| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Microbiology and Molecular Genetics, College of Medicine, University of California at Irvine, California 92717 [S. K., M. K., E. J. S.], and Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovak Republic [S. K., M. K.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
1%, hereafter termed true hypoxia; Refs. 2
and 4
) via the HRE in the CA9 promoter immediately upstream of the transcription start (4)
. HIF-1, which binds to HRE, is a heterodimeric transcription factor, consisting of the regulated HIF-1
and constitutive HIF-1ß subunits (5)
. Activity of the
subunit can be increased through stabilization by either true hypoxic conditions (6)
or inactivation of the VHL tumor suppressor that targets the HIF-1
subunit for oxygen-dependent proteolysis (7)
. In renal carcinoma cells defective for VHL, CAIX up-regulation is associated with the loss of regulation by hypoxia, consistent with the critical function of VHL in the regulation of HIF-1 (4)
.
In addition to true hypoxic conditions, associated with stabilization of HIF-1
, CAIX expression appears to be controlled by a different mechanism in dense cultures. CAIX was found to be tightly regulated by cell density; CAIX is absent in sparse, rapidly proliferating HeLa cells, whereas its synthesis is induced in dense, overcrowded cultures that express this protein in large amounts (3)
. The mechanism of CAIX induction operating in dense cultures is apparently triggered by an intermediate decrease of O2 tension (<5% and >1%, hereafter termed mild hypoxia) that is generated by increased O2 consumption (8)
. O2 tension in dense culture is too high for stabilization of HIF-1
but sufficient for activation of a PI3-K-dependent pathway (8)
. However, we have shown that for induction of CA9 promoter activity in dense cultures, a minimal level of HIF-1 activity is necessary but not sufficient (8)
. The existence of additional mechanism(s) controlling CAIX expression is also supported by colocalization of CAIX and hypoxia in tumor sections. Although substantially overlapping with pimonidazole staining in regions of acute hypoxia in tumors (4)
, CAIX expression extends beyond the hypoxic regions (4
, 9)
. The patterns of CAIX expression in in vivo as well as in vitro studies are thus consistent with the existence of two separate mechanisms controlling CAIX expression, both dependent on HIF-1
activity and decreased O2 levels but differing with respect to the amount of HIF-1
required. True hypoxia is defined as the mechanism that is driven by HIF-1 and requires HIF-1
stabilization to increase the total amount of HIF-1. Mild hypoxia, on the other hand, although still requiring some HIF-1 activity, induces additional pathway(s), including the involvement of activated PI3-K (8)
, but it is not associated with an additional increase in HIF-1
levels. Varying amounts of HIF-1
have been detected even under normoxic conditions in normal tissue (10)
or cell lines (11)
, and this presumably can provide the small level of HIF-1 activity that is necessary for activation of CA9 under conditions of mild hypoxia.
The CA9 promoter, identified in the [-173, +31] region, contains the critical regulatory elements for CA9 transcriptional activation (4 , 12) . Of the four stimulatory PRs, PR1 was crucial, whereas PR2 enhanced CA9 transcriptional activity (12) . Detailed mutational and supershift analysis identified SP1/SP3 and AP-1 as the critical factors binding PR1 and PR2, respectively (13) .
Although undoubtedly critical for activation under hypoxic conditions (4) , it is of note that HRE alone was not sufficient for activation of the CA9 promoter by mild hypoxia (8) . The minimal mild hypoxia-inducible module within the CA9 promoter consisted of the juxtaposed PR1 and HRE, suggesting a requirement for cooperation between transcription factors binding to these two independent regulatory elements (8) . It has been recognized for some time that a single HRE in isolation is not very active in inducing gene expression in response to hypoxia (14) , and adjacent sequences were identified as being necessary for hypoxic induction (15) , e.g., a cyclic AMP response element in the lactate dehydrogenase A promoter (16) .
As a part of our ongoing effort to understand functioning of the CA9 promoter, we characterized PR5 and its role in transcriptional activation. Given the importance established previously of PR1 for CA9 promoter function (8 , 12 , 13) , we wished to further investigate the role of SP1/SP3 in regulation of true and mild hypoxia-induced CAIX expression. These studies further confirmed the distinction between the two mechanisms on the basis of their different dependency on SP1/SP3 activity. In addition, we define a novel, minimal true, and mild hypoxia-inducible enhancer element consisting of SP1/SP3- and HIF-1-binding elements.
| Materials and Methods |
|---|
|
|
|---|
Plasmid Constructions.
All promoter fragments were cloned in pGL2 basic vector (Promega). The [-173, +31], [-135, +31], [-46, +14], [-36, +14], and [-25, +14] constructs contain the corresponding CA9 fragments. The [-173, +31] (PR1mut) and [-46, +14] (PR1mut) constructs contain the following mutations (bold, underlined) in PR1 ([-46, -24]): AGGCTTGCTCCTAACCCACCCAG. The [-46, +14] (HREmut) construct contains the following mutations in HRE ([-17, +5]): TTTCCAATGCTTTTACAGCCCG. The [-135, +31] (PR1
PR5) construct has PR1 replaced with PR5 and was prepared by block-replacement mutagenesis as described previously (17)
. The SP1HRE construct is a derivative of the [-46, +14] construct with the SP1-binding GC-box sequence TCCGATCGGGGCGGGGCGAGC in place of PR1. Deletions and mutations in all promoter fragments were verified by sequencing.
Cell Lines and Culture.
Human cervical carcinoma HeLa and fibrosarcoma HT 1080 cell lines were grown in DMEM (BioWhittaker), supplemented with 10% FCS (Life Technologies, Inc.), 1.102 units/ml penicillin (Sigma), 1.102 µg/ml streptomycin (ICN), and 125 ng/ml amphotericin B (Sigma). All cell lines were regularly tested for microbial contamination (18)
and uniformly negative. The effects of the SP1 inhibitor MMA (Sigma) on endogenous CAIX expression were tested on the cells that had been seeded at 10,000/cm2 and grown for 3 days. For cell density-dependent CAIX induction, these cells were plated at 160,000/cm2 and incubated in the presence of the indicated MMA concentrations for 24 h. Hypoxic CAIX induction was mimicked with DFO (Sigma). The cells were plated at 40,000/cm2 and pretreated with various concentrations of MMA for 30 min, followed by the addition of 100 µM DFO and incubation for 24 h.
Western Blot Analysis.
Western blot analysis was performed as described previously (8)
.
Transient Transfection Assay.
Cells were transfected with the CA9 pGL2 basic construct (expressing firefly luciferase) and pRL-CMV (Promega; expressing Renilla luciferase) as described previously (8)
. After 7-h exposure to the transfection mixture, the cells were rinsed with PBS, trypsinized, and plated at 20,000 and 160,000/cm2 in the absence/presence of 500 nM MMA. For hypoxia-mimic experiments, the cells were plated at 40,000/cm2 in the absence/presence of 500 nM MMA for 30 min, followed by the addition of 100 µM DFO. The transfected cells were harvested at 42-h post-transfection. Alternatively, the transfected cells were exposed to 0.5% O2 environment in a PROOX In Vitro Chamber (BioSpherix), controlled by the PROOX, model 110 (BioSpherix), for 24 h. Firefly and Renilla luciferase activities were assayed with the Dual-luciferase reporter assay system (Promega) in the Monolight 2010 luminometer. CA9 promoter activity was expressed as the average of ratios of firefly:Renilla luciferase activities from three independent experiments.
EMSA.
NEs were prepared from 3 x 106 cells, seeded at 80,000/cm2, and incubated for 16 h. Cells were washed with ice-cold PBS, resuspended in 1 ml of buffer A [10 mM HEPES (pH 7.9) and 1.5 mM MgCl2], and kept on ice for 15 min. The nuclei were pelleted by centrifugation for 5 min at 4,000 x g at 4°C, resuspended in 200 µl of buffer B [30 mM HEPES (pH 7.9), 1.5 mM MgCl2, 0.2 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin and leupeptin, 500 mM KCl, 10% glycerol], and kept on ice for 15 min. After clearing by centrifugation for 5 min at 12,000 x g at 4°C, the supernatant was recovered as NE and stored in aliquots at -80°C. Protein concentrations were determined with the bicinchoninic acid protein assay reagent. Double-stranded probe PR5 (TGCCCCTCACTCCACCCCCATCCTAGCT and its complement; Ref. 12
) was end-labeled with T4-polynucleotide kinase and purified with QIAquick Nucleotide Removal kit (Qiagen). As competitors PR5, PR1 (CCAGGCTTGCTCCTCCCCCACCCAG and its complement), SP1 (GC-box-ATTCGATCGGGGCGGGGCGAGC and its complement), transforming growth factor-ß RCE (CGCCCCCGGCCCCACCCCAGGAAG and its complement), and AP-1 (CGCTCTGTGAGTCAGCCTG and its complement) oligonucleotide probes were used. Binding reactions, supershifts with SP1 and SP3 Ab, electrophoretic separation, and detection of complexes were performed as described previously (13)
.
| Results |
|---|
|
|
|---|
|
|
CAIX Expression Is Dependent on SP1 Activity.
The demonstration that there are two SP1/SP3-binding elements (PR1 and PR5) within the CA9 promoter, as well as the strong dependence of the PR1 position on SP1/SP3 binding, prompted us to investigate the importance of SP1 activity for CAIX expression. MMA, an anticancer drug, specifically inhibits transcription of multiple genes by preventing SP1 binding (19
, 20)
. We tested the effects of MMA on CAIX expression induced by cell density and the hypoxia-mimic DFO in HeLa and HT 1080 cell lines. Western blotting revealed that cell density-induced CAIX expression was effectively abrogated by
100 nM MMA concentrations (Fig. 3A)
. Although more refractory than cell density-induced expression (maximal concentrations were required for complete suppression), hypoxia-mimic-induced CAIX expression was also sensitive to inhibition by MMA (Fig. 3B)
. The MMA concentrations used were not toxic to any cell line, and ß-actin levels were unaffected by MMA treatment (Fig. 3, A and B)
. Because of the higher sensitivity of cell density-mediated CAIX expression to MMA inhibition, we conclude that in the absence of HIF-1
stabilization, SP1 activity plays a more prominent role in the corresponding activating mechanism.
|
|
The Hypoxia-inducible [-36, +14] CA9 Fragment Contains an SP1/SP3-binding Site.
The minimal CA9 sequence, tested previously for hypoxic inducibility, was the [-36, +14] fragment (4)
. However, in addition to the core HRE sequence (Fig. 5A
, TACGTGCA on the antisense strand, underlined bold), this fragment contains a considerable part (boxed) of the SP1-binding site within PR1 (13)
. We asked whether there is a contribution of this incomplete PR1 to transcriptional activity, and, if so, what is the activity of the CA9 HRE in the absence of other upstream sequences (fragment [-25, +14])? To this end, we tested the activity of the [-46, +14], [-36, +14], [-25, +14], [-46, +14] (PR1mut), and SP1HRE constructs in transiently transfected HeLa cells. We found that the inducibility of the [-46, +14], [-36, +14], and SP1HRE constructs by cell density or the hypoxia-mimic DFO was similar, whereas the [-25, +14] and [-46, +14] (PR1mut) constructs were inducible only by DFO (Fig. 5A)
. The fold of induction by DFO for the [-46, +14], [-36, +14], and SP1HRE constructs was considerably higher (78-fold) than the [-25, +14] and [-46, +14] (PR1mut; 3-fold; Fig. 5A
). Apparently, the [-46, +14], [-36, +14], and SP1HRE constructs respond in the same way to inducing signals, suggesting that even the incomplete SP1-binding site in the [-36, +14] fragment is functional, and the factors bound to it (SP1/SP3) are engaged in cooperation with factors bound to HRE.
|
| Discussion |
|---|
|
|
|---|
In addition to the SP1/SP3-binding site identified previously in the PR1 position (13) , competition and supershift EMSA confirmed PR5 as another SP1/SP3-binding site in the CA9 promoter. Deletion of the distal SP1/SP3-binding PR5 decreased CA9 promoter activity, and PR5 could functionally replace PR1. It is of note, however, that PR5 from its original position cannot compensate for SP1/SP3 deficiency in the PR1 position in the mutant with disabled PR1. These results go beyond our previous conclusions about the essential role of SP1/SP3 activity in the PR1 position for CA9 promoter activity (13) , suggesting requirements for optimal spacing between SP1/SP3 binding and factor(s) binding to the juxtaposed HRE.
Except for SP1 and SP3 factors, both PR1 and PR5 are capable of binding another, as yet unidentified factor, designated previously as the complex 3-forming factor (13) . The removal of this factor from the PR1 position by replacing PR1 with GC-box (that binds SP1/SP3 but does not bind complex 3-forming factor-13), within the [-173, +31] (13) or [-46, +14] (SP1HRE; this study) constructs, had no effect on promoter activity. Therefore, although the role of this factor in physiological transcriptional regulation of CA9 is unknown at present, it seems to be dispensable for inducible CA9 promoter activity under hypoxic conditions.
The presence of two SP1/SP3-binding sites (PR1 and PR5) indicated that SP1/SP3 factors may play an important role in specific regulation of CA9 promoter activation. Indeed, by using the SP1 inhibitor MMA, we demonstrated that CAIX induction in HeLa and HT 1080 cell lines is dependent on SP1/SP3 activity. Quantitative differences in the sensitivity of hypoxia-mimic and mild hypoxia-induced CAIX expression to MMA inhibition may be reflective of distinct mechanisms driving CAIX expression under these conditions. We propose that the lower sensitivity of hypoxia-mimic-induced CAIX expression to MMA inhibition reflects the dominant role of HIF-1
stabilization in the hypoxic pathway (4)
with concomitant less dependence on SP1/SP3 activity. On the other hand, mild hypoxia is not associated with HIF-1
stabilization (8)
, and, in the absence of HIF-1 signal, CAIX expression appears to rely more on SP1/SP3 activity. However, it should be noted that hypoxia alone (HIF-1
stabilization) induces a significantly lower level of expression than high density (inducing PI3-K activation) and hypoxia (HIF-1
stabilization) combined (8)
.
In the process of dissection of the minimal mild-hypoxia inducible CA9 promoter fragment [-46, +14], comprising PR1 and HRE (8) , we found that the hypoxia-inducible [-36, +14] CA9 fragment described previously (4) contains a truncated but apparently functional SP1/SP3-binding site. Fold inductions of this construct by hypoxia-mimic and mild hypoxia, as well as absolute values, were comparable with the [-46, +14] and SP1HRE constructs that both harbor full-length SP1/SP3-binding sites. Conversely, the [-25, +14] and [-46, +14] (PR1mut) constructs with the SP1/SP3-binding site missing and mutated, respectively, were not induced by mild hypoxia. Although they retained inducibility by hypoxia-mimic, this was considerably lower compared with constructs containing an SP1/SP3-binding site. These results lend themselves to the following conclusions: (a) the [-36, +14] fragment contains a functional SP1/SP3 site; and (b) the SP1/SP3 binding is absolutely required for induction by mild hypoxia. Even under conditions of true hypoxia, induction of the promoter fragments with SP1/SP3-binding sites (the [-46, +14] and SP1HRE constructs) was much more efficient as opposed to the ones lacking the SP1/SP3-binding site (the [-25, +14] and [-46, +14] [PR1mut] constructs). Induction of the constructs without SP1/SP3-binding site was only slightly higher than the [-46, +14] (HREmut) construct with disrupted HIF-1 binding. Therefore, SP1/SP3 potently enhances the true hypoxia-stimulated response from HRE.
The CA9 promoter lacks a TATA box, and it is GC rich (21) . Clusters of SP1-binding sites in the proximity of the transcription start site appear to be typical of the TATA-less promoters (22) . Earlier studies indicated that SP1 was responsible for recruiting the TATA-binding protein (23) and fixing the transcriptional start site at TATA-less promoters (22) . These findings, together with the fact that SP1 sites are found in the promoters of many housekeeping genes, led to the widely held notion that SP1 acts as a basal transcription factor and that SP1 sites represent constitutive promoter elements that support basal transcription at these elements (24) . More recently, however, it was realized that transcription from SP1 sites may be more complex than first envisioned, because these elements have been found to be involved in regulation of many processes, e.g., tissue-specific gene expression, response to oncogenes, growth stimulation, and differentiation (Ref. 24 and references therein).
The strong requirement of CAIX expression and CA9 promoter activity on SP1/SP3 raised questions about the possible regulation of SP1/SP3 activity in the process of true and mild hypoxic induction of CAIX. Previously, we failed to detect any changes with respect to SP1/SP3 activity in dense and sparse HeLa cultures; the EMSA indicated identical binding to PR1 and PR5 (12) , and Western blotting with SP1 and SP3 Abs provided the same profile.5 Apparently, in the process of cell density-induced CAIX expression, the activity of the PR1 and PR5-binding factors remains constitutive. Similarly, we were unable to reveal any differences in PR1 and PR5 binding in NE prepared from control and hypoxia-mimic-treated HeLa cells.5 The conclusion that SP1/SP3 activity is not subject to regulation by hypoxia-mimic is supported by another study (25) . Therefore, we conclude that the induction of CA9 transcription by true or mild hypoxia is not associated with appreciable changes in either SP1/SP3 binding to PR1 and PR5 or SP1/SP3 activity. Rather, we propose that SP1/SP3 act as essential and necessary, but not sufficient, constitutive factors providing a platform for an inducible Factor X that will subsequently recruit the transcriptional machinery.
There is the formal possibility that SP1 may be required in the truncated promoter to fix the transcriptional start site (24) . However, this is unlikely because we see the same requirement for SP1 in the context of a promoter construct containing a TATA box.5
Regulation of another hypoxia-inducible gene, the VEGF shares apparent similarities with CA9. Both VEGF and CA9 genes possess SP1/SP3-binding sites close to the transcription start site (Ref. 26
and this study) and functional HREs (4
, 27)
. However, in addition to the differences between the relative position of HRE (immediately upstream of the transcription start in CA9 and
1 kb upstream of the transcription start site in VEGF), there is a clear-cut difference in the role of HRE in each gene. Although transcription from the CA9 promoter is critically dependent on the presence of both HRE and the proximal SP1/SP3-binding PR1 (Ref. 8
; this study), VEGF HRE is dispensable for transcriptional activity, and it is required only for enhancement of transcriptional activation under conditions of true hypoxia (26)
. The outlined differences manifest in a relatively high constitutive transcription from the VEGF promoter, resulting in a moderate (compared with CA9) hypoxic induction. Consequently, despite apparent analogies, there is a distinction between these two genes, and the highly specific induction of CA9 may be the result of a novel type of cooperation between SP1/SP3 and HIF1 factors attributable to the juxtaposed corresponding binding sites in the CA9 promoter.
In Fig. 6
, we propose a model describing activation of transcription from the CA9 promoter under various conditions. A key component of the transcription complex is the putative cofactor X. Among the transcription factors playing a role in this process, activity of the SP1/SP3 factors is constitutive, whereas activities of HIF-1 and Factor X are regulated by a combination of cell density-induced PI3-K activation and lowered oxygen tension, resulting in stabilization of HIF-1
. Under normoxic conditions, the CA9 promoter is in the basal state; in the absence of Factor X and the presence of a minimal amount of HIF-1, SP1/SP3 factors are unable to initiate transcription on their own. Under conditions of high cell density (mild hypoxia), the presence of inducible Factor X, complexing with SP1/SP3 and HIF-1, initiates transcription even without a concomitant increase in the level of HIF-1
subunit. Under conditions of true hypoxia and low cell density, in the absence of Factor X, transcription is driven primarily by enhanced activity of HIF-1 attributable to HIF-1
stabilization. The maximal transcriptional activity is achieved under conditions of true hypoxia at high cell density; HIF-1
stabilization leads to increased HIF-1 activity that cooperates with SP1/SP3 and Factor X in recruiting the transcriptional machinery. It should be noted that there is a requirement for interaction between SP1, HRE, and Smad 3, as a coactivator, for transcriptional activation of the endoglin promoter (28)
. In our own studies, we have eliminated Smad 3/4 as a candidate for Factor X.5
Experiments designed to reveal the identity of the putative inducible Factor X are under way.
|
and increased HIF-1 activity), as well as of mild hypoxia (intermediate O2 tension that is not associated with HIF-1
stabilization). This type of enhancer could be useful in targeting expression to tumor regions with varying degrees of hypoxia.
| FOOTNOTES |
|---|
1 Supported by a grant from the California Cancer Research Program (00-00789V-20240) and The Avon Foundation. ![]()
2 S. K. and M. K. contributed equally to this work. ![]()
3 To whom requests for reprints should be addressed, at Department of Microbiology and Molecular Genetics, Medical Science I B210, University of California at Irvine, College of Medicine, CA 92697-4025. Phone: (949) 824-7024; Fax: (949) 824-8598; E-mail: ejstanbr{at}uci.edu ![]()
4 The abbreviations used are: CAIX, carbonic anhydrase IX; AP-1, activator protein; Ab, antibody; CA9, carbonic anhydrase 9; DFO, desferrioxamine mesylate; EMSA, electrophoretic mobility shift assay; HIF-1, hypoxia-inducible factor 1; HRE, hypoxia-response element; MMA, mithramycin A; NE, nuclear extract; PI3-K, phosphatidylinositol 3'-kinase; PR, protected region; RCE, retinoblastoma control element; SP, specificity protein; pRL-CMV, Renilla luciferase-cytomegalovirus immediate early enhancer-promoter; VEGF, vascular endothelial growth factor; VHL, von Hippel-Lindau. ![]()
5 S. Kaluz, unpublished observations. ![]()
Received 11/ 1/02. Accepted 1/16/03.
| REFERENCES |
|---|
|
|
|---|
stabilization: a role for phosphatidylinositol 3'-kinase. Cancer Res., 62: 4469-4477, 2002.
in rat and human prostate cancer. Cancer Res., 58: 5280-5284, 1998.
R., Pastoreková S., Gibadulinová A., Dequiedt F., Kettmann R., Pastorek J. Transcriptional regulation of the MN/CA 9 gene coding for the tumor-associated carbonic anhydrase IX. Identification and characterization of a proximal silencer element. J. Biol. Chem., 274: 32588-32595, 1999.
R., Pastoreková S., Zelník V., Gibadulinová A., Stanbridge E. J., Závada J., Kettmann R., Pastorek J. Human MN/CA9 gene, a novel member of the carbonic anhydrase family: structure and exon to protein domain relationships. Genomics, 33: 480-487, 1996.[Medline]
in human glioma cells. J. Biol. Chem., 271: 28220-28228, 1996.This article has been cited by other articles:
![]() |
C. J. Yeom, J.-K. Chung, J. H. Kang, Y. H. Jeon, K. I. Kim, Y. N. Jin, Y. M. Lee, J. M. Jeong, and D. S. Lee Visualization of Hypoxia-Inducible Factor-1 Transcriptional Activation in C6 Glioma Using Luciferase and Sodium Iodide Symporter Genes J. Nucl. Med., September 1, 2008; 49(9): 1489 - 1497. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Salnikow, O. Aprelikova, S. Ivanov, S. Tackett, M. Kaczmarek, A. Karaczyn, H. Yee, K. S. Kasprzak, and J. Niederhuber Regulation of hypoxia-inducible genes by ETS1 transcription factor Carcinogenesis, August 1, 2008; 29(8): 1493 - 1499. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Y. Jiang, B. A. Woda, B. F. Banner, G. F. Whalen, K. A. Dresser, and D. Lu Sp1, a New Biomarker That Identifies a Subset of Aggressive Pancreatic Ductal Adenocarcinoma Cancer Epidemiol. Biomarkers Prev., July 1, 2008; 17(7): 1648 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, and E. J. Stanbridge Proteasomal Inhibition Attenuates Transcriptional Activity of Hypoxia-Inducible Factor 1 (HIF-1) via Specific Effect on the HIF-1{alpha} C-Terminal Activation Domain Mol. Cell. Biol., August 1, 2006; 26(15): 5895 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mizukami, K. Fujiki, E.-M. Duerr, M. Gala, W.-S. Jo, X. Zhang, and D. C. Chung Hypoxic Regulation of Vascular Endothelial Growth Factor through the Induction of Phosphatidylinositol 3-Kinase/Rho/ROCK and c-Myc J. Biol. Chem., May 19, 2006; 281(20): 13957 - 13963. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ferrandina, G. F. Zannoni, E. Martinelli, A. Paglia, V. Gallotta, S. Mozzetti, G. Scambia, and C. Ferlini Class III {beta}-Tubulin Overexpression Is a Marker of Poor Clinical Outcome in Advanced Ovarian Cancer Patients. Clin. Cancer Res., May 1, 2006; 12(9): 2774 - 2779. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Adhikary, J. F. Crish, R. Gopalakrishnan, F. Bone, and R. L. Eckert Involucrin Expression in the Corneal Epithelium: An Essential Role for Sp1 Transcription Factors Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3109 - 3120. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sobhanifar, C. Aquino-Parsons, E. J. Stanbridge, and P. Olive Reduced Expression of Hypoxia-Inducible Factor-1{alpha} in Perinecrotic Regions of Solid Tumors Cancer Res., August 15, 2005; 65(16): 7259 - 7266. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mozzetti, C. Ferlini, P. Concolino, F. Filippetti, G. Raspaglio, S. Prislei, D. Gallo, E. Martinelli, F. O. Ranelletti, G. Ferrandina, et al. Class III {beta}-Tubulin Overexpression Is a Prominent Mechanism of Paclitaxel Resistance in Ovarian Cancer Patients Clin. Cancer Res., January 1, 2005; 11(1): 298 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bhattacharya, K. Toth, R. Mazurchuk, J. A. Spernyak, H. K. Slocum, L. Pendyala, R. Azrak, S. Cao, F. A. Durrani, and Y. M. Rustum Lack of Microvessels in Well-Differentiated Regions of Human Head and Neck Squamous Cell Carcinoma A253 Associated with Functional Magnetic Resonance Imaging Detectable Hypoxia, Limited Drug Delivery, and Resistance to Irinotecan Therapy Clin. Cancer Res., December 1, 2004; 10(23): 8005 - 8017. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Robertson, C. Potter, and A. L. Harris Role of Carbonic Anhydrase IX in Human Tumor Cell Growth, Survival, and Invasion Cancer Res., September 1, 2004; 64(17): 6160 - 6165. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaluzova, S. Kaluz, M. I. Lerman, and E. J. Stanbridge DNA Damage Is a Prerequisite for p53-Mediated Proteasomal Degradation of HIF-1{alpha} in Hypoxic Cells and Downregulation of the Hypoxia Marker Carbonic Anhydrase IX Mol. Cell. Biol., July 1, 2004; 24(13): 5757 - 5766. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Miki, M. Ikuta, and T. Matsui Hypoxia-induced Activation of the Retinoic Acid Receptor-related Orphan Receptor {alpha}4 Gene by an Interaction between Hypoxia-inducible Factor-1 and Sp1 J. Biol. Chem., April 9, 2004; 279(15): 15025 - 15031. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mizukami, J. Li, X. Zhang, M. A. Zimmer, O. Iliopoulos, and D. C. Chung Hypoxia-Inducible Factor-1-Independent Regulation of Vascular Endothelial Growth Factor by Hypoxia in Colon Cancer Cancer Res., March 1, 2004; 64(5): 1765 - 1772. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Pantuck, G. Zeng, A. S. Belldegrun, and R. A. Figlin Pathobiology, Prognosis, and Targeted Therapy for Renal Cell Carcinoma: Exploiting the Hypoxia-Induced Pathway Clin. Cancer Res., October 15, 2003; 9(13): 4641 - 4652. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |