Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, X.
Right arrow Articles by Srivastava, R. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, X.
Right arrow Articles by Srivastava, R. K.
[Cancer Research 63, 1059-1066, March 1, 2003]
© 2003 American Association for Cancer Research

Molecular Biology and Genetics

Differential Roles of RelA (p65) and c-Rel Subunits of Nuclear Factor {kappa}B in Tumor Necrosis Factor-related Apoptosis-inducing Ligand Signaling1

Xufeng Chen, Karthikeyan Kandasamy and Rakesh K. Srivastava2

Department of Pharmaceutical Sciences, Molecular and Cellular Biology Program, Greenebaum Cancer Center, University of Maryland, Baltimore, Maryland 21201-1180


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Apo-2L/TRAIL (tumor-necrosis factor-related apoptosis-inducing ligand) is a member of the tumor necrosis factor superfamily and has recently been shown to induce apoptosis through engagement of the death receptors TRAIL-R1 (DR4) and TRAIL-R2 (DR5). The transcription factor nuclear factor (NF)-{kappa}B regulates the expression of genes involved in cancer cell invasion, metastasis, and resistance to chemotherapy. In normal unstimulated cells, NF-{kappa}B is maintained in the cytoplasm with its inhibitor protein I{kappa}B, whereas in cancer cells, NF-{kappa}B is in the nucleus and constitutively activates target genes. To understand the function of NF-{kappa}B in TRAIL-induced apoptosis, we have analyzed the specific roles of NF-{kappa}B subunits. Overexpression of a transdominant-negative mutant of the inhibitory protein I{kappa}B{alpha} results in down-regulation of constitutively active NF-{kappa}B, induction of DR5, and tumor necrosis factor receptor (TNFR) 1-associated death domain expression and enhancement of TRAIL sensitivity. Overexpression of RelA or a transcriptional-deficient mutant of c-Rel inhibits TRAIL-induced apoptosis. Depletion of RelA in mouse embryonic fibroblasts increases cytokine-induced apoptosis, whereas depletion of c-Rel blocks this process. Overexpression of RelA subunit inhibits caspase-8 and DR4 and DR5 expression and enhances expression of cIAP1 and c-IAP2 after TRAIL treatment. By comparison, overexpression of c-Rel enhances DR4, DR5, and Bcl-Xs and inhibits cIAP1, cIAP2, and survivin after TRAIL treatment. These results suggest that the RelA subunit acts as a survival factor by inhibiting expression of DR4/DR5 and caspase-8 and up-regulating cIAP1 and cIAP2. The dual function of NF-{kappa}B, as an inhibitor or activator of apoptosis, depends on the relative levels of RelA and c-Rel subunits. Thus, NF-{kappa}B activity may play an important role in tumor progression, and down-regulation of RelA or up-regulation of c-Rel represents a possible therapeutic target for the treatment of cancer.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Apoptosis is genetically controlled process that plays an essential role in embryogenesis, homeostasis, and the cellular response to stressful stimuli (1, 2, 3) . Genetic aberrations that render cells incapable of executing their suicide program promote tumorigenesis and underlie the observed resistance of human cancers to genotoxic anticancer agents (4) . Thus, revealing the mechanisms of apoptotic program in tumor cells might aid the monitoring of molecular targets and design of effective therapeutic interventions against resistant human cancers.

Recently, Apop-2L/TRAIL3 has been shown to be a potential candidate for cancer therapy (5 , 6) . We and others (7, 8, 9, 10, 11, 12, 13, 14) have shown that TRAIL induces apoptosis in various cancer cell lines, including those that resist to chemotherapeutic agents or ionizing radiation because of inactivating mutations of the p53 tumor suppressor gene, but is less effective in nontransformed cells (15, 16, 17) . TRAIL induces apoptosis by binding to TRAIL-R1 (DR4/Apo-2A) and TRAIL-R2 (DR5/TRICK/Killer; Refs. 7 , 9 , 18, 19, 20, 21, 22 ). Both TRAIL-R1 and TRAIL-R2 contain a conserved cytoplasmic sequence, termed death domains, that can recruit adaptor proteins and activate caspase-8 (12 , 23 , 24) . The cleavage and activation of caspase-8, in turn, activate downstream effector caspases such as caspase-3 and caspase-7 (25 , 26) . Activation of caspase-8 by TRAIL may also cleave BID (a Bcl-2 inhibitory protein), the cleavage product of which triggers mitochondrial depolarization (decrease in {Delta}{psi}m) and subsequent release of cytochrome c from mitochondria (10 , 25 , 27) . Once released into the cytosol, cytochrome c binds to apoptotic protease-activating factor 1 and, in the presence of dATP, recruits and activates procaspase-9 to form the apoptosome (27) . Activated caspases cleave several downstream death substrates and activate endonucleases, resulting in the apoptosis (28, 29, 30) . Other three TRAIL receptors, TRAIL-R3 (TRID/DcR1/LIT; Refs. 19 , 31, 32, 33 ), TRAIL-R4 (TRUNDD/DcR2; Refs. 13 , 34 ), and osteoprotegerin (35) , also bind to TRAIL. TRAIL-R3 and TRAIL-R4 have extracellular domains similar to TRAIL-R1 and TRAIL-R2 but lack a functional cytoplasmic death domain. TRAIL-R3 and TRAIL-R4 may serve as decoy receptors, whereas the fifth receptor, osteoprotegerin, is a secreted protein with no known membrane anchor.

NF-{kappa}B is a transcription factor that plays an important role in controlling immune and inflammatory responses, cellular proliferation and adhesion molecules (36, 37, 38, 39) . NF-{kappa}B is a heterodimeric or homodimeric complex formed from five distinct subunits, RelA (p65), RelB, c-Rel, NF-{kappa}B1 (p50), and NF-{kappa}B2 (p52; Refs. 36 , 38 , 40 ). RelA (p65), RelB, and c-Rel are transcriptionally active members of the NF-{kappa}B family, whereas p50 and p52 primarily serve as DNA binding subunits (36, 37, 38) . The p50 and p52 NF-{kappa}B subunits are derived from larger precursor products, p105 and p100, respectively, or from differential translation of their mRNAs. The classical form of NF-{kappa}B, the heterodimer of p50 and p65 subunits, is normally retained in the cytoplasm in association with inhibitor proteins I{kappa}B{alpha} and I{kappa}Bß. When phosphorylated on serine 32 and serine 36, I{kappa}B{alpha} is degraded by the ubiquitin/26S proteasome pathway, allowing NF-{kappa}B to translocate to the nucleus and regulate gene expression (36 , 38 , 39 , 41) . Recently, NF-{kappa}B has been implicated in protecting cells from apoptosis (42, 43, 44, 45) , whereas much evidence highlights an apparently paradoxical proapoptotic role for NF-{kappa}B (44 , 46, 47, 48) . On the basis of these studies, it appears that opposite functions of NF-{kappa}B lies on the expression of its subunits where c-Rel and RelA functions as proapoptotic and antiapoptotic proteins, respectively.

