Cancer Research Annual Meeting 2010  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, A. K.
Right arrow Articles by Recio, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, A. K.
Right arrow Articles by Recio, L.
[Cancer Research 63, 929-935, March 1, 2003]
© 2003 American Association for Cancer Research


Carcinogenesis

Genetic Susceptibility to Benzene-induced Toxicity

Role of NADPH: Quinone Oxidoreductase-11

Alison K. Bauer2, Brenda Faiola, Diane J. Abernethy, Rosemarie Marchan, Linda J. Pluta, Vicki A. Wong, Kay Roberts, Anil K. Jaiswal, Frank J. Gonzalez, Byron E. Butterworth, Susan Borghoff, Horace Parkinson, Jeffrey Everitt and Leslie Recio

CIIT Centers for Health Research, Research Triangle Park, North Carolina 27709 [A. K. B., B. F., D. J. A., R. M., L. J. P., V. A. W., K. R., B. E. B., S. B., H. P., J. E., L. R.]; Baylor College of Medicine, Houston, Texas 77030 [A. K. J.]; and National Cancer Institute, Bethesda, Maryland 20892 [F. J. G.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Enzymes that activate and detoxify benzene are likely genetic determinants of benzene-induced toxicity.NAD(P)H: quinone oxidoreductase-1 (NQO1) detoxifies benzoquinones, proposed toxic metabolites of benzene. NQO1 deficiency in humans is associated with an increased risk of leukemia, specifically acute myelogenous leukemia, and benzene poisoning. We examined the importance of NQO1 in benzene-induced toxicity by hypothesizing that NQO1-deficient (NQO1-/-) mice are more sensitive to benzene than mice with wild-type NQO1 (NQO1+/+; 129/Sv background strain). Male and female NQO1-/- and NQO1+/+ mice were exposed to inhaled benzene (0, 10, 50, or 100 ppm) for 2 weeks, 6 h/day, 5 days/week. Micronucleated peripheral blood cells were counted to assess genotoxicity. Peripheral blood counts and bone marrow histology were used to assess hematotoxicity and myelotoxicity. p21 mRNA levels in bone marrow cells were used as determinants of DNA damage response. Female NQO1-/- mice were more sensitive (6-fold) to benzene-induced genotoxicity than the female NQO1+/+ mice. Female NQO1-/- mice had a 9-fold increase (100 versus 0 ppm) in micronucleated reticulocytes compared with a 3-fold increase in the female NQO1+/+ mice. However, the induced genotoxic response in male mice was similar between the two genotypes (>=10-fold increase at 100 ppm versus 0 ppm). Male and female NQO1-/- mice exhibited greater hematotoxicity than NQO1+/+ mice. p21 mRNA levels were induced significantly in male mice (>10-fold) from both strains and female NQO1-/- mice (> 8-fold), which indicates an activated DNA damage response. These results indicate that NQO1 deficiency results in substantially greater benzene-induced toxicity. However, the specific patterns of toxicity differed between the male and female mice.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Benzene is one of the few known etiological factors identified for acute myelogenous leukemia in humans (1) , and is associated with a spectrum of lympho-hematopoietic cancers in humans and mice (2, 3, 4) . Potential for exposure to benzene in the workplace can be high in certain industries, such as the production of paint and organic chemicals (5) . Environmental benzene exposures can also occur from gasoline and cigarette smoke (6 , 7) . A better understanding of the mechanisms involved in benzene-induced hematotoxicity is essential in developing biomarkers that will identify individuals who are more genetically susceptible to benzene-induced toxicity and leukemogenesis.

Oxidation of benzene by CYP2E13 to reactive intermediates is a prerequisite of cellular toxicity (Fig. 1Citation ; Ref. 8 ). Mice deficient in CYP2E1 activity developed no benzene-induced myelotoxicity or hematotoxicity (9) . Several groups have hypothesized that hydroquinone and catechol, benzene metabolites, are converted by bone marrow myeloperoxidase to reactive quinones (1,4-BQ and 1,2-BQ, respectively; Refs. 8 , 10 ). 1,4- and 1,2-BQ can be detoxified back to HQ and catechol, respectively, by NQO1 (DT-diaphorase; E.C. 1.6.99.2). NQO1 is a 2- or 4-electron reductase that maintains quinones and their derivatives in a reduced state where they can more readily be conjugated and excreted (11) . Therefore, the activity of NQO1 in the bone marrow is likely a key genetic determinant of benzene-induced hematotoxicity (12) .



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Benzene metabolism in the liver and bone marrow. Benzene metabolism in the liver by CYP2E1 is followed by several possible routes of metabolism (11 , 14) . NQO1 detoxifies the BQs in the bone marrow to the less toxic metabolites, hydroquinone and catechol. BQ, benzoquinone; DH, benzene dihydrodiol dehydrogenase; EH, microsomal epoxide hydrolase; MPO, myeloperoxidase. This diagram is greatly simplified and does not contain the entire metabolic pathway for benzene, which includes any Phase II metabolism of benzene.

 
An NQO1 polymorphism at position 609 in exon 6 (C->T) in the human NQO1 gene results in a proline to serine substitution at position 187 in the amino acid structure of the NQO1 protein, resulting in a complete loss of protein and enzyme activity. The NQO1 polymorphism frequency varies among ethnic groups, for example, 4% in Caucasians versus 22% in Chinese (12) . Individuals heterozygous or homozygous for the NQO1 polymorphism have an increased risk of developing benzene poisoning and de novo acute leukemias in adults and children, including acute myelogenous leukemia and acute lymphoblastic leukemia (13, 14, 15) .

