
[Cancer Research 63, 902-905, March 1, 2003]
© 2003 American Association for Cancer Research
Ogg1 Knockout-associated Lung Tumorigenesis and Its Suppression by Mth1 Gene Disruption1
Kunihiko Sakumi2,
Yohei Tominaga,
Masato Furuichi,
Ping Xu,
Teruhisa Tsuzuki,
Mutsuo Sekiguchi and
Yusaku Nakabeppu
Division of Neurofunctional Genomics, Medical Institute of Bioregulation, Kyushu University and CREST, JST, Fukuoka 812-8582 [K. S., Y. T., M. F., P. X., Y. N.]; Department of Medical Biophysics and Radiation Biology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 [T. T.]; and Biomolecular Engineering Research Institute, Suita 565-0874 [M. S.], Japan
 |
ABSTRACT
|
|---|
Using Mth1 and Ogg1 knockout mice, we evaluated the roles of these enzymes to prevent tumorigenesis and the accumulation of 8-oxoguanine (8-oxoG) in DNA. We found that lung adenoma/carcinoma spontaneously developed in Ogg1 knockout mice
1.5 years after birth in which 8-oxoG was found to accumulate in their genomes. The mean number of tumors/mouse was 0.71 for the Ogg1 knockout mice, which was five times higher than that observed in wild-type mice (0.14). Although the accumulation of 8-oxoG was also confirmed in the Ogg1, Mth1 double knockout mice, we found no tumor in the lungs of these mice. This observation suggests that Mth1 gene disruption resulted in a suppression of the tumorigenesis caused by an Ogg1 deficiency.
 |
Introduction
|
|---|
8-OxoG3
is a mutation-prone molecule that pairs with adenine as well as cytosine during DNA replication, thus resulting in a transversion mutation (1
, 2)
. The occurrence of 8-oxoG in DNA is derived through two pathways, an incorporation of oxidized precursor, 8-oxodGTP into DNA during DNA synthesis, and the direct oxidation of guanine base in DNA. To prevent the former pathway, organisms possess the oxidized purine nucleoside triphosphatase encoded by the Mth1 gene, which degrades 8-oxo dGTP into 8-oxo dGMP and PPI (3
, 4)
. Once 8-oxoG comes into existence in DNA, 8-oxoG-DNA glycosylase, encoded by Ogg1 gene, removes the oxidized base from the DNA (5, 6, 7)
. To evaluate the roles of these enzymes to prevent tumorigenesis and the accumulation of 8-oxoG in DNA, we produced Ogg1, Mth1 double knockout mice and compared their tumor susceptibility and 8-oxoG content with either Ogg1 or Mth1 single knockout mice and also with wild type mice. We herein show that lung adenoma/carcinoma spontaneously developed in Ogg1 knockout mice in which 8-oxoG accumulated in the genome. Although, the accumulation of 8-oxoG was also confirmed in Ogg1, Mth1 double knockout mice, we found no tumors in the lungs of these mice.
 |
Materials and Methods
|
|---|
Knockout Mouse and Tumorigenesis Experiment.
The development of Mth1 knockout mice has been described previously (8)
. To disrupt the Ogg1 gene, a targeting vector was constructed by replacing the 3.1-kbp XhoI-XhoI region, which contains exons 13, with the polII-neo cassette. The targeting vector was then introduced into CCE ES cells by electroporation using standard procedures (8)
. Ogg1 gene-disrupted ES cells were injected into C57Bl/6J blastcyst to produce Ogg1 knockout mice. In experiment 1, the parental mice (Fig. 2A, A and B)
had been backcrossed to C57Bl/6J for the 10th (Mth1) or 2nd (Ogg1) generations. To obtain mice with four kinds of genotypes, TTGG, ttGG, TTgg, and ttgg, the TtGG males were crossed with TTGg females to produce TtGg mice. Among the 153 weaned offspring obtained from inbreeding the TtGg mice, we found 8 TTGG, 8 ttGG, 14 TTgg, and 7 ttgg mice, respectively, by two independent genotypings. During tumorigenesis experiment, 1 TTGG mouse and 1 ttgg mouse died by water leak accident before examination and were omitted from the result. One ttGG mouse died by thymic lymphoma without lung tumor on 571st day after birth, which was included in the result (no. 238 in Fig. 2A
). One ttgg mouse, which was born from an intercross, was killed by euthanasia on 547th day after birth, because of his severe liver tumor. The mouse had no lung tumor and was shown in Fig. 2A
(no. 287). All other mice used in experiment 1 and 2 survived during the experiments. In experiment 2, the first generation of Ogg1 heterozygous knockout mice backcrossed to C57Bl/6J were intercrossed to prepare 20 TTGG and 11 TTgg mice. The mice were grown under special pathogen-free conditions and then were examined at 580 (±1) days (experiment 1) or between 6975 weeks (experiment 2) after birth to identify any spontaneously developing tumors. The tumors were identified by both macroscopic and microscopic analyses.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 2. The predisposition of Ogg1 knockout mice to lung adenoma/carcinoma. A, the pedigree of the knockout mice. Parental mice (A and B) have been backcrossed to C57Bl/6J for the 10th (Mth1) or 2nd (Ogg1) generations. The filled in figures represent the Ogg1 (blue) and Mth1 (red) knockout alleles, respectively. The ID numbers of the mice possessing lung adenoma/carcinoma were marked in red. The number of tumors found in the same mouse is indicated beside the ID number. B, genotyping of Mth1 and Ogg1 alleles of the knockout mice. KO and WT indicate the knockout and wild-type alleles, respectively. The PCR primers are described in the "Materials and Methods." C, RT-PCR. The primers are described in the "Materials and Methods." In Ogg1, the band corresponding to the major transcript is marked by *. D, lung adenoma and carcinoma developed in the TTgg mice. Left: lung carcinoma; right: lung adenoma. Top right and bottom, stained with H&E.
|
|
Genomic PCR and RT-PCR.
Tail and liver DNAs were used for genomic PCR to determine the genotype of each mouse. The position and direction of each primer is shown in Fig. 1
. Recombinant Taq DNA polymerase and a DNA Ladder (1 kb) were obtained from Takara Shuzo (Kyoto, Japan) and Life Technologies, Inc., respectively. The primer sequences used to determine the genotype were as follows: Mth1: HIMT-1, CTCTCCAGCCCTTGTTCAAGTTC; mgMTH3-1, CCTACTCTCTTGGGCTTCATCC; neoHI1, GAACCTGCGTGCAATCCATCTTGT; and Ogg1: mgO5-1, GTTAAGCTTCAAACGTGCCTC; mgO3-1, GAAGGACTGTCCAGAAGCTA; and mpII5'-3, AAAGTCTCTCATTAGTATCCC.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1. Mth1 and Ogg1 knockout mice. Genomic structure of Mth1 and Ogg1 knockout mice. The coding regions in the exons are shown as a closed area. The position and direction of each primer for genomic-PCR and RT-PCR was indicated by closed and open triangles, respectively.
|
|
For RT-PCR analyses, total RNA was prepared from the liver using Isogen (Nippon Gene Co. Ltd., Toyama, Japan). First strand cDNA was synthesized by a first strand cDNA synthesis kit (Amersham Pharmacia Biotech United Kingdom Ltd.) using random primers. The primers used to amplify the specific cDNAs were as follows. Mth1: mtYS-1, CTCCGCCCCGGGAAACTTTG and mt5-3, AACCACTGAGGGCGCATTTC; Ogg1: mO5-2, CCAGCTCTATTGCACTGTGTA and mO3-3, GCCATACATGGACATCCAC. The position and direction of each primer is shown in Fig. 1
.
Measurement of 8-OxodG in DNA.
Liver DNA was extracted using a DNA Extractor WB-Rapid kit (Wako Pure Chemical Industries Ltd.) according to the manufactures instruction. The extracted DNA was hydrolyzed by Nuclease P1 (Seikagaku Kogyo Co.) and acid phosphatase before HPLC-MS/MS analyses. A HPLC-MS/MS analysis of 8-oxodG in the digests of DNA was performed using the Shimadzu VP-10 HPLC system connected to the API 3000 MS/MS system (PE-SCIEX, Thornill, Ontario, Canada). The separation of the nucleosides was done on a Hydrosphere C18 column (3 µm, 2 x 150 mm; YMC, Kyoto, Japan). The concentrations of 8-oxodG in the samples were obtained using the MacQuan program with a standard curve for each set of measurements, and the ratios of 8-oxodG to 106dG in the samples were shown. All measurements were performed on a blind test basis.