It has recently been shown that TRAIL can activate NF-{kappa}B (44 , 49, 50, 51) . However, the intracellular signaling pathways responsible for TRAIL receptor-mediated NF-{kappa}B activation and the role of distinct subunits of NF-{kappa}B in TRAIL-induced signaling are unclear. Here, we demonstrate the opposite roles of RelA (p65) and c-Rel subunits of NF-{kappa}B in apoptosis. RelA deficiency enhances, whereas c-Rel deficiency blocks TRAIL-induced apoptosis. Thus, NF-{kappa}B may play an important role in the sensitivity of cancer cells to the apoptotic response to TRAIL.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
Antibodies against Rel A (p65), p50, I{kappa}B{alpha}, Bcl-Xs, and c-Rel were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); antibodies against DR4 and DR5 were from Imgenex, Inc. (San Diego, CA); and antibody against actin was from Oncogene Research (Boston, MA). ELISA kits for DR4 and DR5 were purchased from Biosource International, Inc. (Camarillo, CA). Enhanced chemiluminescence Western blot detection reagents were from Amersham Life Sciences, Inc. (Arlington Heights, IL). LipofectAMINE reagent was from Invitrogen Life Technologies (Carlsbad, CA). ß-Gal enzyme assay system with reporter lysis buffer was purchased from Promega (Madison, WI). Cytokine TRAIL was purchased from Biomol (Plymouth Meeting, PA). RNase protection assay kit was purchased from PharMingen (San Diego, CA). All other chemicals used were of analytical grade from Fisher Scientific (Suwanee, GA) or Sigma (St. Louis, MO).

Cells and Culture Conditions.
MDA-MB-231 and MCF-7 cells were obtained from the American Type Culture Collection (Manassas, VA). We used these two cell lines because MDA-MB-231 cells express low level of constitutively active NF-{kappa}B compared with MCF-7 cells. Cells were grown in RPMI 1640 supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin mixture. All of the cells were maintained at 37°C with 5% CO2.

Transient Transfection.
Cells were plated in 60-mm dishes in RPMI 1640 containing 10% FBS and 1% penicillin-streptomycin mixture at a density of 1 x 106 cells/dish. The next day, transfection mixtures were prepared. Cells were transfected with expression constructs encoding mutant I{kappa}B{alpha} (pCMV4-I{kappa}B-{alpha} and S32/36), c-Rel (pCMV4-c-Rel), RelA/p65 (pCMV4-p65), p50 (pCMV4-p50), or empty vector (pCMV4-neo) as control in the presence of a vector pCMV-LacZ (Invitrogen Life Technologies, Inc.) expressing ß-gal. For each transfection, 2 µg of DNA were diluted in 50 µl of medium without serum. After the addition of 3 µl of LipofectAMINE into 50 µl of Opti-MEM, the transfection mixture was incubated for 10 min at room temperature. Cells were washed with serum-free medium, the transfection mixture was added, and cultures were incubated for 24 h in the incubator. The next day, culture medium was replaced with fresh RPMI 1640 containing 10% FBS and 1% penicillin-streptomycin mixture, and TRAIL was added. At the end of incubation, cells were harvested and washed with ice-cold PBS.

Flow Cytometry.
Cells were treated with TRAIL (20 ng/ml) for various time points, harvested, and fixed in 85% ethanol. Cells were then stained with propidium iodide in PBS with 0.5% NP40 and RNase A. Propidium iodide-stained cells were analyzed using a Beckton Dickson FACStar flow cytometer. Data were analyzed by ModFit LT.

EMSA.
Nuclear extracts were prepared from cells. Double-stranded oligonucleotides containing consensus binding site for NF-{kappa}B (GATCGAGGGGACTTTCCCTACG; Promega) were 5' end-labeled using polynucleotide kinase and [{gamma}-32P]dATP. Nuclear extracts (5.0 µg) were incubated with 1 µl of labeled oligonucleotide (20,000 cpm) in 20 µl of incubation buffer [10 mM Tris-HCl, 40 mM NaCl, 1 mM EDTA, 1 mM ß-mercaptoethanol, 2% glycerol, and 2 µg of poly(deoxyinosinic-deoxycytidylic acid)] for 20 min at room temperature. The specificity of NF-{kappa}B DNA binding activity was confirmed by competition with excess cold wild-type or nonconsensus oligonucleotide. Supershift was assayed by additional incubations with rabbit polyclonal antibodies against p65, p50, or c-Rel for 45 min at room temperature before incubation of the labeled oligonucleotide. Anti-ß-actin antibody was used as control. DNA protein complexes were resolved by electrophoresis in 6% nondenaturing polyacrylamide gels and analyzed by autoradiography.

Reporter Transfection and Luciferase Assay.
The transcription activity of NF-{kappa}B was assayed by the transfection of luciferase reporter containing specific consensus sequence of NF-{kappa}B and ß-gal as a control into cells, and luciferase activity was measured and normalized by ß-gal activity as per manufacturer’s directions (Promega).

RNase Protection Assay.
Total RNAs were extracted using Trizol reagent (Life Technologies, Inc., Gaithersburg, MD). The RNase Protection Assay was performed as per manufacture’s directions (Pharmigen). Briefly, 2 µg of RNA was incubated with {alpha}-32P-UTP labeled single-stranded RNA probes overnight at 56°C and treated with RNase for 45 min at 30°C. The RNA-RNA complexes were resolved by electrophoresis in 6% denaturing polyacrylamide gels and analyzed by autoradiography.

Immunoblot Assays.
Cells were lysed in a buffer containing 10 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.5 mM EDTA, 1 mM EGTA, 1% SDS, 1 mM sodium orthovanadate, and a mixture of protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, and 2 µg/ml aprotinin). Lysates were centrifuged for 20 min at 12,000 x g and stored at -70°C. Proteins were resolved by SDS-PAGE, transferred onto polyvinylidene difluoride membrane (Bio-Rad), and probed with appropriate dilutions of primary antibodies. Immunoreactive protein complexes were visualized by enhanced chemiluminescent kit (Amersham).

DR4 and DR5 ELISA.
MDA-MB-231 and MCF-7 cells were treated with TRAIL for 48 h. At the end of incubation period, cells were harvested and washed twice with ice-cold PBS. Cells were lysed in extraction buffer for 30 min on ice with vortexing at 10-min intervals. The extracts were centrifuged at 13,000 rpm for 10 min at 4°C. Lysates were aliquoted and assayed for DR4 and DR5 proteins by ELISA as per manufacture’s directions (Biosource International, Inc., Camarillo, CA).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
TRAIL Activates NF-{kappa}B in Breast Cancer MDA-MB-231 and MCF-7 Cells.
Recent studies have shown the involvement of NF-{kappa}B in the regulation of apoptosis (52, 53, 54) . In some breast cancer cells, NF-{kappa}B is constitutively activated (54 , 55) and, therefore, may change the apoptotic response of several anticancer drugs and irradiation. To determine whether NF-{kappa}B plays a role in TRAIL-induced apoptotic signaling in breast cancer cells, we first examined the activation of NF-{kappa}B (Fig. 1A)Citation . MDA-MB-231 and MCF-7 cells were treated with soluble TRAIL for various time periods. Translocation of NF-{kappa}B to nucleus was examined by EMSAs. The NF-{kappa}B binding activity was increased in a time-dependent manner in MDA-MB-231 cells after treatment with TRAIL, reaching a maximum at 2 h (Fig. 1A)Citation . In MCF-7 cells, a robust activation of NF-{kappa}B was observed in untreated cells, which was additionally increased by TRAIL treatment as early as 20 min (Fig. 1A)Citation .



View larger version (52K):
[in this window]
[in a new window]
  		Fig. 1. Time course of TRAIL-induced NF-{kappa}B activation in breast cancer cells. A, MDA-MB-231 and MCF-7 cells were treated with TRAIL (25 ng/ml) for 20, 40, 60, 120, and 300 min. After the incubated period, cells were harvested and nuclear extracts were prepared. Nuclear extracts were analyzed for NF-{kappa}B binding with its consensus sequence by EMSA. B, MDA-MB-231 and MCF-7 cells were transfected with NF-{kappa}B/luciferase reporter plasmid and a cytomegalovirus 4 promoter-driven ß-gal expression plasmid to normalize the transfection efficiency. The luciferase activity was assayed for NF-{kappa}B activation and normalized to ß-gal.

 
We next examined the transcriptional activation of NF-{kappa}B by luciferase assay. MDA-MB-231 and MCF-7 cells were transiently transfected with {kappa}B-luciferase reporter plasmid construct and the NF-{kappa}B transactivity was measured by the luciferase assay (Fig. 1B)Citation . The data showed that NF-{kappa}B transactivation was induced 25-fold in MDA-MB-231 cells at 2 h and 3.5-fold in MCF-7 cells at 40 min by TRAIL (Fig. 1B)Citation . Thus, these data suggest that TRAIL can induce NF-{kappa}B-DNA binding and {kappa}B-dependent transcriptional activity in MDA-MD-231 and MCF-7 cells.

Effects of RelA (p65), p50, and c-Rel Subunits on TRAIL-induced NF-{kappa}B-DNA Binding Activity.
Recent studies have shown conflicting data on the physiological role of NF-{kappa}B on cell survival and apoptosis (37 , 43, 44, 45, 46, 47, 48) . It is possible that the dual functions of NF-{kappa}B depend on its subunits. To additionally identify which NF-{kappa}B subunit(s) contributes to enhanced DNA binding activity, we performed supershift assay with specific antibodies against different subunits of NF-{kappa}B, i.e., RelA (p65), p50, and c-Rel (Fig. 2)Citation . An antibody against ß-actin was also used in the experiment as a negative control. Treatment of cells with TRAIL enhanced the NF-{kappa}B-DNA binding activity in MDA-MB-231 cells. Incubation of nuclear extracts with unlabelled consensus NF-{kappa}B oligonucleotide completely displaced complexes I and II, suggesting the specificity of NF-{kappa}B bands. An antibody specific for the p65 subunit of NF-{kappa}B, which can recognize p65 homodimers and p50/p65 heterodimers of NF-{kappa}B, supershifted complex I and was unable to shift complex II in MDA-MB-231 cells (Fig. 2)Citation . An antibody specific for p50 also caused a supershift in MDA-MB-231 cells. By comparison in MCF-7 cells, anti-p50 antibody caused a major supershift. No significant supershift was observed with anti-c-Rel antibody in both cell lines, probably because of the nature of antibody (Fig. 2)Citation . Anti-ß actin antibody did not cause supershift in both MDA-MB-231 and MCF-7 cells.



View larger version (75K):
[in this window]
[in a new window]
  		Fig. 2. Involvement of various subunits of NF-{kappa}B in TRAIL-induced NF-{kappa}B activation. MDA-MB-231 and MCF-7 cells were treated with or without TRAIL (20 ng/ml) for 2 h and 40 min, respectively. Nuclear extracts were incubated in the presence or absence of antibodies against anti-p65, anti-p50, and anti-c-Rel to determine the presence of NF-{kappa}B subunits in the nuclear extract by super shift assay. An anti-ß-actin antibody was used as a control.

 
Differential Effects of RelA (p65) and c-Rel on TRAIL-induced Apoptosis.
The physiological role of NF-{kappa}B in cell survival and apoptosis is not clear (37 , 43, 44, 45, 46, 47, 48) . NF-{kappa}B has been found to act as an antiapoptotic or a proapoptotic factor. The opposing effects of NF-{kappa}B on cell survival and apoptosis may be attributable to differential expression of its subunits. We therefore sought to examine the specific role of NF-{kappa}B subunits on TRAIL-induced signaling. MDA-MB-231 and MCF-7 cells were transiently transfected with plasmid cDNAs containing different subunits of NF-{kappa}B (RelA/p65, p50, and c-Rel) and a mutant NF-{kappa}B inhibitory protein I{kappa}B{alpha} (serine 32/serine 36) termed as mI{kappa}B{alpha}. We first confirmed the transfection of various subunits of NF-{kappa}B (RelA, p50, and c-Rel) and mI{kappa}B{alpha} by the Western blot analysis (Fig. 3A)Citation . The data revealed that transfected genes were overexpressed significantly in MDA-MB-231 cells.



View larger version (34K):
[in this window]
[in a new window]
  		Fig. 3. Effect of different subunits of NF-{kappa}B on the apoptotic response of breast cancer cells to TRAIL. A, overexpression of various subunits of NF-{kappa}B in MDA-MB-231 cells. Cells were transfected with neo, mI{kappa}B{alpha}, p65, p50, or c-Rel expression vector in the presence of control plasmid (pCMV-LacZ) encoding the ß-gal enzyme. Western blots were performed to determine the overexpression of proteins. B, effects of various subunits of NF-{kappa}B on TRAIL-induced apoptosis. MDA-MB-231 and MCF-7 cells were transfected with various subunits of NF-{kappa}B (neo, mI{kappa}B{alpha}, p65, p50, and c-Rel) with control plasmid (pCMV-LacZ) encoding ß-gal enzyme and were treated with TRAIL (25 ng/ml) for 0, 12, and 24 h. More than 85% of cells were transfected, and there were no significant differences in transfection efficiency among groups. After incubation, cells were harvested, fixed, and stained with DAPI to measure apoptosis. Data represent mean ± SE of three independent experiments.

 
To determine the specific role of NF-{kappa}B subunits in TRAIL-induced apoptosis, transfected cells were treated with or without TRAIL (20 ng/ml) for various time periods, fixed, and stained with DAPI. The mI{kappa}B{alpha} (serine 32/serine 36) expression slightly enhanced the apoptotic response to TRAIL (20 ng/ml) in both MDA-MB-231 and MCF-7 cells (Fig. 3B)Citation . Overexpression of RelA (p65) subunit significantly attenuated TRAIL-induced apoptosis in MDA-MB-231 and MCF-7 cells at 12 and 24 h (Fig. 3B)Citation . By comparison, transfection of cells with c-Rel enhanced TRAIL-induced apoptosis in both MDA-MB-231 and MCF-7 cells at 24 h. Overexpression of p50 subunit had no significant effect on TRAIL-induced apoptosis in both MDA-MB-231 and MCF-7 cells. Considering the different activation status of NF-{kappa}B induced by TRAIL, the results suggested that RelA (p65) subunit of NF-{kappa}B blocks, whereas c-Rel enhances TRAIL-induced apoptosis at 24 h.

Because RelA (p65) subunit of NF-{kappa}B inhibited TRAIL-induced apoptosis, we next examined its effect on DNA binding and NF-{kappa}B activity (Fig. 4)Citation . MDA-MB-231 cells were transiently transfected with plasmid cDNAs containing RelA subunit of NF-{kappa}B or a mI{kappa}B{alpha}. MDA-MB-231 cells showed increased NF-{kappa}B-DNA binding activity of RelA (p65) subunit, whereas mI{kappa}B{alpha} decreased the NF-{kappa}B binding activity in MDA-MB-231 cells (Fig. 4A)Citation . Treatment of cells with MG132, a proteosome inhibitor, inhibited TRAIL-induced NF-{kappa}B-DNA binding activity.