Mice with a specific deletion of NQO1 (NQO1-/-) can be used to directly test the role of this enzyme in the detoxification of benzene. NQO1-/- mice have a portion of intron 5 and all of exon 6 of the NQO1 gene deleted, the same region where NQO1 polymorphisms in humans are found (16) . From birth to 5 weeks of age, no spontaneous histopathological differences occur between the NQO1-/- and NQO1+/+ mice. However, as the NQO1-/- mice age, they develop spontaneous myelogenous hyperplasias (17) . The NQO1-/- mice demonstrated increased menadione toxicity and had an increased susceptibility to polycyclic aromatic hydrocarbon [both benzo(a)pyrene- and 7,12-dimethylbenz(a)anthracene]-induced mouse skin carcinogenesis compared with NQO1+/+ mice (16 , 18) . These findings suggest a protective role for NQO1 in protection against quinone toxicity and carcinogenesis.

In the present study, we examined the importance of NQO1 in benzene-induced toxicity using mice deficient in NQO1 (NQO1-/-) protein expression and activity (16) . Our overall hypothesis is that NQO1-/- mice are more susceptible to benzene-induced toxicity than NQO1+/+ mice because of decreased detoxification of benzene quinone metabolites. We observed that a lack of NQO1 in male mice increases benzene-induced hematotoxicity but not genotoxicity or the DNA damage response. However, NQO1 appears critical in female mice for detoxifying the metabolites of benzene responsible for genotoxicity, hematotoxicity, and induction of the DNA damage response.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animal Husbandry
Mouse Husbandry and Genotyping.
The NQO1-/- and NQO1+/+ mice were originally obtained from Radjendirane et al. (16) and Peters et al. (19) . A detailed description of the generation of NQO1-/- mice is in Ref. 16 . We maintained a pathogen-free NQO1-/- colony and a 129/Sv (NQO1+/+) colony under identical husbandry and environmental conditions in the animal facility at the CIIT Centers for Health Research. All of the animal use was conducted in facilities accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care and approved by the CIIT Animal Care and Use Committee. Mice were housed in shoe-box cages in a humidity- and temperature-controlled room, and provided water and pelleted open-formula rodent diet NIH-07 (Zeigler Brothers, Gardners, PA.) ad libitum. The mice were brother-sister mated and the offspring then genotyped for NQO1.

After sequencing intron 5 (data not shown), we developed NQO1+/+-specific primers in the region of intron 5 deleted in the NQO1-/- mice for genotyping: NQO1D1 (forward), tggagaggcagacaaatgcgca; NQO1D2 (reverse), cctgggaattgacacgggtctt. Primers specific to the neomycin cassette were used for genotyping NQO1-/- mice: NEOD1 (forward), gtactcggatggaagccggtct; NEOD2 (reverse), aatatcacgggtagccaacgct (20) . These primer sets were used in a multiplex PCR reaction [10x PCR buffer without MgCl2 (Applied Biosystems, Foster City, CA), 2.5 mM MgCl2, 200 µM deoxynucleoside triphosphates, 100 pmol/rxn NQO1D primers, 50 pmol/rxn NEOD primers, and 1.25 units AmpliTaq-gold] under these conditions: 94°C for 10 min, 30 cycles of 94°C for 1 min followed by 62°C for 1 min, and 62°C for 5 min. A 2% agarose ethidium bromide gel was run followed by analysis (Alpha Innotech Imaging System, San Leandro, CA). The NQO1+/+ primers produced a 208-bp product, and the NQO1-/- primers produced a 250-bp product, allowing identification of each mouse (Fig. 2)Citation .



View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Genotyping NQO1-/- mice. Agarose gel demonstrating the NQO1+/+ fragment (208 bp) and the NQO1-/- fragment (250 bp). Lane 1 is the DNA size marker (Amplisize; BIO-RAD). Lane 2 is an NQO1+/+ mouse. Lane 3 is a NQO1+/- mouse (with both fragments). Lanes 4–8 are NQO1-/- mice.

 
Experimental Animals.
Male and female mice 10–12 weeks old were used for this study. The mice were housed in shoe-box cages until they were moved to stainless-steel wire mesh cages in a Hinners-style whole-body inhalation chamber 2 weeks before the start of the benzene exposures. During this 2-week acclimation period and the exposure period, the mice were put on a reversed light schedule (on at 1 a.m. and off at 1 p.m.), with exposures taking place during the light cycle. Only water was given during the exposures. Tissues were collected within 5 h after termination of exposure. Each exposure group including air-exposed controls was housed in a separate inhalation chamber. Mice used in the basal CYP2E1 experiment were not housed in suspended wire cages but remained in polycarbonate shoe-box caging.

PNP Hydroxylase Activity and CYP2E1 Protein Expression
Microsomes were prepared from livers excised from mice using differential centrifugation according to the method described by Guengerich (21) . Briefly, livers were removed from naive male and female mice, homogenized in buffer A [0.154 M KCl and 0.05 M Tris Base (Sigma, St. Louis, MO; pH 7.4)], centrifuged at 10,000 x g for 20 min at 4°C followed by centrifugation of the supernatant at 105,000 x g for 60 min at 4°C. The pellet was resuspended in 7 ml of buffer B [0.05 M Tris, 0.25 M sucrose, 1 mM EDTA (Sigma; pH 7.4)], centrifuged at 105,000 x g for 60 min at 4°C, resuspended in buffer C [0.1 M K2HPO4 and 0.25 M sucrose (pH 7.4)] and frozen at -80°C until additional use.

PNP hydroxylase activity was used as a measure of CYP2E1 activity and was determined by a spectrophotometric assay (22) . Incubation mixtures that contained 0.1 M potassium phosphate buffer, 0.1 mM PNP, 1.0 mM ascorbate, and 0.4 mg/ml liver microsomal protein were preincubated for 3 min at 37°C before the addition of 1 mM NADPH. In control incubation mixtures, NADPH was replaced with an equivalent amount of deionized H2O. The total incubation volume was 1 ml. The incubation was performed for 7.5 min at 37°C in a shaking water bath and terminated by adding 0.2 ml of 1.5 N perchloric acid. The sample was diluted 10:1 with 10 N NaOH, and the absorbance was measured at 546 nm on a Beckman DU 650 spectrophotometer (Fullerton, CA). The concentration of 4-nitrocatechol was determined using an extinction coefficient of 10.28 cm2/mol (22) .

For immunoblots, 8 µg of microsomal protein per sample was electrophoresed on a 10% polyacrylamide SDS-PAGE gel and transferred onto Immobilon-P Transfer membrane (Millipore, Bedford, MA). Primary polyclonal rat CYP2E1 antibody (1:1000; Gentest, Woburn, MA) in 0.5% milk in PBS was incubated overnight at 4°C, washed in 1% milk plus 0.1% Tween 20, followed by incubation in an antigoat-horseradish peroxidase antibody (1:20,000; Santa Cruz Biotechnologies, Santa Cruz, CA) in 0.5% milk in PBS. More washes were done, and the signal detected using West Pico Chemiluminescence (Pierce Endogen, Rockford, IL). Densitometry was done using the BIO-RAD Quantity One Quantitation software (Version 4).

Experimental Design
This study used three benzene exposure groups (10, 50, and 100 ppm benzene) and one control unexposed group (0 ppm). Exposure levels were chosen based on toxicity in a pilot study using 0, 10, and 100 ppm benzene exposure levels (data not shown). Mice were exposed to benzene for 6 h/day, 5 days/week for 2 weeks, for all of the experiments based on previous studies (3 , 23) . A previous time course study conducted in male 129/SvJ (The Jackson Laboratory) mice demonstrated that the optimal sampling time point was immediately after exposure for determining peak levels of MN-RET (immature RBC) and p21 mRNA expression relative to 12 or 24 h after exposure (data not shown).

After termination of exposure and chamber off-gassing, mice were euthanized with an i.p. injection of 5 mg pentobarbital/mouse (Abbott Laboratories, Chicago, IL). Blood was collected by cardiac puncture in microcontainers (Becton Dickinson, San Jose, CA) containing EDTA for WBC counts that were counted on an Advia 120 Hematology System (Bayer Diagnostics, Tarrytown, NY) by Antech Diagnostics (New York, NY). Additional blood was collected for MN analysis. Femurs were then removed, and the marrow cavity was flushed with RNA later (Ambion, Austin, TX) and kept at 4°C until processing occurred (<=6 weeks). The sternum, spleen, thymus, liver, lymph nodes, and lung were also collected for fixation and histopathological evaluation.

Benzene Exposure
Benzene exposure methods have been described in detail (23) . Benzene (Sigma) purity was assessed before inhalation by the CIIT inhalation facility, and all of the benzene exposures were controlled by an Andover Infinity system (Andover Controls Corp., Andover, MA). Benzene exposure atmospheres were measured at least six times per exposure with infrared spectrophotometers (MIRAN 1A; The Foxboro Co., Foxboro, MA). The chambers were operated with a continuous flow of HEPA-filtered air at ~1800 liters/min. Control mice (0 ppm) were exposed to a continuous flow of conditioned HEPA-filtered air in inhalation chambers.

MN Analysis in Blood Using a Flow Cytometric Method
The enumeration of MN is a measure of genotoxicity (24) . The Prototype Microflowplus Mouse Micronucleus Analysis kit and protocol (Litron Laboratories, Rochester, NY) were used to evaluate the MN-RET and MN-NCE in mouse blood using malaria-infected cells as a reference standard to consistently define the micronucleus analysis windows, and to establish daily proper photomultiplier tubes voltages and compensation (25) . Briefly, 50 µl of blood were collected and prepared for the determination of MN in RBCs as described (Litron Laboratories). Malaria-infected cells were used to define gating windows and PMT settings for detection by flow cytometry (25) . Nucleated cells in the peripheral blood other than the RET and NCE were gated out. MNs were defined as propidium iodide-positive cells, RETs were identified using specific antibody (CD-71) as CD71-positive cells, and NCEs were identified as CD71-negative cells. CD71 is only expressed in RETs (26) . In an initial pilot study, the MNs were also assessed in the bone marrow by manual counts of acridine-orange stained cytospins of bone marrow cells. The percentage of MN-RET in the bone marrow manual counts was not different from in the blood by flow cytometry.

Histopathology
After necropsy, thymus, sternum, spleen, liver, lymph nodes, and fixative-infused lungs were placed into 10% neutral buffered formalin (Fisher, Fair Lawn, NJ) for 48 h. Sternal tissues were decalcified in 7.5% formic acid for 72 h and then processed routinely. All of the tissues were embedded in paraffin, subjected to microtomy at 4 µm, and prepared routinely for H&E (Sigma) sections. Bone marrow cellularity was assessed by evaluating five images, each representing 0.259 mm2 of marrow from each animal taken from standardized regions of mid-sternebrae marrow cavities. Images were acquired using a Spot RT digital camera (Diagnostic Instruments, Inc., Sterling Heights, MI) on a Zeiss Axioscop 2 microscope (Carl Zeiss, Inc., Thornwood, NY) using Image-Pro Plus software (Media Cybernetics, Silver Spring, MD).

