| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
B in Tumor Necrosis Factor-related Apoptosis-inducing Ligand Signaling1
Department of Pharmaceutical Sciences, Molecular and Cellular Biology Program, Greenebaum Cancer Center, University of Maryland, Baltimore, Maryland 21201-1180
| ABSTRACT |
|---|
|
|
|---|
B regulates the expression of genes involved in cancer cell invasion, metastasis, and resistance to chemotherapy. In normal unstimulated cells, NF-
B is maintained in the cytoplasm with its inhibitor protein I
B, whereas in cancer cells, NF-
B is in the nucleus and constitutively activates target genes. To understand the function of NF-
B in TRAIL-induced apoptosis, we have analyzed the specific roles of NF-
B subunits. Overexpression of a transdominant-negative mutant of the inhibitory protein I
B
results in down-regulation of constitutively active NF-
B, induction of DR5, and tumor necrosis factor receptor (TNFR) 1-associated death domain expression and enhancement of TRAIL sensitivity. Overexpression of RelA or a transcriptional-deficient mutant of c-Rel inhibits TRAIL-induced apoptosis. Depletion of RelA in mouse embryonic fibroblasts increases cytokine-induced apoptosis, whereas depletion of c-Rel blocks this process. Overexpression of RelA subunit inhibits caspase-8 and DR4 and DR5 expression and enhances expression of cIAP1 and c-IAP2 after TRAIL treatment. By comparison, overexpression of c-Rel enhances DR4, DR5, and Bcl-Xs and inhibits cIAP1, cIAP2, and survivin after TRAIL treatment. These results suggest that the RelA subunit acts as a survival factor by inhibiting expression of DR4/DR5 and caspase-8 and up-regulating cIAP1 and cIAP2. The dual function of NF-
B, as an inhibitor or activator of apoptosis, depends on the relative levels of RelA and c-Rel subunits. Thus, NF-
B activity may play an important role in tumor progression, and down-regulation of RelA or up-regulation of c-Rel represents a possible therapeutic target for the treatment of cancer. | INTRODUCTION |
|---|
|
|
|---|
Recently, Apop-2L/TRAIL3
has been shown to be a potential candidate for cancer therapy (5
, 6)
. We and others (7, 8, 9, 10, 11, 12, 13, 14)
have shown that TRAIL induces apoptosis in various cancer cell lines, including those that resist to chemotherapeutic agents or ionizing radiation because of inactivating mutations of the p53 tumor suppressor gene, but is less effective in nontransformed cells (15, 16, 17)
. TRAIL induces apoptosis by binding to TRAIL-R1 (DR4/Apo-2A) and TRAIL-R2 (DR5/TRICK/Killer; Refs. 7
, 9
, 18, 19, 20, 21, 22
). Both TRAIL-R1 and TRAIL-R2 contain a conserved cytoplasmic sequence, termed death domains, that can recruit adaptor proteins and activate caspase-8 (12
, 23
, 24)
. The cleavage and activation of caspase-8, in turn, activate downstream effector caspases such as caspase-3 and caspase-7 (25
, 26)
. Activation of caspase-8 by TRAIL may also cleave BID (a Bcl-2 inhibitory protein), the cleavage product of which triggers mitochondrial depolarization (decrease in 
m) and subsequent release of cytochrome c from mitochondria (10
, 25
, 27)
. Once released into the cytosol, cytochrome c binds to apoptotic protease-activating factor 1 and, in the presence of dATP, recruits and activates procaspase-9 to form the apoptosome (27)
. Activated caspases cleave several downstream death substrates and activate endonucleases, resulting in the apoptosis (28, 29, 30)
. Other three TRAIL receptors, TRAIL-R3 (TRID/DcR1/LIT; Refs. 19
, 31, 32, 33
), TRAIL-R4 (TRUNDD/DcR2; Refs. 13
, 34
), and osteoprotegerin (35)
, also bind to TRAIL. TRAIL-R3 and TRAIL-R4 have extracellular domains similar to TRAIL-R1 and TRAIL-R2 but lack a functional cytoplasmic death domain. TRAIL-R3 and TRAIL-R4 may serve as decoy receptors, whereas the fifth receptor, osteoprotegerin, is a secreted protein with no known membrane anchor.
NF-
B is a transcription factor that plays an important role in controlling immune and inflammatory responses, cellular proliferation and adhesion molecules (36, 37, 38, 39)
. NF-
B is a heterodimeric or homodimeric complex formed from five distinct subunits, RelA (p65), RelB, c-Rel, NF-
B1 (p50), and NF-
B2 (p52; Refs. 36
, 38 , 40
). RelA (p65), RelB, and c-Rel are transcriptionally active members of the NF-
B family, whereas p50 and p52 primarily serve as DNA binding subunits (36, 37, 38)
. The p50 and p52 NF-
B subunits are derived from larger precursor products, p105 and p100, respectively, or from differential translation of their mRNAs. The classical form of NF-
B, the heterodimer of p50 and p65 subunits, is normally retained in the cytoplasm in association with inhibitor proteins I
B
and I
Bß. When phosphorylated on serine 32 and serine 36, I
B
is degraded by the ubiquitin/26S proteasome pathway, allowing NF-
B to translocate to the nucleus and regulate gene expression (36
, 38
, 39
, 41) . Recently, NF-
B has been implicated in protecting cells from apoptosis (42, 43, 44, 45)
, whereas much evidence highlights an apparently paradoxical proapoptotic role for NF-
B (44
, 46, 47, 48)
. On the basis of these studies, it appears that opposite functions of NF-
B lies on the expression of its subunits where c-Rel and RelA functions as proapoptotic and antiapoptotic proteins, respectively.
It has recently been shown that TRAIL can activate NF-
B (44
, 49, 50, 51)
. However, the intracellular signaling pathways responsible for TRAIL receptor-mediated NF-
B activation and the role of distinct subunits of NF-
B in TRAIL-induced signaling are unclear. Here, we demonstrate the opposite roles of RelA (p65) and c-Rel subunits of NF-
B in apoptosis. RelA deficiency enhances, whereas c-Rel deficiency blocks TRAIL-induced apoptosis. Thus, NF-
B may play an important role in the sensitivity of cancer cells to the apoptotic response to TRAIL.
| MATERIALS AND METHODS |
|---|
|
|
|---|
B
, Bcl-Xs, and c-Rel were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); antibodies against DR4 and DR5 were from Imgenex, Inc. (San Diego, CA); and antibody against actin was from Oncogene Research (Boston, MA). ELISA kits for DR4 and DR5 were purchased from Biosource International, Inc. (Camarillo, CA). Enhanced chemiluminescence Western blot detection reagents were from Amersham Life Sciences, Inc. (Arlington Heights, IL). LipofectAMINE reagent was from Invitrogen Life Technologies (Carlsbad, CA). ß-Gal enzyme assay system with reporter lysis buffer was purchased from Promega (Madison, WI). Cytokine TRAIL was purchased from Biomol (Plymouth Meeting, PA). RNase protection assay kit was purchased from PharMingen (San Diego, CA). All other chemicals used were of analytical grade from Fisher Scientific (Suwanee, GA) or Sigma (St. Louis, MO).
Cells and Culture Conditions.
MDA-MB-231 and MCF-7 cells were obtained from the American Type Culture Collection (Manassas, VA). We used these two cell lines because MDA-MB-231 cells express low level of constitutively active NF-
B compared with MCF-7 cells. Cells were grown in RPMI 1640 supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin mixture. All of the cells were maintained at 37°C with 5% CO2.
Transient Transfection.
Cells were plated in 60-mm dishes in RPMI 1640 containing 10% FBS and 1% penicillin-streptomycin mixture at a density of 1 x 106 cells/dish. The next day, transfection mixtures were prepared. Cells were transfected with expression constructs encoding mutant I
B
(pCMV4-I
B-
and S32/36), c-Rel (pCMV4-c-Rel), RelA/p65 (pCMV4-p65), p50 (pCMV4-p50), or empty vector (pCMV4-neo) as control in the presence of a vector pCMV-LacZ (Invitrogen Life Technologies, Inc.) expressing ß-gal. For each transfection, 2 µg of DNA were diluted in 50 µl of medium without serum. After the addition of 3 µl of LipofectAMINE into 50 µl of Opti-MEM, the transfection mixture was incubated for 10 min at room temperature. Cells were washed with serum-free medium, the transfection mixture was added, and cultures were incubated for 24 h in the incubator. The next day, culture medium was replaced with fresh RPMI 1640 containing 10% FBS and 1% penicillin-streptomycin mixture, and TRAIL was added. At the end of incubation, cells were harvested and washed with ice-cold PBS.
Flow Cytometry.
Cells were treated with TRAIL (20 ng/ml) for various time points, harvested, and fixed in 85% ethanol. Cells were then stained with propidium iodide in PBS with 0.5% NP40 and RNase A. Propidium iodide-stained cells were analyzed using a Beckton Dickson FACStar flow cytometer. Data were analyzed by ModFit LT.
EMSA.
Nuclear extracts were prepared from cells. Double-stranded oligonucleotides containing consensus binding site for NF-
B (GATCGAGGGGACTTTCCCTACG; Promega) were 5' end-labeled using polynucleotide kinase and [
-32P]dATP. Nuclear extracts (5.0 µg) were incubated with 1 µl of labeled oligonucleotide (20,000 cpm) in 20 µl of incubation buffer [10 mM Tris-HCl, 40 mM NaCl, 1 mM EDTA, 1 mM ß-mercaptoethanol, 2% glycerol, and 2 µg of poly(deoxyinosinic-deoxycytidylic acid)] for 20 min at room temperature. The specificity of NF-
B DNA binding activity was confirmed by competition with excess cold wild-type or nonconsensus oligonucleotide. Supershift was assayed by additional incubations with rabbit polyclonal antibodies against p65, p50, or c-Rel for 45 min at room temperature before incubation of the labeled oligonucleotide. Anti-ß-actin antibody was used as control. DNA protein complexes were resolved by electrophoresis in 6% nondenaturing polyacrylamide gels and analyzed by autoradiography.