 |
Results
|
|---|
To obtain mice with four kinds of genotypes, namely, TTGG, ttGG, TTgg, and ttgg, we used Mth1 knockout (TtGG) and Ogg1 knockout (TTGg) mice, which had been maintained by backcrossing to C57Bl/6J as a heterozygous animal. The Mth1 knockout mouse carries a mutated Mth1 gene, which lacks the exon 3 that encodes the first 56 amino acids of the protein (8)
. The Ogg1 knockout mouse was originally established in this study by replacing exons 13, which encode the first 189 amino acids of the Ogg1 protein, with the polII-neo cassette. The genome structures of these knockout mice are shown in Fig. 1
. The TtGG males were crossed with TTGg females to produce TtGg mice. Among the progenies obtained from inbreeding the TtGg mice, we selected TTGG, TTgg, ttGG, and ttgg mice for use in a spontaneous tumorigenesis experiment (Fig. 2A)
. The disruption of each gene was confirmed by PCR of the genomic DNA and also by the disappearance of each transcript (Fig. 2, B and C)
. We found four bands in the RT-PCR products for Ogg1 transcript, thus indicating that there are some alternative splicing transcripts, which may encode different polypeptides.
These mice were grown under special pathogen-free conditions and then were examined at 580 (±1) days after birth to identify any spontaneously developing tumors. We found the TTgg mice to be susceptible to the lung adenoma/carcinoma (Fig. 2A)
. Six of 14 TTgg mice demonstrated lung adenoma/carcinoma, and some of the mice had a plural number of tumors in different lobes. Most of these tumors localized not on the surface but inside the lung. Typical tumors found in the Ogg1-deficient mice are shown in Fig. 2D
. As shown in Table 1
(experiment 1), the mean number of tumors/mouse was 0.71 for the TTgg mice, which is five times higher than that observed in TTGG mice (0.14). We obtained similar result from a different experiment using Ogg1+/+(TTGG) and Ogg1-/- (TTgg) mice examined at 6975 weeks after birth (Table 1
, experiment 2). The experiment also showed few differences in the number of liver and intestinal tumors between the TTGG and TTgg mice (data not shown).
Although we had expected the Mth1 mutation to have an additional effect on Ogg1-knockout-associated lung tumorigenesis, Mth1 gene disruption caused a suppression of the tumorigenesis. As shown in Fig. 2A
, we found no lung adenoma/carcinoma in either the ttgg mice or their offspring, although no functional Ogg1 mRNA was found in the mice. To evaluate the roles of the Ogg1 and Mth1 gene products regarding the decrease in the amount of 8-oxoG in the genome, the level of 8-oxodG in the liver DNA of each mouse was determined by HPLC-MS/MS. The amount of 8-oxodG/106dG for each mouse was found to be as follows: TTGG, 5.4 ± 0.6 (n = 7); TTgg, 32.1 ± 0.7(n = 14); ttGG, 6.0 ± 0.3 (n = 6); and ttgg, 34.3 ± 0.4 (n = 5). As shown in Fig. 3
, the amount of 8-oxodG in the DNA of the ttgg mice was as high as that in the TTgg mice and five times higher than that in the wild-type mice. It is therefore evident that the systems to exclude 8-oxoG are apparently impaired in the ttgg mice. The amounts of 8-oxodG in the DNA of the Mth1-disrupted mice were slightly higher than those in the mice carrying a wild-type allele (TTGG versus ttGG, TTgg versus ttgg), however, the difference was not statistically significant. We confirmed that no MTH1 protein existed in either the ttGG or ttgg mice based on the Western blotting analyses (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3. The amount of 8-oxoG contained in the genome of each knockout mouse. Error bars indicate the SE. The amount of 8-oxodG/106dG for each mouse was described in "Results." The differences in the amounts of 8-oxodG/106dG between TTGG and TTgg, TTGG and ttgg, ttGG and ttgg, and ttGG and TTgg were found to be statistically significant (P < 0.001). All statistical differences were examined using Students t test.
|
|
 |
Discussion
|
|---|
There has been no report demonstrating the biological function of 8-oxoG in mammals. In this study, we experimentally demonstrated that Ogg1 knockout mice are predisposed to develop lung adenoma/carcinoma. Most of these tumors exist not on the surface of the lung like methylnitrosourea-induced adenoma (9)
but inside the lung lobes. Previous reports on the Ogg1 knockout mouse recognized no tumors (10
, 11)
, possibly because of the length of observation. Because mutations of the OGG1 gene in human lung cancer have been reported (12, 13, 14, 15)
, the Ogg1 gene should act as a lung tumor suppressor gene in mammals.