Real-Time Quantitative Reverse Transcription-PCR for p21 mRNA Expression
Total RNA from bone marrow was isolated using the Qiagen RNAeasy kit (Qiagen, Valencia, CA), which includes treatment with DNase I. Reverse-transcription reactions were performed with 2 µg of total RNA using random hexamers as primers according to the Reverse Transcription kit from Applied Biosystems. The Applied Biosystems 7700 Prism Sequence Detection System using Sybr green (Applied Biosystems) was used to quantify p21 mRNA levels by PCR using specific primers (27) . PCR reaction conditions and data analysis were performed according to the manufacturer’s recommended protocol (User bulletin no. 2, Applied Biosystems Prism 7700 Sequence Detection System). All of the samples were run in triplicate using gapdh as the calibrator gene, because gapdh levels do not change across genotypes or with benzene exposure (27) .

Statistical Analysis
All of the data are presented as the mean ± SE. A three-way ANOVA was done on each variable with the three main effect factors of gender, strain, and exposure level, and their first order interactions. If any of the interactions were significant, additional analyses were done so that the nature of the interaction could be understood. Tukey’s multiple comparison procedure was used to determine differences among significant factors with three or more levels. P < 0.05 was used as the level of significance for all of the statistical tests. A Pearson correlation coefficient was calculated for the two variables, MN-RET percentages and p21 mRNA fold-increases. Statistical analyses were done using SAS Statistical Software (SAS Institute, Inc., Cary, NC).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Comparison of Basal CYP2E1 Activity and Protein Expression in Liver Microsomes.
To assess any differences in response between the NQO1-/- and NQO1+/+ mice exposed to benzene, the basal CYP2E1 levels were determined for the two strains. PNP activity as a measure of CYP2E1 activity was significantly lower in both genders in the NQO1-/- versus NQO1+/+ mice, whereas CYP2E1 protein expression in the two strains in either gender was not significantly different (Table 1)Citation . Therefore, differences because of CYP2E1 levels between NQO1-/- and NQO1+/+ mice would not be expected to play a role in any differences seen with respect to benzene.


View this table:
[in this window]
[in a new window]

 
Table 1 Basal levels of CYP2E1 activity and protein content in NQO1+/+ versus NQO1-/- mice in both genders

 
Genotoxicity in Mice Exposed to Inhaled Benzene.
The frequency of MN RBC was determined in mice exposed to 0, 10, 50, or 100 ppm benzene. An exposure-dependent increase in MN-RET occurred in both male NQO1-/- and NQO1+/+ mice; at 100 ppm inhaled benzene induced >10-fold increase in MN-RET. However, no significant differences between the two genotypes were seen at any of the exposure levels (Fig. 3A)Citation . Similarly, significant increases in MN-NCE occurred only at the 100-ppm exposure level, although no biologically significant differences were seen between the two genotypes of male mice (Fig. 3B)Citation . The difference in the degree of the response between the MN-RET and the MN-NCE is likely because of the short exposure period (2 weeks), which is not sufficient for maturation of RET to NCE.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A comparison of benzene-induced MN in RET and NCE populations in the peripheral blood of NQO1+/+ versus NQO1-/- mice. A, percentage of MN-RET in male NQO1+/+ and NQO1-/- mice. B, MN-RET in female NQO1+/+ and NQO1-/- mice. C, MN-NCE in male NQO1+/+ and NQO1-/- mice. D, MN-NCE in female NQO1+/+ and NQO1-/- mice. Data represent mean (n = 5 per strain, gender, and exposure level and was repeated twice); bars, ±SE. * indicates significant differences from unexposed mice (0 ppm; P < 0.05); + indicates significant differences between NQO1+/+ and NQO1-/- mice (P < 0.05).

 
There was no exposure-dependent increase in MN-RET or MN-NCE in female NQO1+/+ mice (Fig. 3, C and D)Citation . In contrast, female NQO1-/- mice exhibited an exposure-dependent increase in MN in both populations of cells similar to the increases seen in the male mice (Fig. 3, C and D)Citation . The difference in MN-RET response between 0 and 100 ppm in the female NQO1-/- mice constitutes a 9-fold-increase over unexposed mice compared with a 3-fold-increase over unexposed mice in the female NQO1+/+ mice. In addition, male NQO1+/+ mice were significantly more sensitive than female NQO1+/+ mice in MN responsiveness to inhaled benzene, as reported by others previously (28, 29, 30, 31) .

Analysis of Hematotoxicity and Myelotoxicity Levels in Mice Exposed to Benzene.
Benzene-induced hematotoxicity results in a decrease in total WBC counts and bone marrow cellularity (3 , 32) . We examined these parameters in the NQO1-/- versus the NQO1+/+ mice. Male NQO1-/- mice exhibited significant hematotoxicity at a lower benzene exposure level (50 ppm) than male NQO1+/+ mice (Fig. 4A)Citation . At the 100 ppm level, both strains, NQO1+/+ and NQO1-/-, developed hematotoxicity compared with unexposed mice but did not different from each another. In female mice, the NQO1-/- mice were also significantly more sensitive to benzene-induced hematotoxicity at the 50 and 100 ppm levels compared with the NQO1+/+ mice (Fig. 4B)Citation .



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Hematology in the peripheral blood of NQO1+/+ versus NQO1-/- mice after exposure to inhaled benzene. A, total numbers of WBCs in the peripheral blood in male NQO1+/+ and NQO1-/- mice. B, total numbers of WBCs in the peripheral blood in female NQO1+/+ and NQO1-/- mice. Data represent one experiment and are the means (n = 7) per strain, gender, and exposure level; bars, ±SE. This experiment was repeated twice. * indicates significant differences from unexposed mice (0 ppm; P < 0.05); + indicates significant differences between NQO1+/+ and NQO1-/- mice (P < 0.05).

 
NQO1-/- mice had slightly greater bone marrow cellularity noted in sternebrae than did NQO1+/+ mice (see Fig. 5Citation ), consistent with the myeloid hyperplasia that has been reported previously to develop spontaneously in these animals (17) . A dose-related benzene-induced bone marrow hypoplasia was noted (Fig. 6)Citation . Marrow cellularity was diminished with no discernible effects on specific cell lineages evaluable on histopathology. Lesions were noted in sternal marrows of male NQO1+/+ and NQO1-/- mice, and in female NQO1-/- mice exposed to 100 ppm of benzene. Diminution of cellularity was not noted in lower benzene exposure concentration groups. No compound-induced histopathological lesions were noted in spleen, thymus, liver, lung, or lymph node tissues that were evaluated.



View larger version (116K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Histopathology of NQO1+/+ and NQO1-/- sternums. A, bone marrow from control (air-exposed) female NQO1+/+ mouse depicting normal cellularity of midsternal sternebrae. B, bone marrow from control (air-exposed) female NQO1-/- mouse showing increased cellularity compared with A believed to represent spontaneous myeloid hyperplasia associated with NQO1 deficiency. C, hypocellular marrow from sternebrae of female NQO1-/- mouse exposed to 100 ppm benzene for 14 days. H&E stained. Bar = 50 µM.

 


View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Image analysis of sternums from NQO1+/+ and NQO1-/- mice from both genders. A, quantitation of total cellularity in sternums of female NQO1+/+ and NQO1-/- mice. B, quantitation of total cellularity in sternums of male NQO1+/+ and NQO1-/- mice. Data represent mean and n = 5 mice per group; bars, ±SE. * indicates significant differences from unexposed mice (0 ppm; P < 0.05); + indicates significant differences between NQO1+/+ and NQO1-/- mice (P < 0.05).

 
Assessment of a DNA Damage Response in Mice Exposed to Benzene.
When DNA is damaged, p53 is activated to transcribe several genes, such as p21, a cyclin-dependent kinase inhibitor that can lead to cell cycle arrest (33 , 34) . Previously, our laboratory and others demonstrated that p21 is highly expressed in the bone marrow in response to benzene (27 , 35) . We quantified bone marrow p21 mRNA levels in both the male and female mice (Fig. 7)Citation . In male mice from both genotypes, there was a >10-fold increase in expression of p21 mRNA levels at 100 ppm of benzene compared with unexposed mice (Fig. 7A)Citation ; however, no significant differences were seen between the two genotypes. Female NQO1-/- mice also had a significant induction of p21 mRNA compared with female NQO1+/+ mice (Fig. 7B)Citation .



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. p21 mRNA expression in bone marrow of NQO1+/+ and NQO1-/- mice exposed to benzene. A, quantitative analysis of p21 mRNA levels in male NQO1+/+ and NQO1-/- mice. The Y-axis represents the fold change in the p21 expression relative to unexposed (0 ppm) bone marrow cells. B, quantitative analysis of p21 mRNA levels in female NQO1+/+ and NQO1-/- mice. Data represent mean (n = 3 for 0 ppm; n = 4 for 10 and 50 ppm; n = 6 for 100 ppm) from one experiment; bars, ±SE. This experiment was repeated twice. * indicates significant differences from unexposed mice (0 ppm; P < 0.05); + indicates significant differences between NQO1+/+ and NQO1-/- mice (P < 0.05).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Benzene has long been recognized as a human health concern, because several groups demonstrated that individuals occupationally exposed to benzene were at a much higher risk of developing leukemias than the normal population (36, 37, 38, 39) . Whereas the exact metabolites responsible for the carcinogenic, hematotoxic, and genotoxic effects of benzene are uncertain, several reports discussing benzene toxicity have demonstrated that a synergy exists between combinations of benzene metabolites including phenol, HQ, catechol, and muconaldehyde, another pathway in benzene metabolism (10 , 40) . Our study demonstrates that NQO1 plays a role in benzene detoxification in mice and supports the need to assess enzymes specific for benzene metabolism to identify polymorphisms with functional consequences.

Male NQO1-/- mice were not more sensitive to the effects of benzene-induced genotoxicity or to p53-regulated DNA damage response than NQO1+/+ mice. In contrast, female NQO1-/- mice had a 6-fold higher MN response than the female NQO1+/+ mice. The hematotoxic response to benzene was dramatically altered in both male and female NQO1-/- mice. Male NQO1-/- were sensitive to hematotoxicity at lower exposure levels than male NQO1+/+ mice, and female NQO1-/- mice were susceptible to benzene-induced hematotoxicity, whereas female NQO1+/+ mice were not. The difference in responses between the male NQO1-/- and NQO1+/+ mice with respect to genotoxicity and hematotoxicity suggests that different metabolites are responsible for DNA damage (not NQO1-dependent) than those responsible for hematotoxicity (NQO1-dependent).

The shape of the dose-response curve for benzene-induced p21 mRNA levels correlated significantly with the shape of the dose-response for genotoxicity (r = 0.909; P < 0.0001). p21 mRNA levels in the male NQO1-/- and NQO1+/+ mice were both highly induced (>10-fold), whereas female NQO1-/- mice had significantly higher p21 levels than female NQO1+/+ mice. NQO1 has been shown to stabilize p53 protein in vitro (41) , and NQO1-/- mice express less p53 protein basally than their wild-type counterparts (17) . In our study, male NQO1-/- mice had a slightly lower p21 induction than the NQO1+/+ mice, which supports these other studies.

In this study, there was a >10-fold increase in MN-RET in male NQO1+/+ mice compared with female NQO1+/+ mice at the same exposure. In addition, p21 mRNA induction levels were distinctly different. Other studies have demonstrated gender differences in MN, sister chromatid exchanges, and benzene metabolism (28, 29, 30, 31) . Our data indicate that NQO1 is critical in female mice for detoxifying the benzene metabolites responsible for genotoxicity and hematotoxicity, whereas it is critical only in male mice for detoxifying metabolites responsible for hematotoxicity. These findings support the idea that benzene metabolism in mice is gender-specific and that different metabolites or metabolic pathways may be responsible for benzene-induced genotoxicity versus hematotoxicity.

Little research has been conducted in humans to determine whether gender differences in susceptibility to benzene-induced toxicity exist. Most of the epidemiological studies done to date pooled data from all of the exposure levels because of a small cohort size for women and, thus, did not analyze the effects of gender at specific exposure levels (42 , 43) . None of these epidemiology studies demonstrated a gender difference with benzene-induced toxicity. Thus far, there are no published studies assessing gender with respect to NQO1 deficiency in humans.

In conclusion, this study demonstrates the importance of NQO1 with respect to benzene-induced toxicity in mice. Epidemiology studies have linked NQO1 deficiency and an increased risk of developing benzene poisoning and leukemias in humans (13 , 14) . The increased sensitivity of NQO1 mice to benzene-induced cytotoxic and genotoxic effects combined with spontaneously developing myelogenous hyperplasias may make the NQO1-/- mice more susceptible to developing leukemias and lymphomas (17) . Whereas no gender differences have yet been ascribed to human NQO1 deficiency, our results in female mice necessitate a more detailed evaluation of the NQO1 polymorphism in humans. Additional analyses are ongoing with these mice to determine strain and gender differences with respect to benzene metabolism and response to benzene exposure.


    ACKNOWLEDGMENTS
 
We thank Jason Rose, James Mangum, Earl Tewksbury, the CIIT necropsy and histopathology unit, the animal care unit, and the CIIT inhalation unit for all of their help with this study. We also thank Dr. Barbara Kuyper for editorial review, Drs. David Dorman and Kevin Gaido for critically reviewing the manuscript, and Dennis House for statistical analysis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by National Institute of Environmental Health Sciences National Research Service Award 1F32 ES11424-01 (to A. K. B.) and NIH Grant RO1 ES07943 (to A. K. J.). Back

2 To whom requests for reprints should be addressed, at Laboratory of Pulmonary Pathobiology, E214, Building 101, National Institute of Environmental Health Sciences, 111 T. W. Alexander Drive, Research Triangle Park, NC 27709. Phone: (919) 316-4673; Fax: (919) 541-4133; E-mail: bauer1{at}niehs.nih.gov Back

3 The abbreviations used are: CYP2E1, cytochrome P4502E1; BQ, benzoquinone; MN, micronuclei; NQO1, NADPH: quinone oxidoreductase-1; NCE, normochromatic reticulocyte; RET, reticulocyte; PNP, {rho}-nitrophenol. Back

Received 8/ 8/02. Accepted 1/ 3/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sanz G. F., Sanz M. A., Vallespi T. Etiopathogeny, prognosis and therapy of myelodysplastic syndromes. Hematol. Cell Ther., 39: 277-294, 1997.[Medline]
  2. Hayes R. B., Yin S. N., Dosemeci M., Linet M. Benzene and lymphohematopoietic malignancies in humans. Am. J. Ind. Med., 40: 117-126, 2001.[Medline]
  3. Farris G. M., Robinson S. N., Gaido K. W., Wong B. A., Wong V. A., Hahn W. P., Shah R. S. Benzene-induced hematotoxicity and bone marrow compensation in B6C3F1 mice. Fundam. Appl. Toxicol., 36: 119-129, 1997.[Medline]
  4. Cronkite E. P., Drew R. T., Inoue T., Hirabayashi Y., Bullis J. E. Hematotoxicity and carcinogenicity of inhaled benzene. Environ. Health Perspect., 82: 97-108, 1989.[Medline]
  5. Ayres P. H., Taylor W. D. Solvents Hayes A. H. eds. . In Principles and Methods of Toxicology, Ed. 2 111 Raven Press Ltd. New York 1989.
  6. Runion H. E., Scott L. M. Benzene exposure in the United States 1978–1983: an overview.. Am. J. Ind. Med., 7: 385-393, 1985.[Medline]
  7. Wallace L. Major sources of exposure to benzene and other volatile organic chemicals. Risk Anal., 10: 59 1990.
  8. Smith M. T. The mechanism of benzene-induced leukemia: a hypothesis and speculations on the causes of leukemia. Environ. Health Perspect., 104(Suppl. 6): 1219-1225, 1996.
  9. Valentine J. L., Lee S. S., Seaton M. J., Asgharian B., Farris G., Corton J. C., Gonzalez F. J., Medinsky M. A. Reduction of benzene metabolism and toxicity in mice that lack CYP2E1 expression. Toxicol. Appl. Pharmacol., 141: 205-213, 1996.[Medline]
  10. Ross D. The role of metabolism and specific metabolites in benzene-induced toxicity: evidence and issues.. J. Toxicol. Environ. Health A, 61: 357-372, 2000.[Medline]
  11. Cadenas E., Hochstein P., Ernster L. Pro- and antioxidant functions of quinones and quinone reductases in mammalian cells. Adv. Enzymol. Relat. Areas Mol. Biol., 65: 97-146, 1992.[Medline]
  12. Ross D., Kepa J. K., Winski S. L., Beall H. D., Anwar A., Siegel D. NAD(P)H: quinone oxidoreductase 1 (NQO1): chemoprotection, bioactivation, gene regulation and genetic polymorphisms. Chem. Biol. Interact., 129: 77-97, 2000.[Medline]
  13. Rothman N., Smith M. T., Hayes R. B., Traver R. D., Hoener B., Campleman S., Li G. L., Dosemeci M., Linet M., Zhang L., Xi L., Wacholder S., Lu W., Meyer K. B., Titenko-Holland N., Stewart J. T., Yin S., Ross D. Benzene poisoning, a risk factor for hematological malignancy, is associated with the NQO1 609C–>T mutation and rapid fractional excretion of chlorzoxazone. Cancer Res., 57: 2839-2842, 1997.[Abstract/Free Full Text]
  14. Smith M. T., Wang Y., Kane E., Rollinson S., Wiemels J. L., Roman E., Roddam P., Cartwright R., Morgan G. Low NAD(P)H: quinone oxidoreductase 1 activity is associated with increased risk of acute leukemia in adults.. Blood, 97: 1422-1426, 2001.[Abstract/Free Full Text]
  15. Krajinovic M., Sinnett H., Richer C., Labuda D., Sinnett D. Role of NQO1. MPO and CYP2E1 genetic polymorphisms in the susceptibility to childhood acute lymphoblastic leukemia. Int. J. Cancer, 97: 230-236, 2002.[Medline]
  16. Radjendirane V., Joseph P., Lee Y. H., Kimura S., Klein-Szanto A. J., Gonzalez F. J., Jaiswal A. K. Disruption of the DT diaphorase (NQO1) gene in mice leads to increased menadione toxicity. J. Biol. Chem., 273: 7382-7389, 1998.[Abstract/Free Full Text]
  17. Long D. J., II, Gaikwad A., Multani A., Pathak S., Montgomery C. A., Gonzalez F. J., Jaiswal A. K. Disruption of the NAD(P)H:quinone oxidoreductase 1 (NQO1) gene in mice causes myelogenous hyperplasia. Cancer Res., 62: 3030-3036, 2002.[Abstract/Free Full Text]
  18. Long D. J., Waikel R. L., Wang X. J., Perlaky L., Roop D. R., Jaiswal A. K. NAD(P)H: quinone oxidoreductase 1 deficiency increases susceptibility to benzo(a)pyrene-induced mouse skin carcinogenesis.. Cancer Res., 60: 5913-5915, 2000.[Abstract/Free Full Text]
  19. Peters J. M., Cattley R. C., Gonzalez F. J. Role of PPAR {alpha} in the mechanism of action of the nongenotoxic carcinogen and peroxisome proliferator Wy-14, 643. Carcinogenesis (Lond.), 18: 2029-2033, 1997.[Abstract/Free Full Text]
  20. Beck E., Ludwig G., Auerswald E. A., Reiss B., Schaller H. Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from transposon Tn5. Gene, 19: 327-336, 1982.[Medline]
  21. Guengerich F. P. Analysis and characterization of enzymes Hayes A. W. eds. . Principles and Methods of Toxicology, 784-785, Raven Press New York 1989.
  22. Reinke L. A., Moyer M. J. p-Nitrophenol hydroxylation. A microsomal oxidation which is highly inducible by ethanol. Drug Metab. Dispos., 13: 548-552, 1985.[Abstract]
  23. Healy L. N., Pluta L. J., James R. A., Janszen D. B., Torous D., French J. E., Recio L. Induction and time-dependent accumulation of micronuclei in peripheral blood of transgenic p53+/- mice. Tg. AC (v-Ha-ras) and parental wild-type (C57BL/6 and FVB/N) mice exposed to benzene by inhalation. Mutagenesis, 16: 163-168, 2001.[Abstract/Free Full Text]
  24. MacGregor J. T., Heddle J. A., Hite M., Margolin B. H., Ramel C., Salamone M. F., Tice R. R., Wild D. Guidelines for the conduct of micronucleus assays in mammalian bone marrow erythrocytes. Mutat. Res., 189: 103-112, 1987.[Medline]
  25. Dertinger S. D., Torous D. K., Tometsko K. R. Simple and reliable enumeration of micronucleated reticulocytes with a single-laser flow cytometer. Mutat. Res., 371: 283-292, 1996.[Medline]
  26. Serke S., Huhn D. Identification of CD71 (transferrin receptor) expressing erythrocytes by multiparameter-flow-cytometry (MP-FCM): correlation to the quantitation of reticulocytes as determined by conventional microscopy and by MP-FCM using a RNA-staining dye.. Br. J. Haematol., 81: 432-439, 1992.[Medline]
  27. Boley S. E., Wong V. A., French J. E., Recio L. p53 heterozygosity alters the mRNA expression of p53 target genes in the bone marrow in response to inhaled benzene. Toxicol. Sci., 66: 209-215, 2002.[Abstract/Free Full Text]
  28. Kenyon E. M., Seeley M. E., Janszen D., Medinsky M. A. Dose-, route-, and sex-dependent urinary excretion of phenol metabolites in B6C3F1 mice. J. Toxicol. Environ. Health, 44: 219-233, 1995.[Medline]
  29. Harper B. L., Ramanujam V. M., Legator M. S. Micronucleus formation by benzene, cyclophosphamide, benzo(a)pyrene, and benzidine in male, female, pregnant female, and fetal mice. Teratog. Carcinog. Mutagen., 9: 239-252, 1989.[Medline]
  30. Luke C. A., Tice R. R., Drew R. T. The effect of exposure regimen and duration on benzene-induced bone marrow damage in mice. II. Strain comparisons involving B6C3F1, C57B1/6 and DBA/2 male mice. Mutat. Res., 203: 273-295, 1988.[Medline]
  31. Meyne J., Legator M. S. Sex-related differences in cytogenetic effects of benzene in the bone marrow of Swiss mice. Environ. Mutagen., 2: 43-50, 1980.[Medline]
  32. Ward E., Hornung R., Morris J., Rinsky R., Wild D., Halperin W., Guthrie W. Risk of low red or white blood cell count related to estimated benzene exposure in a rubberworker cohort (1940–1975). Am. J. Ind. Med., 29: 247-257, 1996.[Medline]
  33. Prives C., Hall P. A. The p53 pathway. J. Pathol., 187: 112-126, 1999.[Medline]
  34. Taylor W. R., Stark G. R. Regulation of the G2/M transition by p53. Oncogene, 20: 1803-1815, 2001.[Medline]
  35. Yoon B. I., Hirabayashi Y., Kawasaki Y., Kodama Y., Kaneko T., Kim D. Y., Inoue T. Mechanism of action of benzene toxicity: cell cycle suppression in hemopoietic progenitor cells (CFU-GM).. Exp. Hematol., 29: 278-285, 2001.[Medline]
  36. Aksoy M., Erdem S. Followup study on the mortality and the development of leukemia in 44 pancytopenic patients with chronic exposure to benzene. Blood, 52: 285-292, 1978.[Free Full Text]
  37. Aksoy M., Erdem S., DinCol G. Leukemia in shoe-workers exposed chronically to benzene. Blood, 44: 837-841, 1974.[Abstract/Free Full Text]
  38. Infante P. F., Rinsky R. A., Wagoner J. K., Young R. J. Leukaemia in benzene workers. Lancet, 2: 76-78, 1977.[Medline]
  39. Vigliani E. C., Forni A. Benzene and leukemia. Environ. Res., 11: 122-127, 1976.[Medline]
  40. Snyder R. Overview of the toxicology of benzene. J. Toxicol. Environ. Health A., 61: 339-346, 2000.[Medline]
  41. Asher G., Lotem J., Cohen B., Sachs L., Shaul Y. Regulation of p53 stability and p53-dependent apoptosis by NADH quinone oxidoreductase 1. Proc. Natl. Acad. Sci. USA, 98: 1188-1193, 2001.[Abstract/Free Full Text]
  42. Rothman N., Smith M. T., Hayes R. B., Li G. L., Irons R. D., Dosemeci M., Haas R., Stillman W. S., Linet M., Xi L. Q., Bechtold W. E., Wiemels J., Campleman S., Zhang L., Quintana P. J., Titenko-Holland N., Wang Y. Z., Lu W., Kolachana P., Meyer K. B., Yin S. An epidemiologic study of early biologic effects of benzene in Chinese workers, Environ. Health Perspect., 104(Suppl.6): 1365-1370, 1996.
  43. Yin S. N., Hayes R. B., Linet M. S., Li G. L., Dosemeci M., Travis L. B., Li C. Y., Zhang Z. N., Li D. G., Chow W. H., Wacholder S., Wang Y. Z., Jiang Z. L., Dai T. R., Zhang W. Y., Chao X. J., Ye P. Z., Kou Q. R., Zhang X. C., Lin X. F., Meng J. F., Ding C. Y., Zho J. S., Blot W. J. A cohort study of cancer among benzene-exposed workers in China: overall results.. Am. J. Ind. Med., 29: 227-235, 1996.[Medline]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
H. Zhou, J. K. Kepa, D. Siegel, S. Miura, Y. Hiraki, and D. Ross
Benzene Metabolite Hydroquinone Up-Regulates Chondromodulin-I and Inhibits Tube Formation in Human Bone Marrow Endothelial Cells
Mol. Pharmacol., September 1, 2009; 76(3): 579 - 587.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Iskander, R. J. Barrios, and A. K. Jaiswal
Disruption of NAD(P)H:Quinone Oxidoreductase 1 Gene in Mice Leads to Radiation-Induced Myeloproliferative Disease
Cancer Res., October 1, 2008; 68(19): 7915 - 7922.
[Abstract] [Full Text] [PDF]


Home page
Hum Exp ToxicolHome page
H. Ahmad Khan
Short Review: Benzene's toxicity: a consolidated short review of human and animal studies
Human and Experimental Toxicology, September 1, 2007; 26(9): 677 - 685.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
K. S. Ahn, G. Sethi, A. K. Jain, A. K. Jaiswal, and B. B. Aggarwal
Genetic Deletion of NAD(P)H:Quinone Oxidoreductase 1 Abrogates Activation of Nuclear Factor-{kappa}B, I{kappa}B{alpha} Kinase, c-Jun N-terminal Kinase, Akt, p38, and p44/42 Mitogen-activated Protein Kinases and Potentiates Apoptosis
J. Biol. Chem., July 21, 2006; 281(29): 19798 - 19808.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
Q. Lan, L. Zhang, G. Li, R. Vermeulen, R. S. Weinberg, M. Dosemeci, S. M. Rappaport, M. Shen, B. P. Alter, Y. Wu, et al.
Hematotoxicity in Workers Exposed to Low Levels of Benzene
Science, December 3, 2004; 306(5702): 1774 - 1776.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. J. Abernethy, E. V. Kleymenova, J. Rose, L. Recio, and B. Faiola
Human CD34+ Hematopoietic Progenitor Cells Are Sensitive Targets for Toxicity Induced by 1,4-Benzoquinone
Toxicol. Sci., May 1, 2004; 79(1): 82 - 89.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
B. Faiola, A. K. Bauer, E. S. Fuller, V. A. Wong, L. J. Pluta, D. J. Abernethy, J. B. Mangum, J. I. Everitt, and L. Recio
Variations in Prkdc and Susceptibility to Benzene-Induced Toxicity in Mice
Toxicol. Sci., October 1, 2003; 75(2): 321 - 332.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. K. Bauer, B. Faiola, D. J. Abernethy, R. Marchan, L. J. Pluta, V. A. Wong, F. J. Gonzalez, B. E. Butterworth, S. J. Borghoff, J. I. Everitt, et al.
Male Mice Deficient in Microsomal Epoxide Hydrolase Are Not Susceptible to Benzene-Induced Toxicity
Toxicol. Sci., April 1, 2003; 72(2): 201 - 209.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, A. K.
Right arrow Articles by Recio, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, A. K.
Right arrow Articles by Recio, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online