Reporter Transfection and Luciferase Assay.
The transcription activity of NF-
B was assayed by the transfection of luciferase reporter containing specific consensus sequence of NF-
B and ß-gal as a control into cells, and luciferase activity was measured and normalized by ß-gal activity as per manufacturers directions (Promega).
RNase Protection Assay.
Total RNAs were extracted using Trizol reagent (Life Technologies, Inc., Gaithersburg, MD). The RNase Protection Assay was performed as per manufactures directions (Pharmigen). Briefly, 2 µg of RNA was incubated with
-32P-UTP labeled single-stranded RNA probes overnight at 56°C and treated with RNase for 45 min at 30°C. The RNA-RNA complexes were resolved by electrophoresis in 6% denaturing polyacrylamide gels and analyzed by autoradiography.
Immunoblot Assays.
Cells were lysed in a buffer containing 10 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.5 mM EDTA, 1 mM EGTA, 1% SDS, 1 mM sodium orthovanadate, and a mixture of protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, and 2 µg/ml aprotinin). Lysates were centrifuged for 20 min at 12,000 x g and stored at -70°C. Proteins were resolved by SDS-PAGE, transferred onto polyvinylidene difluoride membrane (Bio-Rad), and probed with appropriate dilutions of primary antibodies. Immunoreactive protein complexes were visualized by enhanced chemiluminescent kit (Amersham).
DR4 and DR5 ELISA.
MDA-MB-231 and MCF-7 cells were treated with TRAIL for 48 h. At the end of incubation period, cells were harvested and washed twice with ice-cold PBS. Cells were lysed in extraction buffer for 30 min on ice with vortexing at 10-min intervals. The extracts were centrifuged at 13,000 rpm for 10 min at 4°C. Lysates were aliquoted and assayed for DR4 and DR5 proteins by ELISA as per manufactures directions (Biosource International, Inc., Camarillo, CA).
| RESULTS |
|---|
|
|
|---|
B in Breast Cancer MDA-MB-231 and MCF-7 Cells.
B in the regulation of apoptosis (52, 53, 54)
. In some breast cancer cells, NF-
B is constitutively activated (54
, 55)
and, therefore, may change the apoptotic response of several anticancer drugs and irradiation. To determine whether NF-
B plays a role in TRAIL-induced apoptotic signaling in breast cancer cells, we first examined the activation of NF-
B (Fig. 1A)
B to nucleus was examined by EMSAs. The NF-
B binding activity was increased in a time-dependent manner in MDA-MB-231 cells after treatment with TRAIL, reaching a maximum at 2 h (Fig. 1A)
B was observed in untreated cells, which was additionally increased by TRAIL treatment as early as 20 min (Fig. 1A)
|
B by luciferase assay. MDA-MB-231 and MCF-7 cells were transiently transfected with
B-luciferase reporter plasmid construct and the NF-
B transactivity was measured by the luciferase assay (Fig. 1B)
B transactivation was induced 25-fold in MDA-MB-231 cells at 2 h and 3.5-fold in MCF-7 cells at 40 min by TRAIL (Fig. 1B)
B-DNA binding and
B-dependent transcriptional activity in MDA-MD-231 and MCF-7 cells.
Effects of RelA (p65), p50, and c-Rel Subunits on TRAIL-induced NF-
B-DNA Binding Activity.
Recent studies have shown conflicting data on the physiological role of NF-
B on cell survival and apoptosis (37
, 43, 44, 45, 46, 47, 48)
. It is possible that the dual functions of NF-
B depend on its subunits. To additionally identify which NF-
B subunit(s) contributes to enhanced DNA binding activity, we performed supershift assay with specific antibodies against different subunits of NF-
B, i.e., RelA (p65), p50, and c-Rel (Fig. 2)
. An antibody against ß-actin was also used in the experiment as a negative control. Treatment of cells with TRAIL enhanced the NF-
B-DNA binding activity in MDA-MB-231 cells. Incubation of nuclear extracts with unlabelled consensus NF-
B oligonucleotide completely displaced complexes I and II, suggesting the specificity of NF-
B bands. An antibody specific for the p65 subunit of NF-
B, which can recognize p65 homodimers and p50/p65 heterodimers of NF-
B, supershifted complex I and was unable to shift complex II in MDA-MB-231 cells (Fig. 2)
. An antibody specific for p50 also caused a supershift in MDA-MB-231 cells. By comparison in MCF-7 cells, anti-p50 antibody caused a major supershift. No significant supershift was observed with anti-c-Rel antibody in both cell lines, probably because of the nature of antibody (Fig. 2)
. Anti-ß actin antibody did not cause supershift in both MDA-MB-231 and MCF-7 cells.
