
[Cancer Research 63, 1083-1092, March 1, 2003]
© 2003 American Association for Cancer Research
Transforming Growth Factor ß1 Stimulates Vascular Endothelial Growth Factor Gene Transcription in Human Cholangiocellular Carcinoma Cells1
Christoph Benckert,
Sven Jonas,
Thorsten Cramer,
Zofia von Marschall,
Georgia Schäfer,
Michael Peters,
Karola Wagner,
Cornelia Radke,
Bertram Wiedenmann,
Peter Neuhaus,
Michael Höcker and
Stefan Rosewicz2
Departments of General Visceral and Transplantation Surgery [C. B., S. J., P. N.], Hepatology, Gastroenterology, Endocrinology and Metabolism [T. C., Z. v. M., G. S., M. P., K. W., B. W., M. H., S. R.], and Pathology [C. R.], Charité, Humboldt-University, 13353 Berlin, Germany
 |
ABSTRACT
|
|---|
The expression pattern and functional interaction of proangiogenic factors in human cholangiocellular carcinoma (CCC) have not been fully defined. We therefore investigated the expression of vascular endothelial growth factor (VEGF) and transforming growth factor (TGF)-ß1 as well as their respective receptors in human CCC tumor samples and further analyzed their functional interaction in vitro. Expression of VEGF, TGF-ß1, and their receptors was examined by immunohistochemistry, in situ hybridization, quantitative competitive reverse transcription-PCR, and ELISA. VEGF promoter analysis and identification of transcription factors involved in promoter regulation were investigated using transient transfection and electrophoretic mobility shift assays. We observed strong expression of VEGF in CCC tumor cells and localization of VEGF receptors 1 and 2 in endothelial cells; in addition, coexpression of TGF-ß1 and its receptors in tumor cells suggests a possible functional interaction between both cytokines. In vitro studies confirmed a paracrine/autocrine stimulation of VEGF by TGF-ß1 at a transcriptional level. Additional molecular studies using 5' deletion and mutational analysis of the human VEGF promoter revealed that TGF-ß1 stimulates VEGF through Sp1-dependent transcriptional activation. These data suggest that overexpression and functional interaction of TGF-ß1 and VEGF might contribute to the "angiogenic switch" and the malignant phenotype in human CCC.
 |
INTRODUCTION
|
|---|
Intrahepatic human CCC3
is the second most common primary hepatobiliary cancer subsequent to hepatocellular carcinoma. Despite overall advances in the ability to diagnose and treat patients with CCC, the prognosis for this disease still remains poor (1
, 2) . One of the most important factors influencing the dismal prognosis of CCC is based on late diagnosis at an advanced stage of disease, when tumor cell invasion into blood and lymphatic vessels has resulted in metastatic spread, and curative resection can no longer be achieved (3)
.
In recent years, considerable experimental evidence has accumulated, emphasizing the role of angiogenesis for tumor growth and metastasis (4, 5, 6)
. Cancer cells, often during the premalignant stages of tumor development, can activate quiescent endothelial cells through a process termed "angiogenic switch," which is characterized by overexpression of proangiogenic factors paralleled by decreased expression of antiangiogenic factors (7
, 8)
.
Among these proangiogenic factors, VEGF plays a predominant role for the induction of tumor-associated angiogenesis (9, 10, 11)
. VEGF was originally discovered as a mediator of both vascular permeability and endothelial cell proliferation (12
, 13) and is widely expressed during development and in various pathological states, most notably tumorigenesis. Generally, VEGF is detected in most malignant epithelial tumor cells: VEGF165 is the predominant isoform; and VEGF206 is rarely expressed (10
, 11
, 14)
. The biological effects of VEGF are mediated mainly by the tyrosine kinase receptors VEGFR-1 (fms-like tyrosine kinase) and VEGFR-2 [KDR/fetal liver kinase 1 (15
, 16)
]. Both receptors are predominantly expressed in vascular endothelial cells of tumor vessels (10
, 11
, 17)
.
In addition to VEGF, TGF-ß (particularly TGF-ß1) has featured prominently among cytokines studied for their capability to regulate angiogenesis, both in vitro and in vivo (18)
. TGF-ß1 is a secreted multifunctional protein that modulates a diverse set of cellular responses such as cell proliferation, differentiation, angiogenesis, and metastasis (18, 19, 20)
. TGF-ß1 signaling is initiated by assembling two serine/threonine receptor complexes, known as type I and type II receptors, that activate Smad complexes (19)
. After TGF-ß binding to its receptors, the receptor-regulated Smads (R-Smads), Smad2 and Smad3, are phosphorylated by the type I receptor and associate with the common partner Smad4. The resulting heteromultimer translocates to the nucleus, where it regulates expression of TGF-ß target genes (21)
.
Little is currently known about the expression of the VEGF/VEGFR and TGF-ß/TGF-ß receptor systems in human CCC. The current study was therefore initiated to evaluate the expression of both cytokines and their receptors in human CCC and to explore the potential interaction between these factors at a molecular level.
 |
MATERIALS AND METHODS
|
|---|
Materials.
The following materials were purchased from the indicated manufacturers: (a) DMEM, RPMI 1640, and PBS, Life Technologies, Inc. (Berlin, Germany); (b) UltraCulture medium, BioWhittaker (Verviers, Belgium); (c) FCS, trypsin/EDTA, penicillin, and streptomycin, Biochrom (Berlin, Germany); (d) DNA molecular size markers, oligo(dT) primers, and restriction enzymes, Bethesda Research Laboratories (Bethesda, MD); (e) Thermus aquaticus DNA polymerase, Perkin-Elmer (Norwalk, CT); (f) Omniscript Reverse Transcriptase Kit for first-strand cDNA synthesis, Qiagen (Hilden, Germany); (g) colorimetric Bradford protein assay, Bio-Rad Laboratories (Hercules, CA,); (h) polyclonal rabbit anti-VEGF, polyclonal rabbit anti-VEGFR-1, polyclonal anti-VEGFR-2, polyclonal rabbit TGF-ß1, TßR-I, and TßR-II, anti-Sp1, anti-Sp3, anti-AP2, and anti-Egr-1 Abs, Santa Cruz Biotechnology (Santa Cruz, CA); (i) monoclonal mouse anti-CD31 Ab, Dianova (Hamburg, Germany); and (j) RNAzol B, Wak-Chemie Medical (Bad Soden, Germany). All other chemicals and reagents were purchased from Sigma Chemical Co. (Deisenhofen, Germany). ELISAs for TGF-ß1 and VEGF and TGF-ß1 and pan-specific TGF-ß Ab were purchased from R&D Systems (Minneapolis, MN). The human bile duct carcinoma cell lines EGI-1 and TFK-1 were obtained from the German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung für Mikroorganismen und Zelluulturen, Braunschweig, Germany).
Tissue Samples.
CCC tissue samples were obtained from 19 individuals who underwent surgical resection at the Department of Surgery at Charité University Hospital. Fifteen samples contained normal liver tissue at resection margins and served as control tissues.
Immunohistochemistry.
Immunohistochemical analysis of surgically resected formalin-fixed, paraffin-embedded tissue samples was carried out using the alkaline phosphatase/anti-alkaline phosphatase method exactly as described previously (22)
. To confirm the specificity of the observed immunohistochemical signal, two independent approaches were used: (a) serial dilution of the primary Ab until the signal disappeared; and (b) preimmune rabbit IgG as the first Ab that failed to reveal relevant staining. Sections were analyzed by two independent investigators. MVD was determined by light microscopy according to the procedure of Weidner et al. (23)
.
In Situ Hybridization.
Sense and antisense 35S-labeled cRNA probes were prepared from human cDNAs subcloned into pBluescript KS vectors: a 517-bp fragment of VEGF121 cDNA was subcloned into a SmaI site; a 1080-bp fragment of fms-like tyrosine kinase cDNA was subcloned into a Sall and a NotI site; and a 1400-bp fragment of KDR was subcloned into a BamIII site. Prehybridization, hybridization, washing procedures, and RNase digestion of mismatched sequences as well as autoradiography were performed as described previously (22)
.
Cell Cultures.
TFK-1 and EGI-1 cells were cultured in DMEM or RPMI 1640, respectively, supplemented with 10% (v/v) FCS, 100 units/ml penicillin, and 100 µg/ml streptomycin. All cells were grown as a subconfluent monolayer in a humidified atmosphere containing 5% CO2 at 37°C.
ELISA for VEGF and TGF-ß1 in Cell Cultures.
For generation of conditioned media, 2 x 104 cells were plated in 24-well plates in growth medium overnight. After washing with PBS, cells were switched to serum-free UltraCulture medium. Conditioned medium was collected after incubation with or without TGF-ß1 (10 ng/ml), centrifuged to remove floating cells, and stored frozen at -20°C. Cell extracts were centrifuged at 15,000 rpm for 15 min, and the protein concentration in each supernatant was determined by colorimetric Bradford protein assay. VEGF and TGF-ß1 concentrations were assessed by ELISA (Quantikine; R&D Systems), following the instructions supplied by the manufacturer and normalized to protein content.
PCR for VEGF Splice Forms.
Total RNA from TFK-1 and EGI-1 cells was isolated using the RNAzol B reagent following the instructions supplied by the manufacturer. Amplification of reverse transcription products was performed as described previously (22
, 24)
. Used primer sequences recognize all known VEGF splice variants and were generated according to published sequences.
Quantification of VEGF by QC RT-PCR.
Total RNA extraction from tumor cells and reverse transcription of 2 µg of RNA were performed as described above. Competitors for VEGF165 and ß-actin were constructed using a "semi-nested" PCR technique as described previously (22)
. Wild-type PCR products were reamplified using combined (so-called "mimic") sense primers, which bind 80 to 120 bp downstream of the original sense primer but contain the original sense primer sequence at their 5'-ends. Only competitor constructs showing equal wild-type:competitor ratios before and after reamplification were used further for competitive PCR. The following amplification and quantification procedures were performed as described previously (22)
.
DNA Constructs and Reporter Plasmids.
The series of progressive hVEGF 5' deletion constructs, which are all based on the promoterless luciferase reporter gene vector pAH1409, have been reported previously (25)
. To study the characteristics of potential hVEGF-regulatory elements in a heterologous promoter system, an oligonucleotide comprising the region hVEGF -88 to -50 bp was synthesized and subcloned into the restriction sites HindIII (5') and XhoI (3') of the vector pT81-Luc (26)
, which contains the enhancerless herpes simplex TK viral promoter. All pT81 constructs were checked by restriction digest for the correct length of promoter segments and then confirmed by sequencing. Sequential deletion of the GC boxes from 5'- and 3'-end was performed and has been described in detail (26)
.
Transient Transfections.
TFK-1 and EGI-1 cells were transfected using the Effectene Transfection Reagent Kit (Qiagen). To correct for transfection efficiency, cotransfection with 100 ng/ml Renilla luciferase expression construct pRL-TK (Promega, Mannheim, Germany) was performed. After transfection, cells were deprived of serum and maintained in UltraCulture (Biowhittaker Inc., Walkersville, MD). Firefly and Renilla luciferase activities were detected in a monolight luminometer (EG Berthold, Bad Wildbach, Germany) using a dual luciferase reporter assay (Promega) according to the manufacturers instructions. Incubations were performed in triplicates, and the results were normalized for transfection efficiency. Values were expressed as the fold increase in luciferase activity compared with untreated controls.
EMSA.
Nuclear extracts from TFK-1 cells were prepared by using a nonionic detergent method. For the detection of DNA binding activity, nuclear protein extracts were incubated with radiolabeled double-stranded oligonucleotides comprising the -88 to -50 region of the hVEGF promoter. The following oligonucleotides were used in 100- or 200-fold excess as unlabeled competitors (5'
3'): (a) Sp1 consensus, attcgatcggggcggggcgagc; (b) Sp1 mutant, attcgatcggttcggggcgagc; (c) AP2 consensus, gatcgaactgaccgcccgcggcccgt; (d) AP2 mutant, gatcgaactgaccgcttgcggcccgt; (e) Egr-1 consensus, ggatccagcgggggcgagcgggggcga; and (f) Egr-1 mutant, ggatccagctagggcgagcgggggcga.
DNA binding reactions were performed as described previously (26)
. For competition experiments, nuclear extracts were incubated with a 100x molar excess of double-stranded competitor oligonucleotide. For supershift experiments, nuclear extracts were incubated with 1 µg of anti-Sp1, anti-Sp3, anti-AP2, or anti-Egr-1 Abs for 10 min at room temperature before the addition of radiolabeled probes. DNA-protein complexes were electrophoresed on a 6% nondenaturing polyacrylamide gel, dried, and exposed to Kodak BioMax MR films (Amersham, Braunschweig, Germany) at -80°C.
Statistical Analysis.
Statistical differences were evaluated by one-way ANOVA using GraphPad statistical software (GraphPad Software Inc., San Diego, CA). Differences were considered statistically significant at P < 0.05. Unless otherwise stated, all data are expressed as mean ± SE.
 |
RESULTS
|
|---|
Expression of VEGF and Its Receptors in Human CCC.
We initially examined the expression of VEGF and its receptors in 19 surgically resected samples of human CCC. Using a monoclonal Ab against the endothelial cell-specific antigen CD31, we detected a significant amount of vascular endothelial cells interdispersed between ductal tumor cells, suggesting a considerable degree of tumor vascularization (Fig. 1A)
. The MVD for the 19 tumor specimens was calculated at 126.5 ± 45.1 according to the procedure of Weidner et al. (23)
. Immunostaining with a polyclonal Ab specific for hVEGF revealed a strong expression of VEGF in epithelial tumor cells in 19 of 19 tumor specimens investigated (Fig. 1B)
. To further corroborate the cellular source of VEGF production, we performed in situ hybridization using a 35S-labeled cRNA probe specific for hVEGF. In analogy to the results obtained by immunohistochemistry, VEGF was strongly expressed in epithelial tumor cells of all 19 tumor specimens, whereas the surrounding mesenchymal and endothelial cells were consistently negative (Fig. 1, E and F)
. Although VEGF mRNA was consistently expressed over tumor cells throughout the tumor, a selective enhancement of the hybridization signal intensity was observed in the areas directly adjacent to necrotic foci (Fig. 1E)
. To confirm the specificity of the VEGF mRNA expression pattern, sense cRNA was analyzed in parallel, which revealed no specific hybridization pattern different from background (Fig. 1F)
.

View larger version (133K):
[in this window]
[in a new window]
|
Fig. 1. Expression of VEGF and its receptors in human CCC. A, immunostaining with endothelial cell-specific anti-CD31 Ab showed a significant amount of endothelial cells surrounding epithelial tumor cells in human CCC. Note the resected liver tissue on the top of the tumor. Paraffin-embedded tissue sections were stained with polyclonal VEGF Ab (B) and polyclonal Abs for VEGFR-1 (C) and VEGFR-2 (D) or hybridized with 35S-labeled antisense cRNA for VEGF (E), VEGFR-1 (G), and VEGFR-2 (H). Ductal tumor cells showed strong VEGF immunoreactivity (B) and a strong VEGF mRNA hybridization signal (E) (arrow 1 indicates a strong perinecrotic hybridization signal, and arrow 2 indicates typical central tumor necrosis). Hybridization with sense cRNA did not show any significant hybridization signal (F; arrow indicates tumor cells without any specific hybridization signal). VEGFR-1 (C) and VEGFR-2 (D) were expressed by endothelial cells surrounding ductal tumor cells (arrows), as shown by immunohistochemistry (C and D) and in situ hybridization (G and H). Arrows indicate blood vessels as evidenced by intraluminal erythrocytes. Sense hybridization for VEGFRs did not show a significant hybridization signal (data not shown). Original magnifications: A, x10; BH, x40.
|
|
Analysis of the VEGFR expression pattern revealed immunoreactivity for VEGFR-1 in 15 of 19 samples, whereas VEGFR-2 was expressed in 10 of 19 tumor specimens. In 10 samples, we detected both VEGFRs, and in 4 samples, neither VEGFR was detected. Immunostaining with monospecific Abs directed against VEGFR-1 (Fig. 1C)
and VEGFR-2 (Fig. 1D)
showed that both receptors were expressed exclusively in endothelial cells adjacent to tumor cells. In situ hybridization demonstrated tumor endothelial cells as the only cellular source of both VEGFR mRNA transcripts (Fig. 1, G and H)
. Again, no significant hybridization signal was observed using sense cRNA (data not shown).
Expression of TGF-ß1 and Its Receptors in Human CCC.
To investigate the potential interaction of VEGF with TGF-ß1, we next had to characterize the expression pattern for TGF-ß1 and its receptors in CCC. Immunostaining with a polyclonal Ab directed against TGF-ß1 revealed that all CCCs examined consistently expressed TGF-ß1 (19 of 19 specimens). Two distinct expression patterns were observed. In 15 of 19 tumor specimens, a strong TGF-ß1 signal was detected over mesenchymal cells surrounding tumor cells, but only weak or negligible immunostaining was seen over tumor cells (Fig. 2A)
. In contrast, 4 of 19 tissue samples showed strong TGF-ß1 expression over tumor cells, whereas surrounding mesenchymal cells demonstrated only weak immunoreactivity (Fig. 2B)
. Immunostaining with polyclonal Abs directed against TßR-I and TßR-II consistently revealed a strong signal for both receptors over transformed epithelial tumor cells in 19 of 19 tumor samples (Fig. 2, C and D)
. These data demonstrate that the majority of human CCCs coexpress VEGF and TGF-ß1 as well as their respective receptors, suggesting a possible functional interdependence between these two cytokines.

View larger version (137K):
[in this window]
[in a new window]
|
Fig. 2. Expression of TGF-ß1 and its receptors in human CCC. Immunostaining with a polyclonal anti-TGF-ß1 Ab revealed two distinct expression patterns: A, immunoreactivity for TGF-ß1 signal was strong over mesenchymal cells surrounding ductal tumor cells but only weak over transformed cells; and B, strong TGFß-1 immunostaining over tumor cells; the surrounding mesenchymal cells do not show significant immunoreactivity. Immunostaining with polyclonal Abs for TßR-I (C) and TßR-II (D) consistently demonstrated a strong signal for both receptors over transformed ductal epithelial cells. Original magnifications: A, x40; BD, x20.
|
|
TGF-ß1 Stimulates VEGF in Human CCC Cell Lines.
To further analyze this hypothetical functional relation, we established a representative in vitro system. Two well-established and characterized human CCC cell lines (TFK-1 and EGI-1) were analyzed for their expression of VEGF and TGF-ß1 to confirm the expression patterns observed in vivo. RT-PCR analysis using oligonucleotide primers designed to amplify all five known splicing variants of VEGF showed that various VEGF mRNA splice forms were expressed in both CCC cell lines. Three bands of 403, 535, and 607 bp, corresponding to VEGF isoforms VEGF121, VEGF165, and VEGF189, respectively, were amplified (Fig. 3A)
. In contrast, no VEGF145 and VEGF206 mRNA transcripts could be detected. Using ELISAs specific for hVEGF and TGF-ß1, we detected both cytokines in supernatants and cell lysates of the two cell lines (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3. Paracrine and autocrine stimulation of VEGF by TGF-ß1. A, detection of VEGF mRNA in human CCC cell lines by RT-PCR. ß-Actin was amplified as a positive control, and a parallel PCR without prior reverse transcription (RT-) was performed to exclude genomic contamination. B, TFK-1 cells were incubated with 10 ng/ml TGF-ß1 for the indicated time points. Supernatants were collected, and VEGF was determined by ELISA and normalized to mg of protein. Shown are the mean ± SE of four separate experiments, each performed in triplicates (*, P < 0.001). C, serum-starved TFK-1 cells were incubated with 50 ng/ml neutralizing TGF-ß1 Ab or an irrelevant isotype-matched control Ab (IgG) for 96 h, and VEGF concentration in supernatants was determined by ELISA. The results shown represent the mean ± SE of four separate experiments, each conducted in triplicates (*, P < 0.01).
|
|
Coexpression of VEGF and TGF-ß1 in vivo and in vitro raises the possibility of autocrine/paracrine VEGF stimulation by TGF-ß1. To further investigate this hypothesis, we initially analyzed TFK-1 cells as a representative in vitro model. We observed a time-dependent increase of VEGF concentrations in response to TGF-ß1 (Fig. 3B)
. A significant stimulation of VEGF by TGF-ß1 was observed as early as 48 h after incubation (2.3-fold increase) and persisted throughout the observation period of 96 h. Similar results were obtained in EGI-1 cells, although the TGF-ß1 concentrations required for maximal induction of VEGF were higher compared with TFK-1 cells (100 ng/ml). Based on TGF-ß1 expression in tumor cells in vivo and in vitro, we considered the possibility that TGF-ß1 might also stimulate VEGF expression in an autocrine manner. We therefore investigated the effects of a neutralizing TGF-ß1 Ab on VEGF protein concentration in cell culture supernatants. Compared with an isotype-matched control Ab, addition of a neutralizing TGF-ß Ab resulted in a significant inhibition of VEGF concentrations in TFK-1 supernatants to 61 ± 9% of control (n = 4; P < 0.05; Fig. 3C
). This observation was further confirmed in two independent cell lines (HepG2 and HuH7) derived from human liver (data not shown). This implies that exogenous as well as autocrine secreted TGF-ß1 is able to stimulate VEGF expression.
Molecular Mechanism of TGF-ß1-induced VEGF Expression in TFK-1 Cells.
To elucidate whether increased VEGF production in response to TGF-ß1 is based on an increase in VEGF mRNA concentrations, we performed QC RT-PCR. VEGF mRNA concentrations increased upon TGF-ß1 treatment in a time-dependent manner. Induction of VEGF mRNA concentrations was observed as early as 12 h, and a maximal stimulation was observed after 48 h of TGF-ß1 incubation (5.6 ± 1.9-fold; n = 3; P < 0.05; Fig. 4A
). We next investigated the effect of TGF-ß1 on VEGF gene transcription. A hVEGF promoter-reporter construct ranging from its 5'-end -2018 to +50 was expressed in TFK-1 and EGI-1 cells using transient transfection assays. Treatment with TGF-ß1 resulted in increased VEGF promoter activity in both cell lines, although the effects in EGI-1 cells did not reach statistical significance (Fig. 4B)
. Because TGF-ß1 was more potent in TFK-1 cells, we further determined the dose dependency of TGF-ß1 on VEGF promoter activity using this cell line. We observed a dose-dependent increase of VEGF promoter activity in reponse to TGF-ß1, with significant stimulation observed at 1 ng/ml, and maximal stimulation occurring at 100 ng/ml (Fig. 4C)
. For additional experiments, we used a concentration of 10 ng/ml TGF-ß1.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4. Effects of TGF-ß1 on VEGF gene expression. A, total RNA from TFK-1 cells incubated with 10 ng/ml TGF-ß1 for the indicated time periods was extracted and submitted to QC RT-PCR. Quantitative analysis of VEGF165 mRNA expression was calculated based on the molar ratio of VEGF165:ß-actin copies. Values are expressed as the fold induction and represent the mean ± SE of three independent experiments (*, P < 0.05). B, TFK-1 and EGI-1 cells were transiently transfected with 2 µg of a hVEGF promoter luciferase construct and 100 ng/ml Renilla luciferase expression construct and then incubated with or without 10 ng/ml TGF-ß1 under serum-free conditions. After 24 h, cells were harvested and analyzed for luciferase activity. C, dose-dependent regulation of hVEGF promoter activity in TFK-1 cells stimulated with the indicated concentrations of TGF-ß1 for 24 h. Data shown represent the mean ± SE of five separate experiments, each performed in triplicate, and are expressed as the fold increase over untreated control (B) or as a percentage of maximal stimulation (C; *, P < 0.05 versus untreated controls).
|
|
TGF-ß1-responsive Elements in the hVEGF Promoter.
To define the VEGF promoter regions that confer TGF-ß1 responsiveness, a series of 5' deletion constructs was tested in transient transfection assays. The results shown in Fig. 5A
demonstrate that 5' deletion analysis down to -85/+50 sustained basal VEGF promoter activity and conferred TGF-ß1 responsiveness, although to a slightly variable degree. In contrast, removal of the VEGF promoter region -85/-53 decreased basal VEGF promoter activity by about 95% and completely abolished TGF-ß1 responsiveness. To further confirm that the hVEGF -85/-53 promoter region confers TGF-ß1 responsiveness, a heterologous promoter system was used. This construct contains an enhancerless TK promoter in front of the luciferase reporter gene (pTK-Luc). Cells transfected with empty pTK-Luc showed very low promoter activity and did not respond to TGF-ß1 treatment. Subcloning of the hVEGF -88/-50 sequence into this construct (pTK-Luc/hVEGF-88/-50) resulted in strong enhancement of basal promoter activity, suggesting that the hVEGF -88/-50 sequence functions as a basal enhancer of the VEGF gene in CCC cells. Furthermore, presence of the hVEGF-88/-50 element conferred TGF-ß1 sensitivity to the pTK-Luc construct, resulting in a 2-fold increase in reporter gene activity (Fig. 5B)
.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5. Identification of TGF-ß1-responsive sequences in the human VEGF promoter. A, transient transfection assays using a set of 5' deletion constructs. TFK-1 cells were transiently transfected with 2 µg of each construct. A Renilla luciferase reporter construct (100 ng) was cotransfected to correct for variability in transfection efficiencies. After transfection, cells were serum-starved for 24 h and then stimulated with 10 ng/ml TGF-ß1 for an additional 24 h or left untreated, and luciferase activity was determined. Shown are the mean ± SE of five independent experiments. B, TFK-1 cells were transiently transfected with 2 µg of a construct into which the hVEGF -88 to -50 promoter element was subcloned adjacent to an enhancerless TK promoter in front of the luciferase gene (pTK-Luc/hVEGF-88/-50). After transfection, cells were stimulated with 10 ng/ml TGF-ß1 for 24 h. Luciferase activity represents the mean ± SE of three separate experiments each performed in triplicates (*, P < 0.001).
|
|
Sp1 Binding Sites within the VEGF Promoter Are Essential for TGF-ß1 Responsiveness.
The -85/-50 region of the hVEGF gene promoter contains three potential consensus binding sites for the transcription factor Sp1, two potential consensus binding sites for transcription factor Egr-1, and one potential consensus binding site for AP2, which partially overlap (Fig. 6A)
. To elucidate which of these transcription factors participates in TGF-ß1 responsiveness, a mutational analysis of the potential binding sites was performed. hVEGF-88/+50/Sp1-mut and hVEGF-85/+50/Egr-mut comprised two nucleotide mutations known to abolish Sp1 binding or Egr-1 binding, respectively (25)
. Transactivation assays in TFK-1 cells revealed that mutation of the potential Egr-1 binding sites did not abolish TGF-ß1 responsiveness (Fig. 6B)
. In contrast, inactivating mutations of all potential Sp1 consensus binding sites resulted in a substantial decrease of basal VEGF promoter activity and completely abolished TGF-ß1 responsiveness (Fig. 6B)
.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6. Identification of transcription factor binding sites required for TGF-ß1-induced transactivation of the VEGF promoter. A, illustration of potential binding sites for the transcription factors Sp1, Egr-1, and AP2 within the human VEGF promoter sequence -88 to -50. B, in the VEGF luciferase construct -88 to -50, mutations were introduced into the three potential Sp1 sites (hVEGF-88/-50:Sp1-mut) and into both potential Egr-1 sites (hVEGF-88/-50:Egr-1 mut), respectively. Luciferase activities were then determined in TFK-1 cells after transfection of 2 µg of the indicated constructs with or without TGFß-1 (10 ng/ml) treatment. C, deletion analysis of the potential Sp1 binding sites. Deletion constructs of the human VEGF -88 to -50 promoter sequence were generated that result in the indicated loss of the three putative Sp1 binding sites. Two µg of each construct were transiently transfected into TFK-1 cells and stimulated with TGF-ß1 (10 ng/ml) for 24 h before luciferase activity was determined. Data shown represent the mean ± SE of five independent experiments, each performed in triplicates (*, P < 0.05).
|
|
To determine whether all three potential Sp1 binding sites are required for hVEGF transactivation, different Sp1 binding site deletions were constructed: hVEGF -76/-50; hVEGF -88/-59; and hVEGF -63/-50 (26)
. Fig. 6C
shows that all three constructs displayed constitutive basal promoter activity, although to a lesser extent than the -88/-50 construct. TGF-ß1 responsiveness decreased somewhat upon deletion of Sp1 binding site I but showed a significant loss when two Sp1 binding sites (I and II) or only the Sp1 binding site next to the -50 end (III) was deleted. These data indicate that Sp1 binding site I is dispensable, whereas Sp1 binding sites II and III are indispensable for TGF-ß1 responsiveness.
Sp1 and Sp3 Transcription Factors Bind to the -85 to -50 region of the VEGF Promoter.
We next investigated which members of the Sp transcription factor family are able to bind to the potential consensus binding sites. EMSAs using a 32P-labeled double-stranded oligonucleotide that covers the -88 to -50 region of the hVEGF promoter and nuclear extracts from TFK-1 cells demonstrated the formation of two prominent DNA-protein complexes (Fig. 7A
, Lane 1). The two complexes could be completely competed away by addition of an excess of unlabeled VEGF -88/-50 oligonucleotide or consensus Sp1 binding oligonucleotide, whereas using an oligonucleotide containing a mutated Sp1 binding site did not affect complex formation (Fig. 7A
, Lanes 24). In contrast, DNA-protein complex formation could be reduced but not completely eliminated using a 100-fold molar excess of unlabeled AP2 and Egr-1 oligonucleotides and was not affected by unlabeled, mutated AP2 or Egr-1 oligonucleotides (Fig. 7A
, Lanes 58). To confirm that any of the two nucleo-protein complexes represent the binding of Sp1, AP2, or Egr-1 transcription factors, gel shift analysis was performed using specific anti-Sp1, anti-AP2, and anti-Egr1 Abs. Furthermore, anti-Sp3 Abs were used, based on the fact that Sp1 binding sites also recognize Sp3 (27)
. Addition of Sp1 Ab resulted in a supershift of a major component of complex I, and a Sp3 Ab completely supershifted complex II (Fig. 7B
, Lanes 2 and 3). Simultaneous addition of Sp1 and Sp3 Abs resulted in a complete supershift of complex II and a major supershift of complex I. Addition of AP2 and Egr-1 Abs, however, did not result in altered nucleo-protein complex (Fig. 7B
, Lanes 5 and 6), although their ability to supershift has independently been confirmed (data not shown). These results suggest that complex I represents predominant binding of Sp1 (and to a lesser extent, Sp3), whereas complex II represents binding of Sp3 to the -88 to -50 segment of the hVEGF promoter.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7. Sp1 and Sp3 transcription factors bind to the -88 to -50 region of the human VEGF promoter in TFK-1 cells. Crude nuclear protein extracts were prepared from unstimulated (A and B) or TGF-ß1-stimulated TFK-1 cells (C) and used in EMSA studies. A, DNA-protein complexes are indicated by arrows. The specificity of the DNA-protein interaction was confirmed by addition of a 100x molar excess of unlabeled oligonucleotides. B, the indicated Abs against Sp1, Sp3, AP2, and Egr-1 were added to nuclear extracts of TFK-1 cells, and the labeled hVEGF olignucleotide -88/-50. C, TFK-1 cells were stimulated with 10 ng/ml TGFß-1 before extraction of nuclear proteins and EMSA using a double-stranded 32P-labeled hVEGF -88/-50 oligonucleotide. Shown are representative audioradiographs of two to three independent experiments yielding very similar results. D, Gal4/Luc was transiently cotransfected with expression constructs for either Gal4/Sp1 or Gal4/Sp3 into TFK-1 cells. Parallel cultures transfected exclusively with 2 µg of Gal4-Luc were included as negative controls. Cells were incubated with 10 ng/ml TGF-ß1 or left untreated, harvested after 24 h, and assayed for luciferase activity. Results are given as mean ± SE and represent four independent experiments, each conducted in triplicates (*, P < 0.01).
|
|
To evaluate whether treatment with TGF-ß1 results in increased DNA binding of transcription factors, we performed EMSAs after various time points of TGF-ß1 incubation. However, no significant changes in the formation of DNA-protein complexes on the -88/-50 region of the hVEGF gene promoter were observed for up to 2 h of incubation (Fig. 7C)
.
TGF-ß1 Stimulates Sp1-dependent Transactivation of hVEGF Promoter in TFK-1 Cells.
Because TGF-ß1-stimulated VEGF transcription was not accompanied by a change in the composition of Sp1 and Sp3 DNA-protein complexes, we next investigated the effect of TGF-ß1 on Sp1- or Sp3-dependent transactivation. We used a system in which either Sp1 or Sp3 was fused to the DNA-binding domain of the yeast transcription factor Gal4. After cotransfection of Sp1/Gal4 or Sp3/Gal4 with a Gal4/luciferase construct, the ability of the Sp-Gal4 fusion proteins to activate Gal4 DNA binding can be assessed. Cotransfection of Sp1/Gal4 with Gal4/luciferase resulted in a significant 2.6-fold increase of Gal4/luciferase promoter activity in response to TGF-ß1 treatment (Fig. 7D)
. Cotransfection of Sp3/Gal4 resulted in basal luciferase activity comparable with cotransfection with Sp1/Gal4. However, TGF-ß1 treatment had no significant effect on Sp3-mediated transactivation (Fig. 7D)
. These results suggest that the transactivation domain of Sp1 mediates TGF-ß1-induced transcriptional activation of the hVEGF promoter.
 |
DISCUSSION
|
|---|
The factors involved and responsible for the "angiogenic switch" during malignant transformation of human cholangiocytes are poorly understood.
Thus far, determination of MVD has not been evaluated in CCC. Using an endothelial cell-specific Ab, we determined the mean MVD as 126 ± 45 vessels/0.74 mm2 (n = 19). This is well within the range of MVD observed in tumors commonly considered to be well vascularized, such as node-positive breast carcinoma (101 ± 49) or prostate carcinoma with metastatic disease (77 ± 32; Ref. 23
), indicating a considerable degree of tumor-associated angiogenesis in human CCC.
In view of the significant vascularization of CCCs, the analysis of VEGF and its receptors appears of particular relevance (28)
. Two previous immunohistochemical studies investigated VEGF expression in human CCC and yielded conflicting results (29
, 30)
. We were able to demonstrate that all 19 human CCC samples investigated expressed VEGF protein. Immunohistochemistry detects intracellular as well as receptor-bound VEGF, thereby precluding unambiguous determination of the cellular source of VEGF. We therefore performed in situ hybridization and demonstrated the malignant cholangiocyte as the exclusive cellular source of VEGF expression in vivo. Furthermore, we observed pronounced VEGF mRNA expression in areas surrounding necrotic foci. This observation has also been described in other malignancies (22
, 31
, 32)
. Enhanced VEGF expression in the areas adjacent to low oxygen tension suggests a possible role for local hypoxia as a stimulus for VEGF up-regulation in CCC (33)
.
To the best of our knowledge, the expression of VEGFRs in CCC has not been investigated. By means of immunohistochemistry and in situ hybridization, we observed expression of VEGFR-1 in 15 of 19 tumor samples and expression of VEGFR-2 in 10 of 19 tumor samples. Both VEGFR mRNA and protein were exclusively expressed by endothelial cells. VEGFRs are rarely expressed in quiescent endothelial cells, whereas enhanced expression of both receptors is frequently observed in the context of tumor neovascularization (10
, 11
, 31
, 32
, 34)
. Taken together, expression of both VEGFRs indicates that not only VEGF but also its receptors are up-regulated upon malignant transformation in CCC.
A variety of stimuli have been described as activators of VEGF gene expression in other cell systems and also appear conceivable to be responsible for the induction of VEGF (and angiogenesis) in human CCC: (a) tumor hypoxia, as evidenced by enhanced perinecrotic VEGF mRNA expression in our study; (b) genetic alterations such as K-ras-activating mutations and expression of mutated p53, which have been reported as common genetic alterations in CCC (35
, 36)
and also have been demonstrated to up-regulate VEGF in transformed cell lines (37
, 38)
; and (c) finally, various cytokines such as epidermal growth factor, platelet-derived growth factor, interleukin 6, and TGF-ß1 as well as oxidative stress are also known to induce VEGF expression (26
, 39 , 40)
. Among those, TGF-ß1 plays a prominent role in the pathogenesis of liver disease (41, 42, 43)
. Recently, Yokomuro et al. (44)
demonstrated that TGF-ß1 lost its antiproliferative and proapoptotic effect on human CCC cells, suggesting a possible role for TGF-ß1 in propagating the malignant phenotype of CCC. For other gastrointestinal malignancies, such as pancreatic carcinoma (45)
and colon cancers (46)
, it has been well established that mutations disabling a component of the TGF-ß1 signaling pathway promote the malignant phenotype of a given tissue. Induction of VEGF represents such a potential mechanism by which TGF-ß1 might act as a promoter of tumorigenesis (47, 48, 49, 50)
. We therefore focused our studies on the functional relation between TGF-ß1 and VEGF in human CCC.
Previous studies identified mesenchymal cells as the main cellular source of TGF-ß1 in the liver (51)
. We detected TGF-ß1 predominantly in mesenchymal cells (15 of 19 samples), but we also observed expression in tumor cells in a smaller percentage of samples (4 of 19 samples), suggesting that TGF-ß1 expression is controlled in a cell type-specific manner in a given CCC. This observation reconciles previous work with one report demonstrating TGF-ß1 immunoreactivity in mesenchymal cells in 25 of 30 CCCs (52)
, whereas another study demonstrated TGF-ß1 immunoreactivity in CCC mainly over tumor cells (53)
. The expression of the TßRs in CCC has not been investigated. We demonstrated strong immunoreactivity for both receptors over tumor cells in all tumor specimens, whereas only scarce immunostaining was seen in surrounding mesenchymal cells, indicating that tumor cells can act as a target for TGF-ß1 in human CCC. In extension to previously published reports, we now provide evidence for coexpression of VEGF, TGF-ß1, and their respective receptors in human CCC.
To further explore the postulated TGF-ß1-VEGF interaction, we established an in vitro system of two human CCC cell lines, TFK-1 and EGI-1. Using RT-PCR and VEGF- and TGF-ß1-specific ELISAs, we confirmed coexpression of VEGF and TGF-ß1 in both tumor cell lines. In addition, TGF-ß1 treatment resulted in a significant time-dependent increase of VEGF protein levels. This observation is consistent with previous data showing TGF-ß1-induced VEGF protein concentration in human osteoblasts (49)
and in human keratinocytes (50)
. Furthermore, we demonstrated that antagonizing endogenous TGF-ß1 using a neutralizing TGF-ß1 Ab results in inhibition of VEGF expression, which represents the first report of an autocrine and paracrine regulatory pathway for TGF-ß1-regulated VEGF expression.
Although the stimulatory effect of TGF-ß1 on VEGF expression has been described in a variety of in vitro systems, the molecular mechanisms responsible for this induction remain unsolved (40
, 47, 48, 49, 50
, 54)
. We performed QC RT-PCR analysis and demonstrated that TGF-ß1 stimulated VEGF expression mainly at a pretranslational level.
Using a hVEGF promoter-reporter construct, we found that TGF-ß1 treatment results in a dose-dependent activation of VEGF promoter constructs in human CCC cell lines. Further 5' deletion analysis identified the VEGF promoter region -85 to -53 as responsible for basal VEGF promoter activity as well as TGF-ß1 responsiveness. Interestingly, this GC-rich region of the VEGF promoter has been demonstrated to represent the minimal region required for basal as well as regulated VEGF promoter activity in various cell systems, such as platelet-derived growth factor-mediated up-regulation in NIH3T3 cells (25)
, p42/p44 mitogen-activated protein kinase-mediated up-regulation in fibroblasts (55)
, interleukin 1-mediated up-regulation in cardiac myocytes (56)
, p73-mediated down-regulation in leukemic cells (57)
, and oxidative stress-mediated induction in gastric cancer cells (26)
.
Mutational analysis of the putative transcription factor binding sites demonstrated that the Sp1/Sp3 binding sites but not the Egr-1 binding sites are required for TGF-ß1-mediated transactivation of the hVEGF promoter. Sequential deletion analysis of the three Sp1/Sp3 binding sites revealed that Sp1 binding site I was dispensable, whereas Sp1 binding sites II and III were indispensable for TGF-ß1-mediated transactivation. However, all three binding sites were required for maximal TGF-ß1 responsiveness, a situation similar to that observed for oxidative stress in gastric cancer cells (26)
.
It has recently become clear that, aside from the Smad binding elements, canonical Sp1 sites can function as TGF-ß1-responsive elements for gene activation (58)
. Although not completely understood, this is due to functional cooperation of Smad proteins with Sp1, which involves the physical interaction of these two transcription factor families (59, 60, 61, 62)
and occurs independent from direct association of Smad proteins with DNA (62)
. The molecular mechanisms underlying this functional cooperativity between Smads and Sp1 have not yet been fully elucidated, although several potential modes of action have been proposed (59, 60, 61, 62)
.
We currently do not know which of these proposed mechanisms is operative in TGF-ß-mediated induction of VEGF gene transcription. However, our EMSA analysis revealed no change in DNA binding of Sp1 or Sp3 upon TGF-ß1 treatment, suggesting that a mechanism other than altering the DNA binding affinity of Sp transcription factors is responsible for TGF-ß-mediated transactivation. We therefore analyzed the transactivating capability using fusion proteins of Sp1 and Sp3 with the DNA binding domain of the yeast transcription factor Gal4. We observed that expression of fusion proteins between Gal4 DNA binding domain and Sp1 but not Sp3 renders the Gal4 reporter construct TGF-ß1 responsive. Thus, Sp1 but not Sp3 can be activated by TGF-ß1 treatment to increase transcription. Therefore, in addition to "classical" TGF-ß target genes (60, 61, 62)
, VEGF represents the first proangiogenic factor that is transcriptionally regulated by TGF-ß1 through the Sp1 family of transcription factors.
In summary, we provided evidence for coexpression of VEGF and TGF-ß1 as well as their respective receptors upon malignant transformation in human CCC. Furthermore, TGF-ß1 can stimulate VEGF gene transcription in malignant cholangiocytes in a paracrine and/or autocrine manner through an Sp1-dependent mechanism. This regulatory pathway might contribute to the "angiogenic switch" and the malignant phenotype of human CCC.
 |
ACKNOWLEDGMENTS
|
|---|
Gal4-Sp1 and Gal4-Sp3 constructs were kindly provided by Guntram Suske. hVEGF 5' deletion constructs were kindly provided by Georg Finkenzeller.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 S. R. was supported by grants from Deutsche Forschungsgemeinschaft, Deutsche Krebshilfe, Berliner Krebshilfe, Sander Stiftung, Else Kröner Fresenius Stiftung, and Sonnenfeld Stiftung. M. H. was supported by Deutsche Forschungsgemeinschaft and the Bundesministerium für Bildung und Forschung (NBLIII). 
2 To whom requests for reprints should be addressed, at Department of Hepatology, Gastroenterology, Endocrinology and Metabolism, Charité, Campus Virchow-Klinikum, Humboldt-University, Augustenburger Platz 1, 13353 Berlin, Germany. Phone: 49-30-450-553733; Fax: 49-30-450-553940; E-mail: stefan.rosewicz{at}charite.de 
3 The abbreviations used are: CCC, cholangiocellular carcinoma; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; TGF, transforming growth factor; EMSA, electrophoretic mobility shift assay, MVD, microvessel density; QC, quantitative competitive; RT-PCR, reverse transcription-PCR; Ab, antibody; TßR, TGF-ß1 receptor; hVEGF, human VEGF; TK, thymidine kinase; EGR, early growth response protein; AP-2, activator protein 2. 
Received 5/20/02.
Accepted 12/27/02.
 |
REFERENCES
|
|---|
- Neuhaus P., Jonas S., Bechstein W. O., Lohmann R., Radke C., Kling N., Wex C., Lobeck H., Hintze R. Extended resections for hilar cholangiocarcinoma. Ann. Surg., 230: 808-818, 1999.[Medline]
- Farley D. R., Weaver A. L., Nagorney D. M. "Natural history" of unresected cholangiocarcinoma: patient outcome after noncurative intervention. Mayo Clin. Proc., 70: 425-429, 1995.[Medline]
- Bismuth H., Nakache R., Diamond T. Management strategies in resection for hilar cholangiocarcinoma. Ann. Surg., 215: 31-38, 1992.[Medline]
- Kerbel R. S. Tumor angiogenesis: past, present and the near future. Carcinogenesis (Lond.), 21: 505-515, 2000.[Abstract/Free Full Text]
- Carmeliet P., Jain R. K. Angiogenesis in cancer and other diseases. Nature (Lond.), 407: 249-257, 2000.[Medline]
- Hanahan D., Weinberg R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.[Medline]
- Folkman J. Seminars in Medicine of the Beth Israel Hospital, Boston. Clinical applications of research on angiogenesis. N. Engl. J. Med., 333: 1757-1763, 1995.[Free Full Text]
- Hanahan D., Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 86: 353-364, 1996.[Medline]
- Ferrara N. Molecular and biological properties of vascular endothelial growth factor. J. Mol. Med., 77: 527-543, 1999.[Medline]
- Veikkola T., Alitalo K. VEGFs, receptors and angiogenesis. Semin. Cancer Biol., 9: 211-220, 1999.[Medline]
- Neufeld G., Cohen T., Gengrinovitch S., Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. FASEB J., 13: 9-22, 1999.[Abstract/Free Full Text]
- Keck P. J., Hauser S. D., Krivi G., Sanzo K., Warren T., Feder J., Connolly D. T. Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science (Wash. DC), 246: 1309-1312, 1989.[Abstract/Free Full Text]
- Senger D. R., Galli S. J., Dvorak A. M., Perruzzi C. A., Harvey V. S., Dvorak H. F. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science (Wash. DC), 219: 983-985, 1983.[Abstract/Free Full Text]
- Houck K. A., Ferrara N., Winer J., Cachianes G., Li B., Leung D. W. The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol. Endocrinol., 5: 1806-1814, 1991.[Abstract]
- De Vries C., Escobedo J. A., Ueno H., Houck K., Ferrara N., Williams L. T. The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science (Wash. DC), 255: 989-991, 1992.[Abstract/Free Full Text]
- Terman B. I., Dougher-Vermazen M., Carrion M. E., Dimitrov D., Armellino D. C., Gospodarowicz D., Bohlen P. Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem. Biophys. Res. Commun., 187: 1579-1586, 1992.[Medline]
- Petrova T. V., Makinen T., Alitalo K. Signaling via vascular endothelial growth factor receptors. Exp. Cell Res., 253: 117-130, 1999.[Medline]
- Pepper M. S. Transforming growth factor-ß: vasculogenesis, angiogenesis, and vessel wall integrity. Cytokine Growth Factor Rev., 8: 21-43, 1997.[Medline]
- Massague J., Blain S. W., Lo R. S. TGF-ß signaling in growth control, cancer, and heritable disorders. Cell, 103: 295-309, 2000.[Medline]
- Blobe G. C., Schiemann W. P., Lodish H. F. Role of transforming growth factor ß in human disease. N. Engl. J. Med., 342: 1350-1358, 2000.[Free Full Text]
- Massague J., Wotton D. Transcriptional control by the TGF-ß/Smad signaling system. EMBO J., 19: 1745-1754, 2000.[Medline]
- von Marschall Z., Cramer T., Hocker M., Finkenzeller G., Wiedenmann B., Rosewicz S. Dual mechanism of vascular endothelial growth factor upregulation by hypoxia in human hepatocellular carcinoma. Gut, 48: 87-96, 2001.[Abstract/Free Full Text]
- Weidner N., Semple J. P., Welch W. R., Folkman J. Tumor angiogenesis and metastasis: correlation in invasive breast carcinoma. N. Engl. J. Med., 324: 1-8, 1991.[Abstract]
- von Marschall Z., Riecken E. O., Rosewicz S. Stromelysin 3 is overexpressed in human pancreatic carcinoma and regulated by retinoic acid in pancreatic carcinoma cell lines. Gut, 43: 692-698, 1998.[Abstract/Free Full Text]
- Finkenzeller G., Sparacio A., Technau A., Marme D., Siemeister G. Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression. Oncogene, 15: 669-676, 1997.[Medline]
- Schafer, G., Cramer, T., Suske, G., Kemmner, W., Wiedenmann, B., and Hocker, M. Oxidative stress regulates vascular endothelial growth factor-A gene transcription through Sp1- and Sp3-dependent activation of two proximal GC-rich promoter elements. J. Biol. Chem., 278: in press, 2003.
- Hagen G., Muller S., Beato M., Suske G. Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res., 20: 5519-5525, 1992.[Abstract/Free Full Text]
- Plate K. From angiogenesis to lymphangiogenesis. Nat. Med., 7: 151-152, 2001.[Medline]
- Kawahara N., Ono M., Taguchi K., Okamoto M., Shimada M., Takenaka K., Hayashi K., Mosher D. F., Sugimachi K., Tsuneyoshi M., Kuwano M. Enhanced expression of thrombospondin-1 and hypovascularity in human cholangiocarcinoma. Hepatology, 28: 1512-1517, 1998.[Medline]
- Hida Y., Morita T., Fujita M., Miyasaka Y., Horita S., Fujioka Y., Nagashima K., Katoh H. Vascular endothelial growth factor expression is an independent negative predictor in extrahepatic biliary tract carcinomas. Anticancer Res., 19: 2257-2260, 1999.[Medline]
- Brown L. F., Berse B., Jackman R. W., Tognazzi K., Manseau E. J., Senger D. R., Dvorak H. F. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in adenocarcinomas of the gastrointestinal tract. Cancer Res., 53: 4727-4735, 1993.[Abstract/Free Full Text]
- Plate K. H., Breier G., Weich H. A., Risau W. Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature (Lond.), 359: 845-848, 1992.[Medline]
- Ikeda E., Achen M. G., Breier G., Risau W. Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. J. Biol. Chem., 270: 19761-19766, 1995.[Abstract/Free Full Text]
- Takahashi Y., Kitadai Y., Bucana C. D., Cleary K. R., Ellis L. M. Expression of vascular endothelial growth factor and its receptor, KDR, correlates with vascularity, metastasis, and proliferation of human colon cancer. Cancer Res., 55: 3964-3968, 1995.[Abstract/Free Full Text]
- Reeves M. E., DeMatteo R. P. Genes and viruses in hepatobiliary neoplasia. Semin. Surg. Oncol., 19: 84-93, 2000.[Medline]
- Jonas S., Springmeier G., Tauber R., Wiedenmann B., Lobeck H., Gessner R., Kreft B., Kling N., Moelling K., Neuhaus P. p53 mutagenesis in Klatskin tumors. Hum. Pathol., 29: 955-960, 1998.[Medline]
- Okada F., Rak J. W., Croix B. S., Lieubeau B., Kaya M., Roncari L., Shirasawa S., Sasazuki T., Kerbel R. S. Impact of oncogenes in tumor angiogenesis: mutant K-ras up-regulation of vascular endothelial growth factor/vascular permeability factor is necessary, but not sufficient for tumorigenicity of human colorectal carcinoma cells. Proc. Natl. Acad. Sci. USA, 95: 3609-3614, 1998.[Abstract/Free Full Text]
- Kieser A., Weich H. A., Brandner G., Marme D., Kolch W. Mutant p53 potentiates protein kinase C induction of vascular endothelial growth factor expression. Oncogene, 9: 963-969, 1994.[Medline]
- Goldman C. K., Kim J., Wong W. L., King V., Brock T., Gillespie G. Y. Epidermal growth factor stimulates vascular endothelial growth factor production by human malignant glioma cells: a model of glioblastoma multiforme pathophysiology. Mol. Biol. Cell, 4: 121-133, 1993.[Abstract]
- Pertovaara L., Kaipainen A., Mustonen T., Orpana A., Ferrara N., Saksela O., Alitalo K. Vascular endothelial growth factor is induced in response to transforming growth factor-ß in fibroblastic and epithelial cells. J. Biol. Chem., 269: 6271-6274, 1994.[Abstract/Free Full Text]
- Grande J. P. Role of transforming growth factor-ß in tissue injury and repair. Proc. Soc. Exp. Biol. Med., 214: 27-40, 1997.[Abstract]
- Border W. A., Noble N. A. Transforming growth factor ß in tissue fibrosis. N. Engl. J. Med., 331: 1286-1292, 1994.[Free Full Text]
- Oberhammer F., Bursch W., Parzefall W., Breit P., Erber E., Stadler M., Schulte-Hermann R. Effect of transforming growth factor ß on cell death of cultured rat hepatocytes. Cancer Res., 51: 2478-2485, 1991.[Abstract/Free Full Text]
- Yokomuro S., Tsuji H., Lunz J. G., III, Sakamoto T., Ezure T., Murase N., Demetris A. J. Growth control of human biliary epithelial cells by interleukin 6, hepatocyte growth factor, transforming growth factor ß1, and activin A: comparison of a cholangiocarcinoma cell line with primary cultures of non-neoplastic biliary epithelial cells. Hepatology, 32: 26-35, 2000.[Medline]
- Goggins M., Shekher M., Turnacioglu K., Yeo C. J., Hruban R. H., Kern S. E. Genetic alterations of the transforming growth factor ß receptor genes in pancreatic and biliary adenocarcinomas. Cancer Res., 58: 5329-5332, 1998.[Abstract/Free Full Text]
- Grady W. M., Myeroff L. L., Swinler S. E., Rajput A., Thiagalingam S., Lutterbaugh J. D., Neumann A., Brattain M. G., Chang J., Kim S. J., Kinzler K. W., Vogelstein B., Willson J. K., Markowitz S. Mutational inactivation of transforming growth factor ß receptor type II in microsatellite stable colon cancers. Cancer Res., 59: 320-324, 1999.[Abstract/Free Full Text]
- Dolecki G. J., Connolly D. T. Effects of a variety of cytokines and inducing agents on vascular permeability factor mRNA levels in U937 cells. Biochem. Biophys. Res. Commun., 180: 572-578, 1991.[Medline]
- Chua C. C., Hamdy R. C., Chua B. H. Mechanism of transforming growth factor-ß1-induced expression of vascular endothelial growth factor in murine osteoblastic MC3T3-E1 cells. Biochim. Biophys. Acta, 1497: 69-76, 2000.[Medline]
- Saadeh P. B., Mehrara B. J., Steinbrech D. S., Dudziak M. E., Greenwald J. A., Luchs J. S., Spector J. A., Ueno H., Gittes G. K., Longaker M. T. Transforming growth factor-ß1 modulates the expression of vascular endothelial growth factor by osteoblasts. Am. J. Physiol, 277: C628-C637, 1999.[Abstract/Free Full Text]
- Frank S., Hubner G., Breier G., Longaker M. T., Greenhalgh D. G., Werner S. Regulation of vascular endothelial growth factor expression in cultured keratinocytes. Implications for normal and impaired wound healing. J. Biol. Chem., 270: 12607-12613, 1995.[Abstract/Free Full Text]
- De Bleser P. J., Niki T., Rogiers V., Geerts A. Transforming growth factor-ß gene expression in normal and fibrotic rat liver. J. Hepatol., 26: 886-893, 1997.[Medline]
- Vogelbruch M., Wellmann A., Maschek H., Schafer M. K., Flemming P., Georgii A. Transforming growth factor ß 1 in human liver tumors. Verh. Dtsch. Ges. Pathol., 79: 132-136, 1995.[Medline]
- Chen Y., Sasatomi E., Satoh T., Miyazaki K., Tokunaga O. Abnormal distribution of collagen type IV in extrahepatic bile duct carcinoma. Pathol. Int., 50: 884-890, 2000.[Medline]
- Brogi E., Wu T., Namiki A., Isner J. M. Indirect angiogenic cytokines upregulate VEGF and bFGF gene expression in vascular smooth muscle cells, whereas hypoxia upregulates VEGF expression only. Circulation, 90: 649-652, 1994.[Abstract/Free Full Text]
- Milanini J., Vinals F., Pouyssegur J., Pages G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J. Biol. Chem., 273: 18165-18172, 1998.[Abstract/Free Full Text]
- Tanaka T., Kanai H., Sekiguchi K., Aihara Y., Yokoyama T., Arai M., Kanda T., Nagai R., Kurabayashi M. Induction of VEGF gene transcription by IL-1ß is mediated through stress-activated MAP kinases and Sp1 sites in cardiac myocytes. J. Mol. Cell Cardiol., 32: 1955-1967, 2000.[Medline]
- Salimath B., Marme D., Finkenzeller G. Expression of the vascular endothelial growth factor gene is inhibited by p73. Oncogene, 19: 3470-3476, 2000.[Medline]
- Li J. M., Datto M. B., Shen X., Hu P. P., Yu Y., Wang X. F. Sp1, but not Sp3, functions to mediate promoter activation by TGF-ß through canonical Sp1 binding sites. Nucleic Acids Res., 26: 2449-2456, 1998.[Abstract/Free Full Text]
- Derynck R., Zhang Y., Feng X. H. Smads: transcriptional activators of TGF-ß responses. Cell, 95: 737-740, 1998.[Medline]
- Pardali K., Kurisaki A., Moren A., Ten Dijke P., Kardassis D., Moustakas A. Role of Smad proteins and transcription factor Sp1 in p21Waf1/Cip1 regulation by transforming growth factor-ß. J. Biol. Chem., 275: 29244-29256, 2000.[Abstract/Free Full Text]
- Feng X. H., Lin X., Derynck R. Smad2, Smad3 and Smad4 cooperate with Sp1 to induce p15Ink4B transcription in response to TGF-ß. EMBO J., 19: 5178-5193, 2000.[Medline]
- Poncelet A. C., Schnaper H. W. Sp1 and Smad proteins cooperate to mediate transforming growth factor-ß1-induced
2(I) collagen expression in human glomerular mesangial cells. J. Biol. Chem., 276: 6983-6992, 2001.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A. Basu, A. G. Contreras, D. Datta, E. Flynn, L. Zeng, H. T. Cohen, D. M. Briscoe, and S. Pal
Overexpression of Vascular Endothelial Growth Factor and the Development of Post-Transplantation Cancer
Cancer Res.,
July 15, 2008;
68(14):
5689 - 5698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Thelen, A. Scholz, C. Benckert, W. Weichert, E. Dietz, B. Wiedenmann, P. Neuhaus, and S. Jonas
Tumor-Associated Lymphangiogenesis Correlates with Lymph Node Metastases and Prognosis in Hilar Cholangiocarcinoma
Ann. Surg. Oncol.,
March 1, 2008;
15(3):
791 - 799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Obama, S. Satoh, R. Hamamoto, Y. Sakai, Y. Nakamura, and Y. Furukawa
Enhanced Expression of RAD51 Associating Protein-1 Is Involved in the Growth of Intrahepatic Cholangiocarcinoma Cells
Clin. Cancer Res.,
March 1, 2008;
14(5):
1333 - 1339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ishida, J.-L. Gao, and P. M. Murphy
Chemokine Receptor CX3CR1 Mediates Skin Wound Healing by Promoting Macrophage and Fibroblast Accumulation and Function
J. Immunol.,
January 1, 2008;
180(1):
569 - 579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Jungert, A. Buck, G. v. Wichert, G. Adler, A. Konig, M. Buchholz, T. M. Gress, and V. Ellenrieder
Sp1 Is Required for Transforming Growth Factor-{beta}-Induced Mesenchymal Transition and Migration in Pancreatic Cancer Cells
Cancer Res.,
|