View larger version (49K):
[in this window]
[in a new window]
  		Fig. 4. The effects of various subunits of NF-{kappa}B on TRAIL-induced NF-{kappa}B DNA binding and transcriptional activity in breast cancer cells. A, effects of various subunits of NF-{kappa}B on TRAIL-induced NF-{kappa}B-DNA binding activity. MDA-MB-231 cells were transfected with neo or p65 subunit of NF-{kappa}B with a plasmid (pCMV-LacZ) encoding ß-gal enzyme. More than 85% of cells were transfected, and there were no significant differences in transfection efficiency among groups. Transfectants were treated with TRAIL (25 ng/ml) for 2 h. Nuclear extracts were prepared, and EMSAs were performed. MG132, an inhibitor of NF-{kappa}B, was also used. B, MDA-MB-231 cells were transfected with different subunits of NF-{kappa}B and cotransfected with NF-{kappa}B/luciferase reporter plasmid and a cytomegalovirus 4 promoter-driven ß-gal expression plasmid. The luciferase activity was assayed for NF-{kappa}B activation and normalized to ß-gal.

 
Because RelA (p65) subunit of NF-{kappa}B enhanced NF-{kappa}B-DNA binding activity, we sought to examine whether this subunit increases the transcriptional activity of NF-{kappa}B. MDA-MB-231 cells were transiently transfected with plasmid cDNAs containing various subunits of NF-{kappa}B or mI{kappa}B{alpha} and treated with or without TRAIL for 2 h (Fig. 4B)Citation . Treatment of cells with TRAIL alone caused an enhancement in luciferase activity. Overexpression of mI{kappa}B{alpha} inhibited, whereas RelA (p65) enhanced TRAIL-induced luciferase activity. Under these conditions, overexpression of p50 had no effect on luciferase activity, whereas c-Rel subunit slightly enhanced luciferase activity in MDA-MB-231 cells treated with TRAIL (Fig. 4B)Citation .

NH2-terminal of c-Rel subunit of NF-{kappa}B contains a conserved region known as the Rel homology domain, which mediates dimerization and nuclear localization, and a variable COOH-terminal domain, which is responsible for transactivation. To examine directly the effects of RelA or c-Rel on TRAIL-induced apoptosis, RelA, c-Rel (CCR43), or a c-Rel truncation mutant lacking the COOH-terminal transactivation domain ({Delta}c-Rel; CCR-H5) were conditionally expressed in HeLa cells using a tetracycline-regulated system (Fig. 5A)Citation . The RelA, c-Rel, or truncated c-Rel ({Delta}c-Rel) genes were expressed under control of the tTA fusion activator, comprising the Escherichia coli tetracycline repressor and the activation domain of the VP16 protein of herpes simplex virus. Cells were grown in the absence of tetracycline for 48 h to induce expression of RelA and c-Rel (wild-type and mutant). Induction of c-Rel by removing tetracycline resulted in a dose-dependent increase in TRAIL-induced apoptosis in CCR43 (c-Rel overexpressing) cells (Fig. 5A)Citation . In contrast, expression of {Delta}c-Rel by removing tetracycline in CCR-H5 cells rendered these cells resistant to TRAIL. Interestingly, induced expression of RelA inhibited TRAIL-induced apoptosis (Fig. 5A)Citation .



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 5. Effects of various subunits of NF-{kappa}B on TRAIL-induced apoptosis. A, effects of inducible expression of c-Rel, {Delta}c-Rel, and Rel A on sensitivity of HeLa cells to TRAIL. HeLA cell (htRA-1) clones stably transfected with either c-Rel (CCR43), {Delta}c-Rel (CCR-H5, transactivation-deficient mutant), or Rel A were maintained in the absence of tetracycline for 48 h (to induce gene expression) and then exposed to TRAIL (1, 10, 100 ng/ml) or left untreated for another 24 h. Apoptosis was measured by DAPI staining. Data represent mean ± SE of three independent experiments. B, effects of deficiency of either RelA or c-Rel on TNF-{alpha} or TRAIL-induced apoptosis in MEFs. Wild-type, RelA-/-, and c-Rel-/- MEFs were exposed to either TNF-{alpha} or TRAIL for 24 h. Apoptosis was measured by DAPI staining. Data represent mean ± SE of three independent experiments.

 
We additionally confirmed the effects of RelA and c-Rel on apoptosis by examining the response of RelA-/-, c-Rel-/-, or wild-type MEFs to either TNF-{alpha} or TRAIL (Fig. 5B)Citation . RelA-/- MEFs were highly sensitive to TNF-{alpha}-mediated apoptosis, but c-Rel -/- or wild-type fibroblasts remained relatively resistant to TNF-{alpha}. Wild-type and RelA-/- MEFs were both susceptible to TRAIL-induced apoptosis, whereas c-Rel-/- MEFs were almost completely resistant to TRAIL. These data confirmed our previous findings that RelA subunit can inhibit TRAIL-induced apoptosis, whereas c-Rel can enhance the apoptotic response of TRAIL.

Regulation of Death Receptors and Caspase-8 by NF-{kappa}B.
TRAIL initiates apoptosis by binding to death receptors and the activation of caspase-8 (6 , 9 , 25) . Several reports indicated that mitochondrial dysfunctions and Bcl2 family members played important roles in TRAIL signaling. To understand the mechanism of RelA subunit of NF-{kappa}B in control of apoptotic response in MDA-MB-231 and MCF-7 cells to TRAIL, the expression of death receptors and caspase-8 was analyzed by RNase protection assay and immunoblotting. MDA-MB-231 and MCF-7 cells were transfected with different subunits of NF-{kappa}B or a mI{kappa}B{alpha} and treated with or without of TRAIL. The RNase protection assays were performed with probe-set of hAPO-3c (caspase-8, Fas, FasL, DcR1, DR3, DR5, DR4, TRAIL, TNFRp55, TRADD, and RIP) as per manufacturer’s directions (PharMingen). Overexpression of p65 subunit of NF-{kappa}B inhibited the mRNA expression of DR4, DR5, and caspase-8 in MDA-MB-231 cells treated with TRAIL (Fig. 6A)Citation . In contrast, overexpression of c-Rel subunit of NF-{kappa}B enhanced the mRNA expression of DR4, DR5, and caspase-8 in MDA-MB-231 cells treated with TRAIL (Fig. 6A)Citation . Overexpression of p50 subunit of NF-{kappa}B had no effect on the expression of caspase-8, FAS, FasL, DcR1, DR3, DR5, DR4, TRADD, and RIP in the absence or presence of TRAIL. Overexpression of mI{kappa}B{alpha} significantly enhanced expression of DR5 and TRADD in MDA-MB-231 cells (Fig. 6B)Citation . Similarly, overexpression of p65 subunit of NF-{kappa}B inhibited the mRNA expression of DR4 and caspase-8 in MCF-7 cells treated with TRAIL (data not shown).



View larger version (61K):
[in this window]
[in a new window]
  		Fig. 6. Effects of various subunits of NF-{kappa}B on the expression of death-related genes (caspase-8, FasL, Fas, DcR1, DR3, DR4, DR5, TRAIL, TNFRp55, TRADD, and RIP) in breast cancer cells. A and B, MDA-MB-231 cells were transfected with various subunits of NF-{kappa}B or mI{kappa}B{alpha} with a plasmid (pCMV-LacZ) encoding ß-gal enzyme. More than 85% of cells were transfected, and there were no significant differences in transfection efficiency among groups. Transfectants were treated with or without TRAIL (25 ng/ml) for 12 h. Total RNA was used in RNase protection assay (hAPO-3c; PharMingen) to measure the expression of genes. L32 and glyceraldehyde-3-phosphate dehydrogenase were shown as housekeeping genes. C, effects of various subunits of NF-{kappa}B on the expression of death receptors DR4 and DR5 in breast cancer cells. MDA-MB-231 cells overexpressing various subunits of NF-{kappa}B were treated with or without TRAIL (25 ng/ml) for 24 h. The Western blots were performed with anti-DR4 antibody or anti-DR5 antibody. An anti-ß-tubulin antibody was used as a loading control. D–G, effects of various subunits of NF-{kappa}B on the expression DR4 and DR5 in breast cancer cells. MDA-MB-231 and MCF-7 cells, overexpressing various subunits of NF-{kappa}B, were treated with or without TRAIL (25 ng/ml) for 24 h. Expression of DR4 and DR5 was measured by ELISA as per manufacturer’s instructions (Biosource International).

 
We additionally confirmed the expression of proteins in MDA-MB-231 cells by the Western blot analysis (Fig. 6C)Citation . Overexpression of RelA (p65) subunit of NF-{kappa}B in MDA-MB-231 cells inhibited death receptors DR4 and DR5 after TRAIL treatment. In contrast, overexpression of c-Rel subunit of NF-{kappa}B in MDA-MB-231 cells enhanced DR4 and DR5 proteins after TRAIL treatment. There was no difference in loading as evident from antitubulin antibody.

We next measured the effects of overexpression of p65 and c-Rel subunits of NF-{kappa}B on DR4 and DR5 proteins by ELISA (Biosource International). TRAIL induced DR4 and DR5 proteins in MDA/Neo cells (Fig. 6, D and E)Citation . Overexpression of RelA (p65) subunit of NF-{kappa}B in MDA-MB-231 cells inhibited death receptors DR4 and DR5 after TRAIL treatment. In contrast, overexpression of c-Rel subunit of NF-{kappa}B in MDA-MB-231 cells enhanced DR4 and DR5 proteins after TRAIL treatment. These data confirmed our previous findings that overexpression of Rel A (p65) inhibits DR4 and DR5, whereas overexpression of c-Rel enhances DR4 and DR5 proteins in MDA-MB-231 cells.

Regulation of Bcl-2 Family Members by NF-{kappa}B.
Bcl-2 family proteins play important roles in apoptotic response of cancer cells treated with chemotherapeutic drugs or irradiation (30 , 56) . The regulation of Bcl-2 family members by NF-{kappa}B is still unclear. Recently, it has been shown that NF-{kappa}B can induce expression of Bcl-XL and a Bcl-2 homologue A1/Bfl-1 (57 , 58) . In our experiment, no significant changes were found in the transcriptional level of Bcl-2 family members (except Bcl-X) in TRAIL-induced apoptotic signaling in both of MDA-MB-231 and MCF-7 cells overexpressing different subunits of NF-{kappa}B and mI{kappa}B{alpha} (Fig. 7, A and B)Citation . Interestingly, overexpression of c-Rel significantly enhanced the expression of Bcl-X in MDA-MB-231 cells after TRAIL treatment, this band was later identified as Bcl-Xs protein by immunoblot analysis (Fig. 7C)Citation . Thus, the results suggested that c-Rel could promote the expression of proapoptotic gene Bcl-Xs.



View larger version (88K):
[in this window]
[in a new window]
  		Fig. 7. Effects of various subunits of NF-{kappa}B on the expression of Bcl-2 family members (bcl-w, bcl-x, bfl1, bad, bik, bak, bax, bcl-2, and mcl-1) in breast cancer cells. (A and B), MDA-MB-231 and MCF7 cells were transfected with various subunits of NF-{kappa}B or mI{kappa}B{alpha} with a plasmid (pCMV-LacZ) encoding ß-gal enzyme. More than 85% of cells were transfected, and there were no significant differences in transfection efficiency among groups. Transfectants were treated with or without TRAIL (25 ng/ml) for 12 h. Total RNA was used in RNase protection assay (hAPO-2c; PharMingen) to measure the expression of genes. L32 and glyceraldehyde-3-phosphate dehydrogenase were shown as housekeeping genes. C, effects of various subunits of NF-{kappa}B on the expression of Bcl-Xs protein. MDA-MB-231 cells were transfected with various subunits of NF-{kappa}B or mI{kappa}B{alpha} with a plasmid (pCMV-LacZ) encoding ß-gal enzyme. There were no significant differences in transfection efficiency among groups. Transfectants were treated with or without TRAIL (25 ng/ml) for 24 h. Bcl-Xs protein was examined by the Western blot analysis. Tubulin was used as a loading control.

 
Regulation of IAPs by NF-{kappa}B.
NF-{kappa}B can protect cells from apoptosis by promoting expression of survival genes such as Bf1/A1, TRAF1, TRAF2, c-IAP1, and c-IAP-2 (59 , 60) . However, which subunit of NF-{kappa}B is important in the regulation of survival factors in cells are unknown. We therefore examined the expression of IAP, c-IAP1, cIAP2, and survivin in MDA-MB-231 cells overexpressing p65, p50, and c-Rel subunits of NF-{kappa}B or mI{kappa}B{alpha} (Fig. 8)Citation . The Western blot analysis revealed that overexpression of RelA/p65 subunit significantly enhanced the expression of cIAP1 and cIAP2, whereas overexpression of c-Rel subunit inhibited the expression of these proteins after TRAIL treatment in MDA-MB-231 cells (Fig. 8)Citation . Overexpression of p50 had no effect on these genes after TRAIL treatment. Furthermore, overexpression mI{kappa}B{alpha} inhibited cIAP1 and cIAP2 after TRAIL treatment. Overexpression of RelA (p65), p50, or mI{kappa}B{alpha} had no effect on the expression of survivin, whereas overexpression of c-Rel significantly inhibited survivin after TRAIL treatment.



View larger version (51K):
[in this window]
[in a new window]
  		Fig. 8. Effects of various subunits of NF-{kappa}B on the expression of survival genes (xIAP, survivin, NAIP, c-IAP1, cIAP2, and TRAM2) in breast cancer cells. MDA-MB-231 cells were transfected with various subunits of NF-{kappa}B or mI{kappa}B{alpha} with a plasmid (pCMV-LacZ) encoding ß-gal enzyme. More than 85% of cells were transfected, and there were no significant differences in transfection efficiency among groups. Transfectants were treated with or without TRAIL (25 ng/ml) for 24 h. The Western blot analyses were performed to determine the expression of cIAP1, cIAP2, survivin, and tubulin.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we examined the biological roles of various subunit of NF-{kappa}B in TRAIL-induced apoptosis in breast cancer cells. The oncogenic role of NF-{kappa}B was observed earlier in leukemia and lymphoma (61) , breast cancer (52) , and pancreatic cancer (62) . Apparently, the physiological roles of NF-{kappa}B in cell survival and apoptosis (37 , 43 , 45, 46, 47, 48 , 57 , 59 , 63, 64, 65, 66) have provided conflicting views. In certain situations, NF-{kappa}B acts as an antiapoptotic, whereas in others it functions as proapoptotic transcription factor. Therefore, additional studies are needed to examine the physiological roles of NF-{kappa}B subunits.

In our study, overexpression of RelA inhibits TRAIL-induced apoptosis, whereas overexpression of c-Rel enhances TRAIL-induced apoptosis. Similarly, inhibition of RelA subunit of NF-{kappa}B results in hepatic cell death and embryonic lethality of mice (43) . Furthermore, depletion of Rel A or inhibition of NF-{kappa}B phosphorylation, via the expression of the super-repressor form of I{kappa}B{alpha}, sensitizes cells to cytokine-induced apoptosis (43 , 45 , 53 , 65) . This suggests that NF-{kappa}B plays a survival role in oncogenesis because inhibition of NF-{kappa}B in transformed cells can induce apoptosis. In contrast to these studies, NF-{kappa}B can function as proapoptotic in other situations. Interestingly, constitutively active NF-{kappa}B through targeted disruption of I{kappa}B{alpha} causes a massive thymic and splenic cell death in mouse embryos (63) . Furthermore, high levels of the c-Rel subunit of NF-{kappa}B have been noticed during apoptosis in the developing avian embryo (46) .

On the basis of our studies, it appears that dual functions of NF-{kappa}B, as proapoptotic or antiapoptotic, depend on its subunits c-Rel or RelA (p65), respectively. Activation of c-Rel subunit of NF-{kappa}B results in induction of apoptosis-related genes such as DR4, DR5, and Bcl-Xs, and inhibition of survival genes such as cIAP1, cIAP2, and survivin. By comparison, activation of RelA (p65) subunit of NF-{kappa}B inhibits expression of apoptotic genes such as caspase-8, DR4, and DR5 and enhances expression of cIAP1 and cIAP2. Thus, the ratio between c-Rel and RelA (p65) subunits will determine whether the activation of NF-{kappa}B will trigger apoptotic or survival signal.

In our study, MCF-7 cells express higher level constitutively active NF-{kappa}B and are less sensitive to TRAIL-induced apoptosis compared with MDA-MB-231 cells, which express lower level of constitutively active NF-{kappa}B. It appears that constitutive activation of NF-{kappa}B can prevent TRAIL-induced apoptosis. The mechanism by which the constitutive activation of NF-{kappa}B antagonizes TRAIL-induced apoptosis remains to be elucidated. There are several possible candidates that may regulate apoptosis. NF-{kappa}B suppression of apoptosis appears to be at transcriptional level because it regulates expression of TRAF1, TRAF2, cIAP-1, and cIAP-2. Other antiapoptotic genes that are transcriptionally activated by NF-{kappa}B are the Bcl-2 homologues A1/Bfl1 and Bcl-XL, LEX-1, and XIAP. NF-{kappa}B can antagonize p53 function, possibly through the cross-competition for transcriptional coactivators. Conversely, p53 may in some cases act through NF-{kappa}B to induce apoptosis (48) .

It has been reported that constitutively active NF-{kappa}B in breast cancer cells generally does not consist of p50-p65 heterodimer but rather complexes that contain p50, p52, and Bcl-3 (55) . The nuclear accumulation of Bcl-3 is independent of inhibition by other I{kappa}B proteins and of I{kappa}B kinase stimulation. Thus, I{kappa}B expression does not generate a true NF-{kappa}B null phenotype and may, in fact, lead to the up-regulation of functionally different NF-{kappa}B complexes. Therefore, different NF-{kappa}B complexes (some lacking NF-{kappa}B) may control growth and differentiation in different cell types or in response to different stimuli. It is possible to speculate that there are opposing roles for NF-{kappa}B subunits in transformation.

In summary, we have provided direct evidence that the dual function of NF-{kappa}B, as an inhibitor or activator of apoptosis, depends on the relative levels of RelA (p65) or c-Rel subunits, respectively. The ratio between RelA (p65) and c-Rel subunits will determine whether activation of NF-{kappa}B will trigger apoptotic or survival signal. In addition, up-regulation of RelA (p65) subunit of NF-{kappa}B can enhance TRAIL resistance, whereas up-regulation of c-Rel can enhance TRAIL sensitivity. Thus, regulation of NF-{kappa}B subunits may be a novel strategy for cancer therapy.


   ACKNOWLEDGMENTS
 
We thank Dr. Warner C. Greene (Gladstone Institute of Virology and Immunology, University of California, San Francisco, CA) for providing mI{kappa}B{alpha} (serine 32/serine 36), Rel A/p65, p50, and c-Rel expression vectors. We also thank Dr. Céline Gélinas (Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, NJ) for providing c-Rel, {Delta}c-Rel, RelA-expressing HeLa cells, and c-Rel-/- MEFs and Dr. Amer Beg (Department of Biological Sciences, Columbia University, New York, NY) for RelA-/- MEFs.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from Susan G. Komen Breast Cancer Foundation and Charlotte Geyer Foundation. Back

2 To whom requests for reprints should be addressed, at Department of Pharmaceutical Sciences, University of Maryland, Greenebaum Cancer Center, 20 North Pine Street, Baltimore, MD 21201-1180. E-mail: rsrivast{at}rx.umaryland.edu Back

3 The abbreviations used are: TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; I{kappa}B, inhibitor of nuclear factor-{kappa}B; FBS, ß-gal, ß-galactosidase; fetal bovine serum; EMSA, electrophoretic mobility shift assay; DAPI, 4',6-diamidino-2-phenylindole; MEF, mouse embryonic fibroblast; TNF, tumor necrosis factor; FasL, Fas ligand; TRADD, tumor necrosis factor receptor (TNFR)1-associated death domain; RIP, receptor interacting protein; IAP, inhibitor of apoptosis protein. Back

Received 9/30/02. Accepted 1/ 6/03.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Evan G., Littlewood T. A matter of life and cell death. Science (Wash. DC), 281: 1317-1322, 1998.[Abstract/Free Full Text]
  2. Rathmell J. C., Thompson C. B. The central effectors of cell death in the immune system. Annu. Rev. Immunol., 17: 781-828, 1999.[Medline]
  3. Roulston A., Marcellus R. C., Branton P. E. Viruses and apoptosis. Annu. Rev. Microbiol., 53: 577-628, 1999.[Medline]
  4. Lowe S. W., Schmitt E. M., Smith S. W., Osborne B. A., Jacks T. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature (Lond.), 362: 847-849, 1993.[Medline]
  5. Pitti R. M., Marsters S. A., Ruppert S., Donahue C. J., Moore A., Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem., 271: 12687-12690, 1996.[Abstract/Free Full Text]
  6. Srivastava R. K. Intracellular mechanisms of TRAIL and its role in cancer therapy. Mol. Cell. Biol. Res. Commun., 4: 67-75, 2000.[Medline]
  7. Walczak H., Degli-Esposti M. A., Johnson R. S., Smolak P. J., Waugh J. Y., Boiani N., Timour M. S., Gerhart M. J., Schooley K. A., Smith C. A., Goodwin R. G., Rauch C. T. TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J., 16: 5386-5397, 1997.[Medline]
  8. Griffith T. S., Chin W. A., Jackson G. C., Lynch D. H., Kubin M. Z. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol., 161: 2833-2840, 1998.[Abstract/Free Full Text]
  9. Bodmer J. L., Holler N., Reynard S., Vinciguerra P., Schneider P., Juo P., Blenis J., Tschopp J. TRAIL receptor-2 signals apoptosis through FADD and caspase-8. Nat. Cell Biol., 2: 241-243, 2000.[Medline]
  10. Kim E. J., Suliman A., Lam A., Srivastava R. K. Failure of Bcl-2 to block mitochondrial dysfunction during TRAIL-induced apoptosis. Tumor necrosis-related apoptosis-inducing ligand. Int. J. Oncol., 18: 187-194, 2001.[Medline]
  11. Kim K., Takimoto R., Dicker D. T., Chen Y., Gazitt Y., El-Deiry W. S. Enhanced TRAIL sensitivity by p53 overexpression in human cancer but not normal cell lines. Int. J. Oncol., 18: 241-247, 2001.[Medline]
  12. Golstein P. Cell death: TRAIL and its receptors. Curr. Biol., 7: R750-R753, 1997.[Medline]
  13. Marsters S. A., Sheridan J. P., Pitti R. M., Huang A., Skubatch M., Baldwin D., Yuan J., Gurney A., Goddard A. D., Godowski P., Ashkenazi A. A novel receptor for Apo2L/TRAIL contains a truncated death domain. Curr. Biol., 7: 1003-1006, 1997.[Medline]
  14. Ashkenazi A., Pai R. C., Fong S., Leung S., Lawrence D. A., Marsters S. A., Blackie C., Chang L., McMurtrey A. E., Hebert A., DeForge L., Koumenis I. L., Lewis D., Harris L., Bussiere J., Koeppen H., Shahrokh Z., Schwall R. H. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Investig., 104: 155-162, 1999.[Medline]
  15. French L. E., Tschopp J. The TRAIL to selective tumor death [comment]. Nat. Med., 5: 146-147, 1999.[Medline]
  16. Gura T. How TRAIL kills cancer cells, but not normal cells [comment]. Science (Wash. DC), 277: 768 1997.[Free Full Text]
  17. Pan G., O’Rourke K., Chinnaiyan A. M., Gentz R., Ebner R., Ni J., Dixit V. M. The receptor for the cytotoxic ligand TRAIL. Science (Wash. DC), 276: 111-113, 1997.[Abstract/Free Full Text]
  18. Walczak H., Miller R. E., Ariail K., Gliniak B., Griffith T. S., Kubin M., Chin W., Jones J., Woodward A., Le T., Smith C., Smolak P., Goodwin R. G., Rauch C. T., Schuh J. C., Lynch D. H. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo [see comments]. Nat. Med., 5: 157-163, 1999.[Medline]
  19. Sheridan J. P., Marsters S. A., Pitti R. M., Gurney A., Skubatch M., Baldwin D., Ramakrishnan L., Gray C. L., Baker K., Wood W. I., Goddard A. D., Godowski P., Ashkenazi A. Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors. Science (Wash. DC), 277: 818-821, 1997.[Abstract/Free Full Text]
  20. Schneider P., Thome M., Burns K., Bodmer J. L., Hofmann K., Kataoka T., Holler N., Tschopp J. TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-{kappa}B. Immunity, 7: 831-836, 1997.[Medline]
  21. Wu G. S., Burns T. F., McDonald E. R., III, Jiang W., Meng R., Krantz I. D., Kao G., Gan D. D., Zhou J. Y., Muschel R., Hamilton S. R., Spinner N. B., Markowitz S., Wu G., el-Deiry W. S. Killer/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nat. Genet., 17: 141-143, 1997.[Medline]
  22. Schneider P., Bodmer J. L., Thome M., Hofmann K., Holler N., Tschopp J. Characterization of two receptors for TRAIL. FEBS Lett., 416: 329-334, 1997.[Medline]
  23. Ashkenazi A., Dixit V. M. Apoptosis control by death and decoy receptors. Curr. Opin. Cell Biol., 11: 255-260, 1999.[Medline]
  24. Griffith T. S., Rauch C. T., Smolak P. J., Waugh J. Y., Boiani N., Lynch D. H., Smith C. A., Goodwin R. G., Kubin M. Z. Functional analysis of TRAIL receptors using monoclonal antibodies. J. Immunol., 162: 2597-2605, 1999.[Abstract/Free Full Text]
  25. Suliman A., Lam A., Datta R., Srivastava R. K. Intracellular mechanisms of TRAIL: apoptosis through mitochondrial-dependent and -independent pathways. Oncogene, 20: 2122-2133, 2001.[Medline]
  26. Muzio M. Signalling by proteolysis: death receptors induce apoptosis. Int. J. Clin. Lab. Res., 28: 141-147, 1998.[Medline]
  27. Luo X., Budihardjo I., Zou H., Slaughter C., Wang X. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell, 94: 481-490, 1998.[Medline]
  28. Green D. R. Apoptotic pathways: the roads to ruin. Cell, 94: 695-698, 1998.[Medline]
  29. Srivastava R. K., Srivastave A. R., Cho-Chung Y. S. Synergistic effects of 8-Cl-cAMP and retinoic acids in the inhibition of growth and induction of apoptosis in ovarian cancer cells: induction of retinoic acid receptor ß. Mol. Cell. Biochem., 204: 1-9, 2000.[Medline]
  30. Srivastava R. K., Sollott S. J., Khan L., Hansford R., Lakatta E. G., Longo D. L. Bcl-2 and Bcl-X(L) block thapsigargin-induced nitric oxide generation, c-Jun NH(2)-terminal kinase activity, and apoptosis. Mol. Cell. Biol., 19: 5659-5674, 1999.[Abstract/Free Full Text]
  31. Pan G., Ni J., Wei Y. F., Yu G., Gentz R., Dixit V. M. An antagonist decoy receptor and a death domain-containing receptor for TRAIL [see comments]. Science (Wash. DC), 277: 815-818, 1997.[Abstract/Free Full Text]
  32. Degli-Esposti M. A., Smolak P. J., Walczak H., Waugh J., Huang C. P., DuBose R. F., Goodwin R. G., Smith C. A. Cloning and characterization of TRAIL-R3, a novel member of the emerging TRAIL receptor family. J. Exp. Med., 186: 1165-1170, 1997.[Abstract/Free Full Text]
  33. Mongkolsapaya J., Cowper A. E., Xu X. N., Morris G., McMichael A. J., Bell J. I., Screaton G. R. Lymphocyte inhibitor of TRAIL (TNF-related apoptosis-inducing ligand): a new receptor protecting lymphocytes from the death ligand TRAIL. J. Immunol., 160: 3-6, 1998.[Abstract/Free Full Text]
  34. Degli-Esposti M. A., Dougall W. C., Smolak P. J., Waugh J. Y., Smith C. A., Goodwin R. G. The novel receptor TRAIL-R4 induces NF-{kappa}B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity, 7: 813-820, 1997.[Medline]
  35. Emery J. G., McDonnell P., Burke M. B., Deen K. C., Lyn S., Silverman C., Dul E., Appelbaum E. R., Eichman C., DiPrinzio R., Dodds R. A., James I. E., Rosenberg M., Lee J. C., Young P. R. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J. Biol. Chem., 273: 14363-14367, 1998.[Abstract/Free Full Text]
  36. Baldwin A. S., Jr. Series introduction: the transcription factor NF-{kappa}B and human disease. J. Clin. Investig., 107: 3-6, 2001.[Medline]
  37. Baeuerle P. A., Baltimore D. NF-{kappa}B: ten years after. Cell, 87: 13-20, 1996.[Medline]
  38. Ghosh S., May M. J., Kopp E. B. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16: 225-260, 1998.[Medline]
  39. Verma I. M., Stevenson J. K., Schwarz E. M., Van Antwerp D., Miyamoto S. Rel/NF-{kappa}B/I{kappa}B family: intimate tales of association and dissociation. Genes Dev., 9: 2723-2735, 1995.[Free Full Text]
  40. Perkins N. D. The Rel/NF-{kappa}B family: friend and foe. Trends Biochem. Sci., 25: 434-440, 2000.[Medline]
  41. Baeuerle P. A., Henkel T. Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol., 12: 141-179, 1994.[Medline]
  42. Attar R. M., Macdonald-Bravo H., Raventos-Suarez C., Durham S. K., Bravo R. Expression of constitutively active I{kappa}B ß in T cells of transgenic mice: persistent NF-{kappa}B activity is required for T-cell immune responses. Mol. Cell. Biol., 18: 477-487, 1998.[Abstract/Free Full Text]
  43. Beg A. A., Baltimore D. An essential role for NF-{kappa}B in preventing TNF-{alpha}-induced cell death [see comments]. Science (Wash. DC), 274: 782-784, 1996.[Abstract/Free Full Text]
  44. Ravi R., Bedi G. C., Engstrom L. W., Zeng Q., Mookerjee B., Gelinas C., Fuchs E. J., Bedi A. Regulation of death receptor expression and TRAIL/Apo2L-induced apoptosis by NF-{kappa}B. Nat. Cell Biol., 3: 409-416, 2001.[Medline]
  45. Van Antwerp D. J., Martin S. J., Kafri T., Green D. R., Verma I. M. Suppression of TNF-{alpha}-induced apoptosis by NF-{kappa}B [see comments]. Science (Wash. DC), 274: 787-789, 1996.[Abstract/Free Full Text]
  46. Abbadie C., Kabrun N., Bouali F., Smardova J., Stehelin D., Vandenbunder B., Enrietto P. J. High levels of c-rel expression are associated with programmed cell death in the developing avian embryo and in bone marrow cells in vitro. Cell, 75: 899-912, 1993.[Medline]
  47. Lipton S. A. Janus faces of NF-{kappa}B: neurodestruction versus neuroprotection. Nat. Med., 3: 20-22, 1997.[Medline]
  48. Ryan K. M., Ernst M. K., Rice N. R., Vousden K. H. Role of NF-{kappa}B in p53-mediated programmed cell death. Nature (Lond.), 404: 892-897, 2000.[Medline]
  49. Hu W. H., Johnson H., Shu H. B. Tumor necrosis factor-related apoptosis-inducing ligand receptors signal NF-{kappa}B and JNK activation and apoptosis through distinct pathways. J. Biol. Chem., 274: 30603-30610, 1999.[Abstract/Free Full Text]
  50. Oya M., Ohtsubo M., Takayanagi A., Tachibana M., Shimizu N., Murai M. Constitutive activation of nuclear factor {kappa}B prevents TRAIL-induced apoptosis in renal cancer cells. Oncogene, 20: 3888-3896, 2001.[Medline]
  51. Schwenzer R., Siemienski K., Liptay S., Schubert G., Peters N., Scheurich P., Schmid R. M., Wajant H. The human tumor necrosis factor (TNF) receptor-associated factor 1 gene (TRAF1) is up-regulated by cytokines of the TNF ligand family and modulates TNF-induced activation of NF-{kappa}B and c-Jun N-terminal kinase. J. Biol. Chem., 274: 19368-19374, 1999.[Abstract/Free Full Text]
  52. Sovak M. A., Bellas R. E., Kim D. W., Zanieski G. J., Rogers A. E., Traish A. M., Sonenshein G. E. Aberrant nuclear factor {kappa}B/Rel expression and the pathogenesis of breast cancer. J. Clin. Investig., 100: 2952-2960, 1997.[Medline]
  53. Wang C. Y., Mayo M. W., Baldwin A. S., Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-{kappa}B [see comments]. Science (Wash. DC), 274: 784-787, 1996.[Abstract/Free Full Text]
  54. Newton T. R., Patel N. M., Bhat-Nakshatri P., Stauss C. R., Goulet R. J., Jr., Nakshatri H. Negative regulation of transactivation function but not DNA binding of NF-{kappa}B and AP-1 by I{kappa}Bß1 in breast cancer cells. J. Biol. Chem., 274: 18827-18835, 1999.[Abstract/Free Full Text]
  55. Cogswell P. C., Guttridge D. C., Funkhouser W. K., Baldwin A. S., Jr. Selective activation of NF-{kappa}B subunits in human breast cancer: potential roles for NF-{kappa}B2/p52 and for Bcl-3. Oncogene, 19: 1123-1131, 2000.[Medline]
  56. Kroemer G., Dallaporta B., Resche-Rigon M. The mitochondrial death/life regulator in apoptosis and necrosis. Annu. Rev. Physiol., 60: 619-642, 1998.[Medline]
  57. Wang C. Y., Guttridge D. C., Mayo M. W., Baldwin A. S., Jr. NF-{kappa}B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis. Mol. Cell. Biol., 19: 5923-5929, 1999.[Abstract/Free Full Text]
  58. Zong W. X., Edelstein L. C., Chen C., Bash J., Gelinas C. The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-{kappa}B that blocks TNF-{alpha}-induced apoptosis. Genes Dev., 13: 382-387, 1999.[Abstract/Free Full Text]
  59. Wang C. Y., Mayo M. W., Korneluk R. G., Goeddel D. V., Baldwin A. S., Jr. NF-{kappa}B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science (Wash. DC), 281: 1680-1683, 1998.[Abstract/Free Full Text]
  60. Datta S. R., Brunet A., Greenberg M. E. Cellular survival: a play in three Akts. Genes Dev., 13: 2905-2927, 1999.[Free Full Text]
  61. Gil J., Rullas J., Garcia M. A., Alcami J., Esteban M. The catalytic activity of dsRNA-dependent protein kinase, PKR, is required for NF-{kappa}B activation. Oncogene, 20: 385-394, 2001.[Medline]
  62. Wang W., Abbruzzese J. L., Evans D. B., Larry L., Cleary K. R., Chiao P. J. The nuclear factor {kappa}B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clin. Cancer Res., 5: 119-127, 1999.[Abstract/Free Full Text]
  63. Beg A. A., Sha W. C., Bronson R. T., Baltimore D. Constitutive NF-{kappa}B activation, enhanced granulopoiesis, and neonatal lethality in I{kappa}B{alpha}-deficient mice. Genes Dev., 9: 2736-2746, 1995.[Abstract/Free Full Text]
  64. Van Antwerp D. J., Martin S. J., Verma I. M., Green D. R. Inhibition of TNF-induced apoptosis by NF-{kappa}B. Trends Cell. Biol., 8: 107-111, 1998.[Medline]
  65. Liu Z. G., Hsu H., Goeddel D. V., Karin M. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell, 87: 565-576, 1996.[Medline]
  66. Chen C., Edelstein L. C., Gelinas C. The Rel/NF-{kappa}B family directly activates expression of the apoptosis inhibitor Bcl-x(L). Mol. Cell. Biol., 20: 2687-2695, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
J.-J. Chen, C.-W. Chou, Y.-F. Chang, and C.-C. Chen
Proteasome Inhibitors Enhance TRAIL-Induced Apoptosis through the Intronic Regulation of DR5: Involvement of NF-{kappa}B and Reactive Oxygen Species-Mediated p53 Activation
J. Immunol., June 15, 2008; 180(12): 8030 - 8039.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Baritaki, A. Katsman, D. Chatterjee, K. C. Yeung, D. A. Spandidos, and B. Bonavida
Regulation of Tumor Cell Sensitivity to TRAIL-Induced Apoptosis by the Metastatic Suppressor Raf Kinase Inhibitor Protein via Yin Yang 1 Inhibition and Death Receptor 5 Up-Regulation
J. Immunol., October 15, 2007; 179(8): 5441 - 5453.
[Abstract] [Full Text] [PDF]