|
B in cell survival and apoptosis is not clear (37
, 43, 44, 45, 46, 47, 48)
. NF-
B has been found to act as an antiapoptotic or a proapoptotic factor. The opposing effects of NF-
B on cell survival and apoptosis may be attributable to differential expression of its subunits. We therefore sought to examine the specific role of NF-
B subunits on TRAIL-induced signaling. MDA-MB-231 and MCF-7 cells were transiently transfected with plasmid cDNAs containing different subunits of NF-
B (RelA/p65, p50, and c-Rel) and a mutant NF-
B inhibitory protein I
B
(serine 32/serine 36) termed as mI
B
. We first confirmed the transfection of various subunits of NF-
B (RelA, p50, and c-Rel) and mI
B
by the Western blot analysis (Fig. 3A)
|
B subunits in TRAIL-induced apoptosis, transfected cells were treated with or without TRAIL (20 ng/ml) for various time periods, fixed, and stained with DAPI. The mI
B
(serine 32/serine 36) expression slightly enhanced the apoptotic response to TRAIL (20 ng/ml) in both MDA-MB-231 and MCF-7 cells (Fig. 3B)
B induced by TRAIL, the results suggested that RelA (p65) subunit of NF-
B blocks, whereas c-Rel enhances TRAIL-induced apoptosis at 24 h.
Because RelA (p65) subunit of NF-
B inhibited TRAIL-induced apoptosis, we next examined its effect on DNA binding and NF-
B activity (Fig. 4)
. MDA-MB-231 cells were transiently transfected with plasmid cDNAs containing RelA subunit of NF-
B or a mI
B
. MDA-MB-231 cells showed increased NF-
B-DNA binding activity of RelA (p65) subunit, whereas mI
B
decreased the NF-
B binding activity in MDA-MB-231 cells (Fig. 4A)
. Treatment of cells with MG132, a proteosome inhibitor, inhibited TRAIL-induced NF-
B-DNA binding activity.
|
B enhanced NF-
B-DNA binding activity, we sought to examine whether this subunit increases the transcriptional activity of NF-
B. MDA-MB-231 cells were transiently transfected with plasmid cDNAs containing various subunits of NF-
B or mI
B
and treated with or without TRAIL for 2 h (Fig. 4B)
B
inhibited, whereas RelA (p65) enhanced TRAIL-induced luciferase activity. Under these conditions, overexpression of p50 had no effect on luciferase activity, whereas c-Rel subunit slightly enhanced luciferase activity in MDA-MB-231 cells treated with TRAIL (Fig. 4B)
NH2-terminal of c-Rel subunit of NF-
B contains a conserved region known as the Rel homology domain, which mediates dimerization and nuclear localization, and a variable COOH-terminal domain, which is responsible for transactivation. To examine directly the effects of RelA or c-Rel on TRAIL-induced apoptosis, RelA, c-Rel (CCR43), or a c-Rel truncation mutant lacking the COOH-terminal transactivation domain (
c-Rel; CCR-H5) were conditionally expressed in HeLa cells using a tetracycline-regulated system (Fig. 5A)
. The RelA, c-Rel, or truncated c-Rel (
c-Rel) genes were expressed under control of the tTA fusion activator, comprising the Escherichia coli tetracycline repressor and the activation domain of the VP16 protein of herpes simplex virus. Cells were grown in the absence of tetracycline for 48 h to induce expression of RelA and c-Rel (wild-type and mutant). Induction of c-Rel by removing tetracycline resulted in a dose-dependent increase in TRAIL-induced apoptosis in CCR43 (c-Rel overexpressing) cells (Fig. 5A)
. In contrast, expression of
c-Rel by removing tetracycline in CCR-H5 cells rendered these cells resistant to TRAIL. Interestingly, induced expression of RelA inhibited TRAIL-induced apoptosis (Fig. 5A)
.
|
or TRAIL (Fig. 5B)
-mediated apoptosis, but c-Rel -/- or wild-type fibroblasts remained relatively resistant to TNF-
. Wild-type and RelA-/- MEFs were both susceptible to TRAIL-induced apoptosis, whereas c-Rel-/- MEFs were almost completely resistant to TRAIL. These data confirmed our previous findings that RelA subunit can inhibit TRAIL-induced apoptosis, whereas c-Rel can enhance the apoptotic response of TRAIL.
Regulation of Death Receptors and Caspase-8 by NF-
B.
TRAIL initiates apoptosis by binding to death receptors and the activation of caspase-8 (6
, 9
, 25)
. Several reports indicated that mitochondrial dysfunctions and Bcl2 family members played important roles in TRAIL signaling. To understand the mechanism of RelA subunit of NF-
B in control of apoptotic response in MDA-MB-231 and MCF-7 cells to TRAIL, the expression of death receptors and caspase-8 was analyzed by RNase protection assay and immunoblotting. MDA-MB-231 and MCF-7 cells were transfected with different subunits of NF-
B or a mI
B
and treated with or without of TRAIL. The RNase protection assays were performed with probe-set of hAPO-3c (caspase-8, Fas, FasL, DcR1, DR3, DR5, DR4, TRAIL, TNFRp55, TRADD, and RIP) as per manufacturers directions (PharMingen). Overexpression of p65 subunit of NF-
B inhibited the mRNA expression of DR4, DR5, and caspase-8 in MDA-MB-231 cells treated with TRAIL (Fig. 6A)
. In contrast, overexpression of c-Rel subunit of NF-
B enhanced the mRNA expression of DR4, DR5, and caspase-8 in MDA-MB-231 cells treated with TRAIL (Fig. 6A)
. Overexpression of p50 subunit of NF-
B had no effect on the expression of caspase-8, FAS, FasL, DcR1, DR3, DR5, DR4, TRADD, and RIP in the absence or presence of TRAIL. Overexpression of mI
B
significantly enhanced expression of DR5 and TRADD in MDA-MB-231 cells (Fig. 6B)
. Similarly, overexpression of p65 subunit of NF-
B inhibited the mRNA expression of DR4 and caspase-8 in MCF-7 cells treated with TRAIL (data not shown).