To evaluate the roles of the Ogg1 and Mth1 gene products to play in decreasing the amount of 8-oxoG in the genome, the level of 8-oxodG in the liver DNA of each mouse was measured by HPLC-MS/MS. In the Ogg1-deficient mice, an accumulation of 8-oxodG was observed, as previously reported (10
, 11)
. In the ttGG mice, the 8-oxodG content was slightly higher than that in the TTGG mice, however, the difference was not statistically significant. Even under the Ogg1-deficient background, an Mth1 deficiency also resulted in a slight increase in the accumulation of 8-oxodG in DNA. These results proved that the direct oxidation of the guanine base occurs much more frequently than the incorporation of 8-oxodGTP into DNA. In addition, it was also indicated that keeping the 8-oxodG content at low level in DNA is achieved mostly by the Ogg1 gene product. However, it was not statistically significant, MTH1 protein seems to work to decrease the amount of 8-oxodG in DNA.
Although we had expected an additional effect of Mth1 mutation on Ogg1 knockout-associated lung tumorigenesis, no lung tumor was found in the ttgg mouse, though it demonstrated the highest amount of 8-oxodG in all of the observed DNA. This result indicates that the Mth1 gene disruption caused a suppression of the tumorigenesis associated with Ogg1 deficiency. Because MTH1 protein hydrolyzes other oxidized purine nucleoside triphosphates in addition to 8-oxo-dGTP (16)
, one possibility is that the accumulation of oxidized forms of dATP or ATP may cause a suppression of the tumorigenesis. Alternatively, another tumor suppressor responsible gene may exist in the genomic region derived from ES cells, and it had cotransmitted with the Mth1 knockout allele for 10 generations of backcrossing. The genomic region derived from ES cell, including the Mth1 knockout allele was determined to locate between the STS markers of D5Mit99 and D5Mit43 on chromosome 5 (data not shown).
In our interpretation, defect of 8-oxoG repair activity is a cause of lung tumorigenesis observed in the Ogg1 knockout mice. By the limitation of knockout mouse strategy, however, we cannot rule out the possibility that there might be another lung tumor responsible gene that derives from the ES cell genome and links to the Ogg1 knockout allele. A complementation test using Ogg1 transgene will help to conclude the role of the gene.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Norihiko Kinoshita, Naomi Adachi, Akemi Matsuyama, Yukari Yamada, Tadasuke Tsukiyama, and Kenji Nakamura for technical assistance and Dr. Brian Quinn for comments on the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by Grants-in-Aid 13214078, 12213104, and 12680814 from the Ministry of Education, Science, and Culture of Japan. 
2 To whom requests for reprints should be addressed, at Division of Neurofunctional Genomics, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582, Japan. Phone: 81-92-642-6802; Fax: 81-92-642-6804; E-mail: sakumi{at}bioreg.kyushu-u.ac.jp 
3 The abbreviations used are: 8-oxoG, 8-oxoguanine; ES, embryonic stem; 8-oxodG, 8-oxo-deoxyguanosine; dG, deoxyguanosine; TTGG, Mth1+/+·Ogg1+/+; ttGG, Mth1-/-·Ogg1+/+; TTgg, Mth1+/+·Ogg1-/-; ttgg, Mth1-/-·Ogg1-/-; TgGG, Mth1+/-·Ogg1+/+; TTGg, Mth1+/+·Ogg1+/-; TtGg, Mth1+/-·Ogg1+/-; HPLC, high-performance liquid chromatography; MS/MS, tandem mass spectrometry; RT-PCR, reverse transcription-PCR. 
Received 7/16/02.
Accepted 1/16/03.
 |
REFERENCES
|
|---|
- Kasai H., Chung M. H., Jones D. S., Inoue H., Ishikawa H., Kamiya H., Ohtsuka E., Nishimura S. 8-Hydroxyguanine, a DNA adduct formed by oxygen radicals: its implication on oxygen radical-involved mutagenesis/carcinogenesis. J. Toxicol. Sci., 16 (Suppl. 1): 95-105, 1991.
- Maki H., Sekiguchi M. MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis. Nature (Lond.), 355: 273-275, 1992.[Medline]
- Sakumi K., Furuichi M., Tsuzuki T., Kakuma T., Kawabata S., Maki H., Sekiguchi M. Cloning and expression of cDNA for a human enzyme that hydrolyzes 8-oxo-dGTP, a mutagenic substrate for DNA synthesis. J. Biol. Chem., 268: 23524-23530, 1993.[Abstract/Free Full Text]
- Sakai Y., Furuichi M., Takahashi M., Mishima M., Iwai S., Shirakawa M., Nakabeppu Y. A molecular basis for the selective recognition of 2-hydroxy-dATP and 8-oxo-dGTP by human MTH1. J. Biol. Chem., 277: 8579-8587, 2002.[Abstract/Free Full Text]
- Radicella J. P., Dherin C., Desmaze C., Fox M. S., Boiteux S. Cloning and characterization of hOGG1, a human homolog of the OGG1 gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 94: 8010-8015, 1997.[Abstract/Free Full Text]
- Rosenquist T. A., Zharkov D. O., Grollman A. P. Cloning and characterization of a mammalian 8-oxoguanine DNA glycosylase. Proc. Natl. Acad. Sci. USA, 94: 7429-7434, 1997.[Abstract/Free Full Text]
- Arai K., Morishita K., Shinmura K., Kohno T., Kim S. R., Nohmi T., Taniwaki M., Ohwada S., Yokota J. Cloning of a human homolog of the yeast OGG1 gene that is involved in the repair of oxidative DNA damage. Oncogene, 14: 2857-2861, 1997.[Medline]
- Tsuzuki T., Egashira A., Igarashi H., Iwakuma T., Nakatsuru Y., Tominaga Y., Kawate H., Nakao K., Nakamura K., Ide F., Kura S., Nakabeppu Y., Katsuki M., Ishikawa T., Sekiguchi M. Spontaneous tumorigenesis in mice defective in the MTH1 gene encoding 8-oxo-dGTPase. Proc. Natl. Acad. Sci. USA, 98: 11456-11461, 2001.[Abstract/Free Full Text]
- Sakumi K., Shiraishi A., Shimizu S., Tsuzuki T., Ishikawa T., Sekiguchi M. Methylnitrosourea-induced tumorigenesis in MGMT gene knockout mice. Cancer Res., 57: 2415-2418, 1997.[Abstract/Free Full Text]
- Klungland A., Rosewell I., Hollenbach S., Larsen E., Daly G., Epe B., Seeberg E., Lindahl T., Barnes D. E. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage. Proc. Natl. Acad. Sci. USA, 96: 13300-13305, 1999.[Abstract/Free Full Text]
- Minowa O., Arai T., Hirano M., Monden Y., Nakai S., Fukuda M., Itoh M., Takano H., Hippou Y., Aburatani H., Masumura K., Nohmi T., Nishimura S., Noda T. Mmh/Ogg1 gene inactivation results in accumulation of 8-hydroxyguanine in mice. Proc. Natl. Acad. Sci. USA, 97: 4156-4161, 2000.[Abstract/Free Full Text]
- Lu R., Nash H. M., Verdine G. L. A mammalian DNA repair enzyme that excises oxidatively damaged guanines maps to a locus frequently lost in lung cancer. Curr. Biol., 7: 397-407, 1997.[Medline]
- Chevillard S., Radicella J. P., Levalois C., Lebeau J., Poupon M. F., Oudard S., Dutrillaux B., Boiteux S. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumours. Oncogene, 16: 3083-3086, 1998.[Medline]
- Sugimura H., Kohno T., Wakai K., Nagura K., Genka K., Igarashi H., Morris B. J., Baba S., Ohno Y., Gao C., Li Z., Wang J., Takezaki T., Tajima K., Varga T., Sawaguchi T., Lum J. K., Martinson J. J., Tsugane S., Iwamasa T., Shinmura K., Yokota J. hOGG1 Ser326Cys polymorphism and lung cancer susceptibility. Cancer Epidemiol. Biomark. Prev., 8: 669-674, 1999.[Abstract/Free Full Text]
- Wikman H., Risch A., Klimek F., Schmezer P., Spiegelhalder B., Dienemann H., Kayser K., Schulz V., Drings P., Bartsch H. hOGG1 polymorphism and loss of heterozygosity (LOH): significance for lung cancer susceptibility in a Caucasian population. Int. J. Cancer, 88: 932-937, 2000.[Medline]
- Fujikawa K., Kamiya H., Yakushiji H., Fujii Y., Nakabeppu Y., Kasai H. The oxidized forms of dATP are substrates for the human MutT homologue, the hMTH1 protein. J. Biol. Chem., 274: 18201-18205, 1999.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
K. Sakamoto, Y. Tominaga, K. Yamauchi, Y. Nakatsu, K. Sakumi, K. Yoshiyama, A. Egashira, S. Kura, T. Yao, M. Tsuneyoshi, et al.
MUTYH-Null Mice Are Susceptible to Spontaneous and Oxidative Stress Induced Intestinal Tumorigenesis
Cancer Res.,
July 15, 2007;
67(14):
6599 - 6604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kohno, T. Sakiyama, H. Kunitoh, K. Goto, Y. Nishiwaki, D. Saito, H. Hirose, T. Eguchi, N. Yanagitani, R. Saito, et al.
Association of polymorphisms in the MTH1 gene with small cell lung carcinoma risk
Carcinogenesis,
December 1, 2006;
27(12):
2448 - 2454.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Landi, F. Gemignani, F. Canzian, V. Gaborieau, R. Barale, D. Landi, N. Szeszenia-Dabrowska, D. Zaridze, J. Lissowska, P. Rudnai, et al.
DNA Repair and Cell Cycle Control Genes and the Risk of Young-Onset Lung Cancer.
Cancer Res.,
November 15, 2006;
66(22):
11062 - 11069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Akatsuka, T. T. Aung, K. K. Dutta, L. Jiang, W.-H. Lee, Y.-T. Liu, J. Onuki, T. Shirase, K. Yamasaki, H. Ochi, et al.
Contrasting Genome-Wide Distribution of 8-Hydroxyguanine and Acrolein-Modified Adenine during Oxidative Stress-Induced Renal Carcinogenesis
Am. J. Pathol.,
October 1, 2006;
169(4):
1328 - 1342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sakai, M. Nakanishi, K. Yoshiyama, and H. Maki
Impact of reactive oxygen species on spontaneous mutagenesis in Escherichia coli.
Genes Cells,
July 1, 2006;
11(7):
767 - 778.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Hill and M. K. Evans
Dimerization and opposite base-dependent catalytic impairment of polymorphic S326C OGG1 glycosylase
Nucleic Acids Res.,
March 20, 2006;
34(5):
1620 - 1632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kajitani, H. Yamaguchi, Y. Dan, M. Furuichi, D. Kang, and Y. Nakabeppu
MTH1, an Oxidized Purine Nucleoside Triphosphatase, Suppresses the Accumulation of Oxidative Damage of Nucleic Acids in the Hippocampal Microglia during Kainate-Induced Excitotoxicity
J. Neurosci.,
February 8, 2006;
26(6):
1688 - 1698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Hollander, R. T. Philburn, A. D. Patterson, S. Velasco-Miguel, E. C. Friedberg, R. I. Linnoila, and A. J. Fornace Jr.
Deletion of XPC leads to lung tumors in mice and is associated with early events in human lung carcinogenesis
PNAS,
September 13, 2005;
102(37):
13200 - 13205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kunisada, K. Sakumi, Y. Tominaga, A. Budiyanto, M. Ueda, M. Ichihashi, Y. Nakabeppu, and C. Nishigori
8-Oxoguanine Formation Induced by Chronic UVB Exposure Makes Ogg1 Knockout Mice Susceptible to Skin Carcinogenesis
Cancer Res.,
July 15, 2005;
65(14):
6006 - 6010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Hung, P. Brennan, F. Canzian, N. Szeszenia-Dabrowska, D. Zaridze, J. Lissowska, P. Rudnai, E. Fabianova, D. Mates, L. Foretova, et al.
Large-Scale Investigation of Base Excision Repair Genetic Polymorphisms and Lung Cancer Risk in a Multicenter Study
J Natl Cancer Inst,
April 20, 2005;
97(8):
567 - 576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Luna, V. Rolseth, G. A. Hildrestrand, M. Otterlei, F. Dantzer, M. Bjoras, and E. Seeberg
Dynamic relocalization of hOGG1 during the cell cycle is disrupted in cells harbouring the hOGG1-Cys326 polymorphic variant
Nucleic Acids Res.,
March 30, 2005;
33(6):
1813 - 1824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ushijima, Y. Tominaga, T. Miura, D. Tsuchimoto, K. Sakumi, and Y. Nakabeppu
A functional analysis of the DNA glycosylase activity of mouse MUTYH protein excising 2-hydroxyadenine opposite guanine in DNA
Nucleic Acids Res.,
January 28, 2005;
33(2):
672 - 682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yamane, T. Kohno, K. Ito, N. Sunaga, K. Aoki, K. Yoshimura, H. Murakami, Y. Nojima, and J. Yokota
Differential ability of polymorphic OGG1 proteins to suppress mutagenesis induced by 8-hydroxyguanine in human cell in vivo
Carcinogenesis,
September 1, 2004;
25(9):
1689 - 1694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Xie, H. Yang, C. Cunanan, K. Okamoto, D. Shibata, J. Pan, D. E. Barnes, T. Lindahl, M. McIlhatton, R. Fishel, et al.
Deficiencies in Mouse Myh and Ogg1 Result in Tumor Predisposition and G to T Mutations in Codon 12 of the K-Ras Oncogene in Lung Tumors
Cancer Res.,
May 1, 2004;
64(9):
3096 - 3102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y Kimura, S Oda, A Egashira, Y Kakeji, H Baba, Y Nakabeppu, and Y Maehara
A variant form of hMTH1, a human homologue of the E coli mutT gene, correlates with somatic mutation in the p53 tumour suppressor gene in gastric cancer patients
J. Med. Genet.,
May 1, 2004;
41(5):
e57 - e57.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. NAKABEPPU, D. TSUCHIMOTO, A. ICHINOE, M. OHNO, Y. IDE, S. HIRANO, D. YOSHIMURA, Y. TOMINAGA, M. FURUICHI, and K. SAKUMI
Biological Significance of the Defense Mechanisms against Oxidative Damage in Nucleic Acids Caused by Reactive Oxygen Species: From Mitochondria to Nuclei
Ann. N.Y. Acad. Sci.,
April 1, 2004;
1011(1):
101 - 111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. van der Kemp, J.-B. Charbonnier, M. Audebert, and S. Boiteux
Catalytic and DNA-binding properties of the human Ogg1 DNA N-glycosylase/AP lyase: biochemical exploration of H270, Q315 and F319, three amino acids of the 8-oxoguanine-binding pocket
Nucleic Acids Res.,
January 29, 2004;
32(2):
570 - 578.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ichinoe, M. Behmanesh, Y. Tominaga, Y. Ushijima, S. Hirano, Y. Sakai, D. Tsuchimoto, K. Sakumi, N. Wake, and Y. Nakabeppu
Identification and characterization of two forms of mouse MUTYH proteins encoded by alternatively spliced transcripts
Nucleic Acids Res.,
January 23, 2004;
32(2):
477 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Choudhury, R. Zhang, K. Frenkel, T. Kawamori, F.-L. Chung, and R. Roy
Evidence of Alterations in Base Excision Repair of Oxidative DNA Damage during Spontaneous Hepatocarcinogenesis in Long Evans Cinnamon Rats
Cancer Res.,
November 15, 2003;
63(22):
7704 - 7707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yoshimura, K. Sakumi, M. Ohno, Y. Sakai, M. Furuichi, S. Iwai, and Y. Nakabeppu
An Oxidized Purine Nucleoside Triphosphatase, MTH1, Suppresses Cell Death Caused by Oxidative Stress
J. Biol. Chem.,
September 26, 2003;
278(39):
37965 - 37973.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Gackowski, E. Speina, M. Zielinska, J. Kowalewski, R. Rozalski, A. Siomek, T. Paciorek, B. Tudek, and R. Olinski
Products of Oxidative DNA Damage and Repair as Possible Biomarkers of Susceptibility to Lung Cancer
Cancer Res.,
August 15, 2003;
63(16):
4899 - 4902.
[Abstract]
[Full Text]
[PDF]
|
 |
|