the induction of angiogenesis in vitro and alters endothelial cell extracellular proteolytic activity. J. Cell. Physiol., 177: 439-452, 1998.[Medline]
  44. Valtola R., Salven P., Heikkila P., Taipale J., Joensuu H., Rehn M., Pihlajaniemi T., Weich H., deWaal R., Alitalo K. VEGFR-3 and its ligand VEGF-C are associated with angiogenesis in breast cancer. Am. J. Pathol., 154: 1381-1390, 1999.[Abstract/Free Full Text]
  45. Kadambi A., Mouta Carreira C., Yun C. O., Padera T. P., Dolmans D. E., Carmeliet P., Fukumura D., Jain R. K. Vascular endothelial growth factor (VEGF)-C differentially affects tumor vascular function and leukocyte recruitment: role of VEGF-receptor 2 and host VEGF-A. Cancer Res., 61: 2404-2408, 2001.[Abstract/Free Full Text]
  46. Veikkola T., Alitalo K. VEGFs, receptors, and angiogenesis. Semin. Cancer Biol., 9: 211-220, 1999.[Medline]
  47. Orlandini M., Marconcini L., Ferruzzi R., Oliviero S. Identification of a c-fos-induced gene that is related to the platelet-derived growth factor/vascular endothelial growth factor family. Proc. Natl. Acad. Sci. USA, 93: 11675-11680, 1996.[Abstract/Free Full Text]
  48. Schoppmann S., Birner P., Stöckl J., Kalt R., Ullrich R., Caucig C., Kriehuber E., Nagy K., Alitalo K., Kerjaschki D. Tumor-associated macrophages express lymphatic endothelial growth factors and are related to peritumoral lymphangiogenesis. Am. J. Pathol., 161: 947-956, 2002.[Abstract/Free Full Text]
  49. Dinarello C. A. Biologic basis for interleukin-1 in disease. Blood, 87: 2095-2147, 1996.[Abstract/Free Full Text]
  50. Ristimaki A., Narko K., Enholm B., Joukov V., Alitalo K. Proinflammatory cytokines regulate expression of the lymphatic endothelial mitogen vascular endothelial growth factor C. J. Biol. Chem., 273: 8413-8418, 1998.[Abstract/Free Full Text]
  51. Matzkin H., Patel J. P., Altwein J. E., Soloway M. S. Stage T1A carcinoma of the prostate. Urology, 43: 11-21, 1994.[Medline]



This article has been cited by other articles:


Home page
 Jpn J Clin OncolHome page
T. Miyazaki, N. Okada, K. Ishibashi, K. Ogata, T. Ohsawa, T. Ishiguro, H. Nakada, M. Yokoyama, M. Matsuki, H. Kato, et al.
Clinical Significance of Plasma Level of Vascular Endothelial Growth Factor-C in Patients with Colorectal Cancer
Jpn. J. Clin. Oncol., December 1, 2008; 38(12): 839 - 843.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
S. S. Sundar and T. S. Ganesan
Role of Lymphangiogenesis in Cancer
J. Clin. Oncol., September 20, 2007; 25(27): 4298 - 4307.
[Abstract] [Full Text] [PDF]