|
B in MDA-MB-231 cells inhibited death receptors DR4 and DR5 after TRAIL treatment. In contrast, overexpression of c-Rel subunit of NF-
B in MDA-MB-231 cells enhanced DR4 and DR5 proteins after TRAIL treatment. There was no difference in loading as evident from antitubulin antibody.
We next measured the effects of overexpression of p65 and c-Rel subunits of NF-
B on DR4 and DR5 proteins by ELISA (Biosource International). TRAIL induced DR4 and DR5 proteins in MDA/Neo cells (Fig. 6, D and E)
. Overexpression of RelA (p65) subunit of NF-
B in MDA-MB-231 cells inhibited death receptors DR4 and DR5 after TRAIL treatment. In contrast, overexpression of c-Rel subunit of NF-
B in MDA-MB-231 cells enhanced DR4 and DR5 proteins after TRAIL treatment. These data confirmed our previous findings that overexpression of Rel A (p65) inhibits DR4 and DR5, whereas overexpression of c-Rel enhances DR4 and DR5 proteins in MDA-MB-231 cells.
Regulation of Bcl-2 Family Members by NF-
B.
Bcl-2 family proteins play important roles in apoptotic response of cancer cells treated with chemotherapeutic drugs or irradiation (30
, 56)
. The regulation of Bcl-2 family members by NF-
B is still unclear. Recently, it has been shown that NF-
B can induce expression of Bcl-XL and a Bcl-2 homologue A1/Bfl-1 (57
, 58)
. In our experiment, no significant changes were found in the transcriptional level of Bcl-2 family members (except Bcl-X) in TRAIL-induced apoptotic signaling in both of MDA-MB-231 and MCF-7 cells overexpressing different subunits of NF-
B and mI
B
(Fig. 7, A and B)
. Interestingly, overexpression of c-Rel significantly enhanced the expression of Bcl-X in MDA-MB-231 cells after TRAIL treatment, this band was later identified as Bcl-Xs protein by immunoblot analysis (Fig. 7C)
. Thus, the results suggested that c-Rel could promote the expression of proapoptotic gene Bcl-Xs.
|
B.
B can protect cells from apoptosis by promoting expression of survival genes such as Bf1/A1, TRAF1, TRAF2, c-IAP1, and c-IAP-2 (59
, 60)
. However, which subunit of NF-
B is important in the regulation of survival factors in cells are unknown. We therefore examined the expression of IAP, c-IAP1, cIAP2, and survivin in MDA-MB-231 cells overexpressing p65, p50, and c-Rel subunits of NF-
B or mI
B
(Fig. 8)
B
inhibited cIAP1 and cIAP2 after TRAIL treatment. Overexpression of RelA (p65), p50, or mI
B
had no effect on the expression of survivin, whereas overexpression of c-Rel significantly inhibited survivin after TRAIL treatment.
|
| DISCUSSION |
|---|
|
|
|---|
B in TRAIL-induced apoptosis in breast cancer cells. The oncogenic role of NF-
B was observed earlier in leukemia and lymphoma (61)
, breast cancer (52)
, and pancreatic cancer (62)
. Apparently, the physiological roles of NF-
B in cell survival and apoptosis (37
, 43
, 45, 46, 47, 48
, 57
, 59
, 63, 64, 65, 66)
have provided conflicting views. In certain situations, NF-
B acts as an antiapoptotic, whereas in others it functions as proapoptotic transcription factor. Therefore, additional studies are needed to examine the physiological roles of NF-
B subunits.
In our study, overexpression of RelA inhibits TRAIL-induced apoptosis, whereas overexpression of c-Rel enhances TRAIL-induced apoptosis. Similarly, inhibition of RelA subunit of NF-
B results in hepatic cell death and embryonic lethality of mice (43)
. Furthermore, depletion of Rel A or inhibition of NF-
B phosphorylation, via the expression of the super-repressor form of I
B
, sensitizes cells to cytokine-induced apoptosis (43
, 45
, 53
, 65)
. This suggests that NF-
B plays a survival role in oncogenesis because inhibition of NF-
B in transformed cells can induce apoptosis. In contrast to these studies, NF-
B can function as proapoptotic in other situations. Interestingly, constitutively active NF-
B through targeted disruption of I
B
causes a massive thymic and splenic cell death in mouse embryos (63)
. Furthermore, high levels of the c-Rel subunit of NF-
B have been noticed during apoptosis in the developing avian embryo (46)
.
On the basis of our studies, it appears that dual functions of NF-
B, as proapoptotic or antiapoptotic, depend on its subunits c-Rel or RelA (p65), respectively. Activation of c-Rel subunit of NF-
B results in induction of apoptosis-related genes such as DR4, DR5, and Bcl-Xs, and inhibition of survival genes such as cIAP1, cIAP2, and survivin. By comparison, activation of RelA (p65) subunit of NF-
B inhibits expression of apoptotic genes such as caspase-8, DR4, and DR5 and enhances expression of cIAP1 and cIAP2. Thus, the ratio between c-Rel and RelA (p65) subunits will determine whether the activation of NF-
B will trigger apoptotic or survival signal.
In our study, MCF-7 cells express higher level constitutively active NF-
B and are less sensitive to TRAIL-induced apoptosis compared with MDA-MB-231 cells, which express lower level of constitutively active NF-
B. It appears that constitutive activation of NF-
B can prevent TRAIL-induced apoptosis. The mechanism by which the constitutive activation of NF-
B antagonizes TRAIL-induced apoptosis remains to be elucidated. There are several possible candidates that may regulate apoptosis. NF-
B suppression of apoptosis appears to be at transcriptional level because it regulates expression of TRAF1, TRAF2, cIAP-1, and cIAP-2. Other antiapoptotic genes that are transcriptionally activated by NF-
B are the Bcl-2 homologues A1/Bfl1 and Bcl-XL, LEX-1, and XIAP. NF-
B can antagonize p53 function, possibly through the cross-competition for transcriptional coactivators. Conversely, p53 may in some cases act through NF-
B to induce apoptosis (48)
.
It has been reported that constitutively active NF-
B in breast cancer cells generally does not consist of p50-p65 heterodimer but rather complexes that contain p50, p52, and Bcl-3 (55)
. The nuclear accumulation of Bcl-3 is independent of inhibition by other I
B proteins and of I
B kinase stimulation. Thus, I
B expression does not generate a true NF-
B null phenotype and may, in fact, lead to the up-regulation of functionally different NF-
B complexes. Therefore, different NF-
B complexes (some lacking NF-
B) may control growth and differentiation in different cell types or in response to different stimuli. It is possible to speculate that there are opposing roles for NF-
B subunits in transformation.
In summary, we have provided direct evidence that the dual function of NF-
B, as an inhibitor or activator of apoptosis, depends on the relative levels of RelA (p65) or c-Rel subunits, respectively. The ratio between RelA (p65) and c-Rel subunits will determine whether activation of NF-
B will trigger apoptotic or survival signal. In addition, up-regulation of RelA (p65) subunit of NF-
B can enhance TRAIL resistance, whereas up-regulation of c-Rel can enhance TRAIL sensitivity. Thus, regulation of NF-
B subunits may be a novel strategy for cancer therapy.
| ACKNOWLEDGMENTS |
|---|
B
(serine 32/serine 36), Rel A/p65, p50, and c-Rel expression vectors. We also thank Dr. Céline Gélinas (Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, NJ) for providing c-Rel,
c-Rel, RelA-expressing HeLa cells, and c-Rel-/- MEFs and Dr. Amer Beg (Department of Biological Sciences, Columbia University, New York, NY) for RelA-/- MEFs. | FOOTNOTES |
|---|
1 This work was supported by grants from Susan G. Komen Breast Cancer Foundation and Charlotte Geyer Foundation. ![]()
2 To whom requests for reprints should be addressed, at Department of Pharmaceutical Sciences, University of Maryland, Greenebaum Cancer Center, 20 North Pine Street, Baltimore, MD 21201-1180. E-mail: rsrivast{at}rx.umaryland.edu ![]()
3 The abbreviations used are: TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; I
B, inhibitor of nuclear factor-
B; FBS, ß-gal, ß-galactosidase; fetal bovine serum; EMSA, electrophoretic mobility shift assay; DAPI, 4',6-diamidino-2-phenylindole; MEF, mouse embryonic fibroblast; TNF, tumor necrosis factor; FasL, Fas ligand; TRADD, tumor necrosis factor receptor (TNFR)1-associated death domain; RIP, receptor interacting protein; IAP, inhibitor of apoptosis protein. ![]()
Received 9/30/02. Accepted 1/ 6/03.
| REFERENCES |
|---|
|
|
|---|
B. Immunity, 7: 831-836, 1997.[Medline]
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity, 7: 813-820, 1997.[Medline]
B and human disease. J. Clin. Investig., 107: 3-6, 2001.[Medline]
B: ten years after. Cell, 87: 13-20, 1996.[Medline]
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16: 225-260, 1998.[Medline]
B/I
B family: intimate tales of association and dissociation. Genes Dev., 9: 2723-2735, 1995.
B family: friend and foe. Trends Biochem. Sci., 25: 434-440, 2000.[Medline]
B in the immune system. Annu. Rev. Immunol., 12: 141-179, 1994.[Medline]
B ß in T cells of transgenic mice: persistent NF-
B activity is required for T-cell immune responses. Mol. Cell. Biol., 18: 477-487, 1998.
B in preventing TNF-
-induced cell death [see comments]. Science (Wash. DC), 274: 782-784, 1996.
B. Nat. Cell Biol., 3: 409-416, 2001.[Medline]
-induced apoptosis by NF-
B [see comments]. Science (Wash. DC), 274: 787-789, 1996.
B: neurodestruction versus neuroprotection. Nat. Med., 3: 20-22, 1997.[Medline]
B in p53-mediated programmed cell death. Nature (Lond.), 404: 892-897, 2000.[Medline]
B and JNK activation and apoptosis through distinct pathways. J. Biol. Chem., 274: 30603-30610, 1999.
B prevents TRAIL-induced apoptosis in renal cancer cells. Oncogene, 20: 3888-3896, 2001.[Medline]
B and c-Jun N-terminal kinase. J. Biol. Chem., 274: 19368-19374, 1999.
B/Rel expression and the pathogenesis of breast cancer. J. Clin. Investig., 100: 2952-2960, 1997.[Medline]
B [see comments]. Science (Wash. DC), 274: 784-787, 1996.
B and AP-1 by I
Bß1 in breast cancer cells. J. Biol. Chem., 274: 18827-18835, 1999.
B subunits in human breast cancer: potential roles for NF-
B2/p52 and for Bcl-3. Oncogene, 19: 1123-1131, 2000.[Medline]
B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis. Mol. Cell. Biol., 19: 5923-5929, 1999.
B that blocks TNF-
-induced apoptosis. Genes Dev., 13: 382-387, 1999.
B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science (Wash. DC), 281: 1680-1683, 1998.
B activation. Oncogene, 20: 385-394, 2001.[Medline]
B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clin. Cancer Res., 5: 119-127, 1999.
B activation, enhanced granulopoiesis, and neonatal lethality in I
B
-deficient mice. Genes Dev., 9: 2736-2746, 1995.
B. Trends Cell. Biol., 8: 107-111, 1998.[Medline]
B activation prevents cell death. Cell, 87: 565-576, 1996.[Medline]
B family directly activates expression of the apoptosis inhibitor Bcl-x(L). Mol. Cell. Biol., 20: 2687-2695, 2000.This article has been cited by other articles:
![]() |
Z. Liu, Z. Ma, L. S. Terada, and W. T. Garrard Divergent Roles of RelA and c-Rel in Establishing Chromosomal Loops upon Activation of the Ig{kappa} Gene J. Immunol., September 15, 2009; 183(6): 3819 - 3830. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Tabruyn, S. Memet, P. Ave, C. Verhaeghe, K. H. Mayo, I. Struman, J. A. Martial, and A. W. Griffioen NF-{kappa}B activation in endothelial cells is critical for the activity of angiostatic agents Mol. Cancer Ther., September 1, 2009; 8(9): 2645 - 2654. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.R.M. R. Amin, F. R. Khuri, Z. Chen, and D. M. Shin Synergistic Growth Inhibition of Squamous Cell Carcinoma of the Head and Neck by Erlotinib and Epigallocatechin-3-Gallate: The Role of p53-Dependent Inhibition of Nuclear Factor-{kappa}B Cancer Prevention Research, June 1, 2009; 2(6): 538 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shankar, R. Davis, K. P. Singh, R. Kurzrock, D. D. Ross, and R. K. Srivastava Suberoylanilide hydroxamic acid (Zolinza/vorinostat) sensitizes TRAIL-resistant breast cancer cells orthotopically implanted in BALB/c nude mice Mol. Cancer Ther., June 1, 2009; 8(6): 1596 - 1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Rahman, S. Banerjee, S. Ali, A. Ahmad, Z. Wang, D. Kong, and W. A. Sakr 3,3'-Diindolylmethane Enhances Taxotere-Induced Apoptosis in Hormone-Refractory Prostate Cancer Cells through Survivin Down-regulation Cancer Res., May 15, 2009; 69(10): 4468 - 4475. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Chen, C.-W. Chou, Y.-F. Chang, and C.-C. Chen Proteasome Inhibitors Enhance TRAIL-Induced Apoptosis through the Intronic Regulation of DR5: Involvement of NF-{kappa}B and Reactive Oxygen Species-Mediated p53 Activation J. Immunol., June 15, 2008; 180(12): 8030 - 8039. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Baritaki, A. Katsman, D. Chatterjee, K. C. Yeung, D. A. Spandidos, and B. Bonavida Regulation of Tumor Cell Sensitivity to TRAIL-Induced Apoptosis by the Metastatic Suppressor Raf Kinase Inhibitor Protein via Yin Yang 1 Inhibition and Death Receptor 5 Up-Regulation J. Immunol., October 15, 2007; 179(8): 5441 - 5453. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Baritaki, S. Huerta-Yepez, T. Sakai, D. A. Spandidos, and B. Bonavida Chemotherapeutic drugs sensitize cancer cells to TRAIL-mediated apoptosis: up-regulation of DR5 and inhibition of Yin Yang 1 Mol. Cancer Ther., April 1, 2007; 6(4): 1387 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mentaverri, S. Yano, N. Chattopadhyay, L. Petit, O. Kifor, S. Kamel, E. F. Terwilliger, M. Brazier, and E. M. Brown The calcium sensing receptor is directly involved in both osteoclast differentiation and apoptosis FASEB J, December 1, 2006; 20(14): 2562 - 2564. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. El-Rayes, S. Ali, I. F. Ali, P. A. Philip, J. Abbruzzese, and F. H. Sarkar Potentiation of the Effect of Erlotinib by Genistein in Pancreatic Cancer: The Role of Akt and Nuclear Factor-{kappa}B Cancer Res., November 1, 2006; 66(21): 10553 - 10559. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gao, D. L. Dai, M. Martinka, and G. Li Prognostic Significance of Nuclear Factor-{kappa}B p105/p50 in Human Melanoma and Its Role in Cell Migration. Cancer Res., September 1, 2006; 66(17): 8382 - 8388. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Collett and F. C. Campbell Overexpression of p65/RelA potentiates curcumin-induced apoptosis in HCT116 human colon cancer cells Carcinogenesis, June 1, 2006; 27(6): 1285 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Rahman, Y. Li, Z. Wang, S. H. Sarkar, and F. H. Sarkar Gene Expression Profiling Revealed Survivin as a Target of 3,3'-Diindolylmethane-Induced Cell Growth Inhibition and Apoptosis in Breast Cancer Cells. Cancer Res., May 1, 2006; 66(9): 4952 - 4960. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kang, S.-K. Kang, Y.-C. Lee, H.-J. Choi, Y.-S. Lee, S.-Y. Cho, Y.-S. Kim, J.-H. Ko, and C.-H. Kim Transcriptional regulation of the human GD3 synthase gene expression in Fas-induced Jurkat T cells: a critical role of transcription factor NF-{kappa}B in regulated expression Glycobiology, May 1, 2006; 16(5): 375 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zetterberg, W. A. Campbell, H. W. Yang, and W. Xia The Cytosolic Loop of the {gamma}-Secretase Component Presenilin Enhancer 2 Protects Zebrafish Embryos from Apoptosis J. Biol. Chem., April 28, 2006; 281(17): 11933 - 11939. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hasegawa, Y. Yamada, K. Komiyama, M. Hayashi, M. Ishibashi, T. Yoshida, T. Sakai, T. Koyano, T.-S. Kam, K. Murata, et al. Dihydroflavonol BB-1, an extract of natural plant Blumea balsamifera, abrogates TRAIL resistance in leukemia cells Blood, January 15, 2006; 107(2): 679 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kim, I. Chang, J. Y. Kim, K.-H. Choi, and M.-S. Lee Caspase-Mediated p65 Cleavage Promotes TRAIL-Induced Apoptosis Cancer Res., July 15, 2005; 65(14): 6111 - 6119. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shetty, B. A. Graham, J. G. Brown, X. Hu, N. Vegh-Yarema, G. Harding, J. T. Paul, and S. B. Gibson Transcription Factor NF-{kappa}B Differentially Regulates Death Receptor 5 Expression Involving Histone Deacetylase 1 Mol. Cell. Biol., July 1, 2005; 25(13): 5404 - 5416. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Farhana, M. I. Dawson, and J. A. Fontana Apoptosis Induction by a Novel Retinoid-Related Molecule Requires Nuclear Factor-{kappa}B Activation Cancer Res., June 1, 2005; 65(11): 4909 - 4917. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wuerzberger-Davis, P.-Y. Chang, C. Berchtold, and S. Miyamoto Enhanced G2-M Arrest by Nuclear Factor-{kappa}B-Dependent p21waf1/cip1 Induction Mol. Cancer Res., June 1, 2005; 3(6): 345 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sweeney, L. Li, R. Shanmugam, P. Bhat-Nakshatri, V. Jayaprakasan, L. A. Baldridge, T. Gardner, M. Smith, H. Nakshatri, and L. Cheng Nuclear Factor-{kappa}B Is Constitutively Activated in Prostate Cancer In vitro and Is Overexpressed in Prostatic Intraepithelial Neoplasia and Adenocarcinoma of the Prostate Clin. Cancer Res., August 15, 2004; 10(16): 5501 - 5507. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Guo, U. N. Verma, R. B. Gaynor, E. P. Frenkel, and C. R. Becerra Enhanced Chemosensitivity to Irinotecan by RNA Interference-Mediated Down-Regulation of the Nuclear Factor-{kappa}B p65 Subunit Clin. Cancer Res., May 15, 2004; 10(10): 3333 - 3341. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Singh, S. Shankar, X. Chen, M. Asim, and R. K. Srivastava Synergistic Interactions of Chemotherapeutic Drugs and Tumor Necrosis Factor-related Apoptosis-inducing Ligand/Apo-2 Ligand on Apoptosis and on Regression of Breast Carcinoma in Vivo Cancer Res., September 1, 2003; 63(17): 5390 - 5400. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Secchiero, D. Milani, A. Gonelli, E. Melloni, D. Campioni, D. Gibellini, S. Capitani, and G. Zauli Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) and TNF-{alpha} promote the NF-{kappa}B-dependent maturation of normal and leukemic myeloid cells J. Leukoc. Biol., August 1, 2003; 74(2): 223 - 232. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |