| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Institutes of Clinical Chemistry and Laboratory Medicine [N. T., A. B., H. S., K. A., B. B.] and Pathology [W. B., H. B.], University of Münster, 48149 Münster, Germany
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Using a standardized semiautomated method of microsatellite analysis for loss of heterozygosity detection, we identified an allelic imbalance (AI) at the egfr locus in 55 of 163 primary breast cancer cases. Fine mapping of the chromosomal region at 7p12–15 around the egfr gene using 10 CA-SSR markers showed that mutations of egfr in breast cancer are frequently restricted to the first intron of egfr. Thereby, the simple sequence repeat CA-SSR I in intron 1 was affected in 84% of the patients with AI. Reverse transcription-PCR analysis of 23 breast cancer tissues with AI excluded the presence of in-frame deletions between exon 2 and exon 7. For additional characterization of the underlying phenomenon leading to the detection of an AI in microsatellite analysis, a quantitative 5'-nuclease assay for the first CA-SSR I in intron 1 was established. In breast cancer cases with AI the presence of amplifications of this sequence was shown. Kaplan-Meier analysis revealed a statistically significant worse prognosis for patients with AI in the cancer tissue at the egfr locus compared with patients without AI. Interestingly, 75% of the patients bearing AI of CA-SSR I in the tumor also showed AI at normal, nontumorous breast tissue. Our data strongly support the assumption that distinct amplifications in intronic sequences of the egfr gene, which enhance the basic transcription activity of the gene, represent one of the first steps in breast carcinogenesis. Furthermore, they point to the presence of prognosis-associated markers for breast cancer already in morphological normal breast tissue.
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
. Overexpression of EGFR, which has been shown in a variety of tumors, resulted in cellular transformation as shown in NIH-3T3 cells (1
, 2)
. In breast cancer patients, EGFR overexpression was associated with a poor clinical outcome and no benefit from adjuvant endocrine therapy (3
, 4)
. Amplifications of egfr in breast cancer, as described for c-erbB2 (3)
, account for <5% of all breast cancer cases. Therefore, it was broadly accepted that overexpression of EGFR in breast cancer is commonly regulated on the transcriptional level. Furthermore, in a few breast cancer cases an in-frame deletion comprising exon 2 and exon 7 has been described, encoding a constitutively activated EGFR (egfr-vIII), which was found frequently in glioblastomas (5, 6, 7)
. Premature termination of transcription between exons 1 and 2 of the egfr gene occurring proximal to an enhancer region in intron 1 has been described (8) . The transcription activity of the egfr gene depends strongly on the cooperation of this enhancer in intron 1 with an enhancer sequence upstream of the transcriptional start side (9) . The enhancer in intron 1 is located in close proximity to a polymorphic CA-SSR containing 14–21 CA dinucleotides (10) . For this CA-SSR we have shown that egfr transcription is modulated in vitro and in vivo (11) . Decreasing numbers of CA dinucleotides in CA-SSR I correlated with an increased egfr transcription and EGFR protein expression (12) .
Our data indicate that CA-SSR I is the frequent target for mutations within the egfr gene in breast cancer. For the first time we show that the mutations are amplifications. Furthermore, these amplifications are likely to represent early steps in breast carcinogenesis, moreover thereby inducing a breast cancer subtype associated with poor clinical outcome. The discovery of one of the putative, first genetic hits in a subtype of breast cancer might serve as a starting point in the definition of new genetic pathways in breast cancer.
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Microsatellite PCR.
Genomic DNA was isolated from peripheral blood and fresh-frozen tumor tissue of patients with breast cancer. DNA isolation from peripheral blood was performed using the QIAamp Blood kit (Qiagen), and tumor tissue DNA was extracted using the QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s instructions. As a control for PCR fragment length DNA from the tumor cell line MDA-MB-468 was analyzed.
PCR amplification was performed using AmpliTaq DNA Polymerase (Applera) in a 25-µl reaction volume containing 200 nM of each primer, 1 x GeneAmp buffer II, 2 mM MgCl2, 100 µM of each GeneAmp deoxynucleotide triphosphate (Applera), and 20 ng of sample DNA. The primer sequences specific for microsatellite markers near the chromosomal locus of egfr on chromosome 7p are given in Table 1
. Downstream primers were labeled with a fluorescent dye (FAM). Separation was done with a four-color laser-induced fluorescence capillary electrophoresis system (ABI PRISM 310 DNA Analyser and ABI PRISM 3700 DNA Analyser). One to 2 µl of the amplified PCR products were diluted in 20 µl of water (high-performance liquid chromatography grade) containing 0.5 µl GENESCAN 500 TAMRA or 400 HD (Rox) fluorescent size standard (Applera). Denatured PCR fragments were separated on the ABI PRISM 310 and ABI PRISM 3700 DNA Analyser (Applera). Evaluation of the collected data was accomplished with the GeneScan Analysis Software (Applera). All of the analyses were performed at least in duplicates of independent PCRs.
|
2 x SD). The cutoff values for AI were calculated by 1-dc for the loss of the longer and 1/(1-dc) of the shorter allele resulting in cutoff values of 0.79 (loss of longer allele) and 1.27 (loss of shorter allele). Because of the low SD of the method, AI could be detected sensitively if the peak area for one allele in relation to the other decreased in the tumor DNA to 79% of the normal. Therefore, a microsatellite was scored positive for AI if the AI score was <0.79 or >1.27.
RT-PCR Analysis.
Quick-frozen tumor tissues from 23 breast cancer patients with AI at the egfr region were submitted to extraction of total RNA using the single-step isolation described by Chomczynski and Sacchi (15)
using RNAzol (Diagnostic International).
RT-PCR was performed with the Titan One Step RT-PCR kit purchased from Roche Molecular Diagnostics according to the manufacturer’s instructions. In brief, total RNA was reverse-transcribed using avian myeloblastosis virus reverse transcriptase. Amplification was performed using Taq DNA polymerase and Pwo DNA polymerase, and the following oligonucleotides: K1:5'-(Fl)-GC TCT ACA ACC CCA CCA CG-3', V3A:5'-(Fl)-GT ATT GAT CGG GAG AGC CG-3', and V3B:5'-GTG GAG ATC GCC ACT GAT G-3'.
Cycling conditions for primer pairs V3A/V3B and V3B/K1 were as follows: reverse transcription at 50°C for 30 min, initial denaturation at 94°C for 2 min, 35 cycles of denaturation (94°C for 1 min), annealing (59°C for 1 min), and extension (68°C for 1 min), and a final extension step at 68°C for 7 min. Amplified fragments were separated on an agarose gel and visualized by ethidium bromide staining. Gel-excised fragments were purified using the QIAExII system (Qiagen) and submitted to direct DNA sequencing using Big Dye Terminator Cycle Sequencing reagents (Applera) and the ABI PRISM 3700 DNA Analyser. The primer pairs and amplification conditions were optimized using both normal lymphocyte DNA and plasmid DH
E801P containing an exon2/exon7 deletion fragment of the egfr. The primer pair V3A/V3B results in a regular fragment of 1153 bp spanning exon 1 to exon 8, and a 352-bp fragment is amplified when exons 2–7 are deleted. Primer pair V3B/K1 generates a 307-bp fragment when the mRNA is intact and a 251-bp fragment when exons 2–7 are deleted.
Quantitative Real-Time PCR (5' Nuclease Assay).
Primers specific for sequences flanking the first CA repeat in the first intron of the egfr gene (CAIfor: 5'-tgaagaatttgagccaaccaaa-3' and CAIrev: 5'-cacttgaaccagggacagca-3') were designed using Primer Express software (Applera) and a universal probe consisting of 15 CA repeats, and a 5' fluorescent label (CA-Fam) was designed. The primers represented specific sequences for egfr, which were checked by BLAST search.4
Primers and probes were also designed for two different single-copy genes, SOD2 (chromosome 6q25 GenBank accession no. 65965, forward primer: 5'-GGAGAAGCTGACGGCTGC-3', reverse primer: 5'-CCTTATTGAAACCAAGCCAACC-3', VIC-labeled probe: 5'-CAACCTGAGCCTTGGACACCAACAGA-3') and HBB (chromosome 11p, GenBank accession No. V00499, forward primer: 5'-GTGAAGGCTCATGGCAAGAAAG-3', reverse primer: 5'-CAGCTCACTCAGTGTGGCAAAG-3', VIC-labeled probe: ATGGCCTGGCTCACCTGGACAACC). For all three of the genes, the amplicon length was minimized (68–97 bp) to allow for the most efficient PCR amplification. PCR analysis was performed using TaqMan Universal Mix (Applera) and an ABI Prism 7900HT Sequence Detection System (Applera). A PCR cycle consisted of denaturation at 95°C for 15 s and primer annealing and extension at 60°C for 1 min, and was repeated 40 times. PCR reactions were performed at least in triplicates, and serial dilutions of DNA ensured accuracy of gene dosage quantification.
Amplification of the egfr gene was measured in the breast cancer-derived cell line MDA-MB-468 in comparison to normal leukocytes. MDA-MB-468 DNA reportedly displays a 30–50-fold amplification of the egfr gene (16) and was used as a positive control. DNA concentrations were normalized to both SOD2 and HBB, two different single-copy genes (17) .
Induction and Detection of Fragile Sites in B Lymphocytes.
Heparinized whole peripheral blood (1 ml) was cultured in 10 ml Ham’s F-10 medium supplemented with 20% FCS, 100 µmol L-glutamine, 144 µg phytohemagglutinin, and 10,000 units of streptomycin/penicillin at 37°C for 72 h. At 24, 24, and 6 h before harvest, aphidicolin (0.4 µM final concentration), ethanol (0.5% final concentration), and caffeine (2.2 mM final concentration), respectively, were added to the lymphocyte culture for fragile site induction.
Dividing cells were blocked in metaphase by addition of colcemide 1.5 h before harvest. Standard cytogenetic techniques were used for harvesting and slide preparation. The probe for egfr detection was derived from homo sapiens PAC clone containing the whole egfr gene (GenBank accession no. AC006977). DNA was labeled with digoxigenin-11-dUTP by nick translation following standard protocols (18) . The probe was denatured for 5 min at 70°C in 70% formamid-0.6x SSC. Hybridization to the metaphase spreads was carried out overnight at 37°C in a 50% formamid-1x SSC-10% dextran sulfate solution in the presence of Cot-1-DNA (Life Technologies, Inc.) and HPL-DNA (Sigma). Posthybridization washes were performed at 45°C in 50% formamide-2x SSC followed by blocking with 3% BSA in 4x SSC at 37°C. Probe detection was performed using mouse-anti-digoxigenin (Sigma) and Cy3-labeled goat-antimouse antibodies. The chromosomes were counterstained with 4',6-diamidino-2-phenylindole, and images were captured with an Olympus BX61 microscope connected with a digital camera system DP50 (Hamburg, Germany). Giemsa-trypsin banding was performed according to the standard protocol of Seabright (19) . Briefly, slides were incubated 10–40 s in trypsin (1 mg/ml in NaCl) at 37°C, quickly rinsed in water, stained 4 min in Giemsa, and then washed in water. Complete metaphase spreads (n > 100) were assessed at the 350–400-band level by conventional light microscopy (Olympus BX61).
Microdissection of Tissue from Normal, Premalignant Lesions and Tumor Tissues.
Tissues from 16 patients, all known to harbor AI at CA-SSR I in their invasive carcinoma, were laser microdissected (Palm, Oberlensheim, Germany) from serial 10-µm sections of paraffin-embedded tissue after hematoxylin staining. The sections were evaluated by two pathologists (W. B., H. B.). DNA was isolated from both nontumorous lymphocytes and invasive carcinoma from paraffin-embedded tissue. In these 16 cases, nontumorous, morphologically normal breast lobules (n = 69) could be isolated. Breast lobules were pooled to maximize the DNA yield. Only breast lobules with a distinct myoepithelial layer and a single layer of luminal epithelial cells with small, uniform nuclei with evenly distribute chromatin were selected for AI analysis. Twenty-three samples consisted of benign, metaplastic, or hyperplastic proliferative breast lesions such as adenosis, ductal hyperplasia, or apocrine adenosis. In 3 cases ductal hyperplasias with nuclear atypias were present. Also, 3 samples of DCIS and 9 samples of associated lymph node metastasis could be analyzed. Benign and malignant breast lesions were defined according to Elston and Ellis (20)
.
For isolation of DNA from deparaffinated, microdissected tissue the material was suspended in 10–200 µl TE buffer [10 mM Tris/HCl and 1 mM EDTA (pH 7.5)] and incubated with 1–20 µl proteinase K (600 mAu/ml) at 56°C for 10 h. The tube was boiled (10 min), chilled (10 min at 4°C), and enclosed centrifuged for 1 min at 14,000 x g. The supernatant was transferred into a fresh tube before DNA was pelleted in 70% ethanol and centrifuged for 20 min. After two washing steps (70% ethanol; 20 min 14,000 x g) the pellet was air dried and rehydrated by LTE or distilled water and stored frozen at -20°C. Resulting DNA amounts were determined before CA-SSR I microsatellite analysis by quantitative real-time PCR. Both previously mentioned single-copy genes, SOD2 and HBB (primer and probe sequences as shown above), were amplified and quantified via the 5' nuclease assay. PCR analysis was performed using TaqMan Universal Mix (Applera), 400 nmol of forward and reverse primer, 200 nmol probe, 2.5 µl DNA solution, and an ABI Prism 7900HT Sequence Detection System (Applera). PCR conditions were the same as described above. As a control, DNA isolated from formalin-fixed, paraffin-embedded lymph node tissue was photometrically quantified. A standard curve was obtained by serial dilution of control DNA ranging from 120 pg to 10 ng per (each) PCR assay and single-copy gene. The test DNA was amplified in the same PCR run, and the concentration was determined using the standard curve. Each DNA was tested once for each single-copy gene, because the total DNA amount after microdissection is limited. The DNA was used for CA-SSR I microsatellite analysis if the obtained DNA concentrations for SOD2 and HBB were equal.
To ensure the specificity of microsatellite analysis in microdissected tissues, we determined the minimum DNA template concentration by performing serial dilutions of DNA starting at 30 ng. Reproducibility of results was approved by duplicate experiments using a minimum of 1 ng of DNA. Therefore, microsatellite analysis of microdissected tissues was performed with 1.2 ng of DNA.
The PCR protocol for the determination of AI at microdissected tissues was adopted for the use of low cell numbers as follows. PCR assays of egfr using primers for CA-SSR I (Table 1)
were performed in 10-µl reactions containing 1x PCR Buffer II (Applera), 2 mM MgCl2, 50 µM of each GeneAmp deoxynucleotide triphosphate (Applera), 1 µM of forward and reverse primer, 1.2 ng of template DNA, and 0.5 units of Ampli Taq Gold (Applera). The PCR reactions were overlaid with mineral oil and carried out in a 96-well thermocycler (GeneAmp PCR System 9700; Applera). A denaturation step at 95°C for 10 min was followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, primer extension at 72°C for 30 s, and one final extension at 72°C for 7 min. Separation of PCR fragments was performed with a four-color laser-induced fluorescence capillary electrophoresis system as described above.
Statistical Methods.
Actual survival probabilities were calculated by Kaplan-Meier method, and the differences between the groups were estimated by the log-rank or Wilcoxon test. It should be noted that the number of patients in the tables and figures does not add up to 163 because of missing data, e.g., not performed experiments, and patients who were not at least 5 years in or lost in follow-up. Multivariate analysis was performed using Cox proportional hazards regression model.
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
To estimate the size of the mutated sequence we used 17 microsatellite markers on chromosome 7p to test 64 breast cancer patients (Fig. 1)
. The more distant microsatellite loci, D7S519, D7S665, and D7S510, showed no AI, and D7S674, D7S670, D7S478, and CA-SSR V were not informative (homozygous). Ten markers around and in the egfr gene revealed AI on 7p in 23 cases. No AI could be detected in 41 cases. Interestingly, 84% (16 of 19) of informative cases with AI showed AI at CA-SSR I located between enhancers 1 and 2 in the first intron of the egfr (Table 2)
. In addition to the AI at CA-SSR I, AI could be shown at different microsatellite markers on chromosome 7p. The affected sequence reaches up to 8 megabases with the shortest affected region being up to 2 megabases around CA-SSR I (e.g., see patients 78/414 and 7/425). However, all of the AIs occurred in the egfr gene, and/or the close vicinity upstream and/or downstream of the gene and at no other regions of chromosome 7p.
|
|
. These results were confirmed by Western blotting where only full-length EGFR proteins could be detected (data not shown). Thus, exon2/exon7 deletions could not be detected in these tissues and, therefore, are not related to the occurrence of AI in the egfr gene.
|
The sensitivity of the method allowed the detection of an amplification if the AI score exceeds <0.56 or >1.3 (Fig. 3)
. As a control, DNA isolated from the MDA-MB-468 cell line was tested and displayed 30–60-fold amplification of egfr CA-SSR I. Up to 16-fold amplification of the egfr CA-SSR I region could be detected in patients with an AI score of 0.23. In cases with an AI score between 0.56 and 0.79 or 1.27 and 1.29, no significant differences in the gene dosage between tumor DNA and normal DNA could be assessed, but no case with a decreased gene dosage was found for the egfr CA SSR I by this method.
|
, a single-strand break could be observed by Giemsa stain and FISH analysis, which occurred near the egfr gene region as shown by the FISH analysis.
|
. In 5 of 23 and 4 of 5 samples, classified as benign proliferative breast lesions or intraductal proliferations with nuclear atypia, respectively, AI was detected. Furthermore, 30% of the microdissected samples of normal, noncancerous breast tissue showed an AI at the CA-SSR I of egfr. Twelve of 16 patients (75%) revealed AI at normal breast lobules, and at least two lobules were affected.
|
; P < 0.001). The odds ratio for the 5-year probability of recurrence of the 82 patients with a follow-up >5 years reached 4.9 (95% confidence interval, 1.4–17.6). In the subgroup of 35 young early stage patients (<55 years) the odds ratio increased to 7.9 (95% confidence interval, 1.4–45.8).
|
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Amplifications of the entire egfr gene are a frequent event in high malignant tumors of the central nervous system, and EGFR overexpression has been shown on the cytogenetic level in renal carcinoma (23, 24, 25) . However, gene dosage studies show very little evidence for egfr gene rearrangements or amplifications (26) . Against this background, the overexpression of EGFR was regarded mainly as a result of disturbed transcriptional mechanisms. We have shown previously that low-level gene dosage deviations at the boundary of exon 1 and intron 1 of the egfr gene occur frequently and identify patients with poor clinical outcome (14 , 17) . The deviations were not detectable on a cytogenetic level, or at most they were represented by low-level chromosomal gains in comparative genomic hybridization (CGH) (12) .
In a recent study, we gave evidence for the first time that AIs affecting regulating sequences of egfr transcription in the intron 1 of egfr were correlated with EGFR expression in the tumor (12) .
The data presented in this work clearly show that these genetic alterations involve the first 1200 bases of intron 1 of egfr. Although the frequency of AI on 7p differed substantially, a distinct peak in the CA-SSR I region as shown by microsatellite analysis using 16 additional markers was observed.
To exclude that this AI represents only a surrogate marker for the well-defined exon 2/exon 7 deletion mutation resulting in the constitutive active EGFR isoform vIII (6) , we performed RT-PCR analysis. Using a nested approach by applying primers for the cDNA of exon 1 to exon 8, as well as from exon 7 to exon 8, mutant egfr mRNAs could not be detected in tissues harboring a CA-SSR I AI. The integrity of mRNA was approved by ß-actin cDNA amplification. From a subgroup of tumors, Western blotting was also performed using a COOH-terminal binding antibody and an exon 2 to exon 7 sequence-specific antibody as a control. In agreement with the RT-PCR results, no truncated receptor proteins were detected.
From a comparison study with microsatellite PCR and CGH analysis we know that AI at distinct polymorphic loci can also represent amplifications (27) . Therefore, we developed a quantitative real-time PCR assay for gene dosage measurements within the six CA-SSRs in intron 1 of egfr. Interestingly, an increase in CA-SSR I gene dosages could be detected in cases presenting with an AI score <0.56 and >1.3. The sensitivity of the method did not allow us to assess a gene amplification to all of the cases presenting with an AI score significantly different from diploids at the egfr locus, but in no case could a decreased gene dosage be measured. We interpret these data as a first suggestion that distinct amplifications of egfr occur in a substantial subset of invasive breast cancer cases. A basal gene dosage-dependent regulation might be assumed also for egfr as already established for c-erbB-2 (3) .
Searching for published data that could explain an increase of probability for the formation of an amplification at that locus, we found that fragile sites were suggested at 7p11.2 and 7p14.2 (21)
, which have not been characterized in detail, thus far. Therefore, based on the knowledge that the induction of fragile sites triggers the formation of amplification we investigated chromosome 7p in normal lymphocyte metaphase spreads after drug treatment by cytogenetics and FISH analysis using an egfr-specific probe. In fact, a single-strand break could be detected in 30% of the metaphase spreads, and the FISH analysis confirmed the location near the egfr gene region (Fig. 4)
. The high frequency of this event suggests that this is a common fragile site. We are investigating currently the exact structure of the strand break at this fragile site to substantiate our working hypothesis that it is the initial event in the formation of egfr amplifications e.g., by breakage-fusion-bridge cycles (22)
. Of note, AI at CA-SSR I could be detected in morphologically normal breast tissue in three quarters of the patients harboring this AI at the corresponding invasive carcinoma. This was not unexpected because of the fact that AIs at normal breast lobules in women with or without synchronous breast cancer (28)
have already been described. Therefore, we conclude that this genetic alteration might be a primary event in breast cancer carcinogenesis.
Furthermore, 20% of nontumorous hyperplasias and metaplasias, and 80% of the atypical ductal hyperplasias presented with an AI of the CA-SSR I. To our knowledge no other genomic alteration leading to gene deregulation has thus far been reported with such a high frequency in nontumorous breast tissue. The segregation of the AI was additionally detected in all of the cases of associated DCIS and also in all of the lymph node metastases.
For squamous cell carcinoma of the lower jaw, we could already demonstrate that egfr and c-erbB-2 alterations in morphologically normal mouth tissue have predictive value concerning the recurrence rate (29) . Recently, a high-risk marker of local recurrence in early stage breast cancer patients has been narrowed to a region at chromosome 3p24.3 (30) . Therefore, it could be hypothesized that the AI at CA-SSR I of egfr is a genetic marker, which is also important for breast cancer prognosis. Our retrospective cohort study using the CA-SSR I AI at the primary tumor as a prognostic marker demonstrated an increased risk of recurrence for patients harboring the AI. This leads to the assumption that tumors with a CA-SSR I AI present with a distinct phenotype, which is at least determined genetically in the early steps of carcinogenesis.
However, an overexpression of EGFR was not observed in all cases of CA-SSR I AI, thereby indicating only basal impact of such a mutation in an intronic regulatory sequence of the gene. Factors with repressor function may counteract the enhancement of egfr transcription activity by the amplifications.
In consequence a better understanding of this phenotype might lead to the discovery of a target for new therapeutic or even preventive approaches especially counteracting egfr expression and signaling.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by grants from the Deutsche Krebshilfe Bü-1068-1, 10-1660-Br 4, the Federal Ministry of Education and Research (Fö01KS9604/0), and the Interdisciplinary Center of Clinical Research (IZKF Project No. F3-H1). 
2 To whom requests for reprints should be addressed, at Institute of Clinical Chemistry and Laboratory Medicine, Westfälische Wilhelmsuniversität Münster, Albert-Schweitzer-Strasse 33, 48149 Münster, Germany. Phone: 49-251-8347226; Fax: 49-251-8347226; E-mail: brandt{at}uni-muenster.de
3 The abbreviations used are: egfr, epidermal growth factor receptor; TGF, transforming growth factor; CA-SSR, CA simple sequence repeat; FAM, carboxyfluorescein; AI, allelic imbalance; dc, critical difference; RT-PCR, reverse transcription-PCR; SOD2, manganese superoxide dismutase; HBB, ß-globin; DCIS, ductal carcinoma in situ; FISH, fluorescence in situ hybridization.
4 Internet address: http://www.ncbi.nlm.nih.gov/Sitemap/index.html#BLAST.
Received 7/18/02. Accepted 1/27/03.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
2 (I) collagen (COL1A2). Hum. Mol. Genet., 1: 135 1992.This article has been cited by other articles:
|
|
 |
|
  G. Milano, M.-C. Etienne-Grimaldi, L. Dahan, M. Francoual, J.-P. Spano, D. Benchimol, M. Chazal, C. Letoublon, T. Andre, F.-N. Gilly, et al. Epidermal growth factor receptor (EGFR) status and K-Ras mutations in colorectal cancer Ann. Onc., December 1, 2008; 19(12): 2033 - 2038. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Muller, C. Beeger, C. Alix-Panabieres, X. Rebillard, K. Pantel, and H. Schwarzenbach Identification of Loss of Heterozygosity on Circulating Free DNA in Peripheral Blood of Prostate Cancer Patients: Potential and Technical Improvements Clin. Chem., April 1, 2008; 54(4): 688 - 696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-S. Wang, P.-M. Chen, T.-J. Chiou, J.-H. Liu, J.-K. Lin, T.-C. Lin, H.-S. Wang, and Y. Su Epidermal Growth Factor Receptor R497K Polymorphism Is a Favorable Prognostic Factor for Patients with Colorectal Carcinoma Clin. Cancer Res., June 15, 2007; 13(12): 3597 - 3604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Kersting, C. Gebert, K. Agelopoulos, H. Schmidt, P. J. van Diest, H. Juergens, W. Winkelmann, M. Kevric, G. Gosheger, B. Brandt, et al. Epidermal Growth Factor Receptor Expression in High-Grade Osteosarcomas Is Associated with a Good Clinical Outcome Clin. Cancer Res., May 15, 2007; 13(10): 2998 - 3005. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. Moiseeva, R. Heukers, and M. M. Manson EGFR and Src are involved in indole-3-carbinol-induced death and cell cycle arrest of human breast cancer cells Carcinogenesis, February 1, 2007; 28(2): 435 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Rosell, M. Taron, N. Reguart, D. Isla, and T. Moran Epidermal Growth Factor Receptor Activation: How Exon 19 and 21 Mutations Changed Our Understanding of the Pathway Clin. Cancer Res., December 15, 2006; 12(24): 7222 - 7231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Brandt, S. Meyer-Staeckling, H. Schmidt, K. Agelopoulos, and H. Buerger Mechanisms of egfr Gene Transcription Modulation: Relationship to Cancer Risk and Therapy Response Clin. Cancer Res., December 15, 2006; 12(24): 7252 - 7260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Taron, Y. Ichinose, R. Rosell, T. Mok, B. Massuti, L. Zamora, J. L. Mate, C. Manegold, M. Ono, C. Queralt, et al. Activating Mutations in the Tyrosine Kinase Domain of the Epidermal Growth Factor Receptor Are Associated with Improved Survival in Gefitinib-Treated Chemorefractory Lung Adenocarcinomas Clin. Cancer Res., August 15, 2005; 11(16): 5878 - 5885. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Muller-Tidow, S. Diederichs, E. Bulk, T. Pohle, B. Steffen, J. Schwable, S. Plewka, M. Thomas, R. Metzger, P. M. Schneider, et al. Identification of Metastasis-Associated Receptor Tyrosine Kinases in Non-Small Cell Lung Cancer Cancer Res., March 1, 2005; 65(5): 1778 - 1782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Amador, D. Oppenheimer, S. Perea, A. Maitra, G. Cusati, C. Iacobuzio-Donahue, S. D. Baker, R. Ashfaq, C. Takimoto, A. Forastiere, et al. An Epidermal Growth Factor Receptor Intron 1 Polymorphism Mediates Response to Epidermal Growth Factor Receptor Inhibitors Cancer Res., December 15, 2004; 64(24): 9139 - 9143. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Li, A. B. Korol, T. Fahima, and E. Nevo Microsatellites Within Genes: Structure, Function, and Evolution Mol. Biol. Evol., June 1, 2004; 21(6): 991 - 1007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Muller-Tidow, J. Schwable, B. Steffen, N. Tidow, B. Brandt, K. Becker, E. Schulze-Bahr, H. Halfter, U. Vogt, R. Metzger, et al. High-Throughput Analysis of Genome-Wide Receptor Tyrosine Kinase Expression in Human Cancers Identifies Potential Novel Drug Targets Clin. Cancer Res., February 15, 2004; 10(4): 1241 - 1249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Brandt, S. Hermann, K. Straif, N. Tidow, H. Buerger, and J. Chang-Claude Modification of Breast Cancer Risk in Young Women by a Polymorphic Sequence in the egfr Gene Cancer Res., January 1, 2004; 64(1): 7 - 12. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, AI; 
, no AI; 
, homozygous.
