| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Virology |
Department for the Development of Therapeutic Programs, Laboratory "C," Regina Elena Cancer Institute, CRS, Rome [A. D. L., A. S., A. B., A. M. M., M. G. P.], and Section of Genetics, Institute of Molecular Biology and Pathology, National Research Council, Rome [R. M., L. M., A. P., P. L.], Italy
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
To expand our current knowledge of these multifaceted viral tools and their molecular targets in host cells, we have focused on the ENT4 region (amino acids 136), common to both 289R E1A and 243R E1A oncoproteins from human adenovirus (2) . Recently, we identified RACK1, a receptor for activated C kinase, as an E1A antagonizing factor, that physically interacts with the ENT region of E1A (12) . By means of the yeast two-hybrid system, we have now identified a novel physical interaction between adenovirus 2 E1A and the Ran GTPase. The Ran GTPase is the central element in a regulatory network that includes a GTPase-activating protein (RanGAP1), which catalyzes GTP hydrolysis on Ran producing RanGDP, and a guanine exchange factor termed RCC1, which catalyzes nucleotide exchange on Ran; both of these activities are modulated by RanBP1, which increases GTP hydrolysis by RanGAP1 and inhibits the exchange activity of RCC1. Activity of the network requires a full nucleotide exchange-and-hydrolysis cycle on Ran (13, 14, 15) . Ran plays a primary regulatory role in nucleocytoplasmic transport and cell cycle progression (reviewed in Refs. 14 and 16 ). Growing evidence also indicates a regulatory role of Ran in mitotic spindle organization (reviewed in Refs. 17 and 18 ). Ran network components specifically associate with mitotic structures in mammalian cells (19, 20, 21) . In addition, the induction of imbalance among components by overexpressing the RanBP1 protein yields abnormal mitoses, often with monopolar or multipolar spindles (19) . Spindle poles are organized by centrosomes, the major microtubule-organizing centers in eukaryotic cells. To ensure bipolarity in the mitotic spindle, centrosomes duplicate only once per cell cycle during S phase and separate in late G2 to give rise to two spindle poles. Errors in the centrosome duplication cycle give rise to multipolar spindles and, therefore, are regarded as a major cause of genomic instability (reviewed in Refs. 22, 23, 24, 25 ). Centrosome amplification occurs in many tumors and, in particular, in human carcinomas expressing the HPV16-derived E7 transforming protein (26 , 27) .
Here we have sought to dissect the functional significance of the interaction between E1A and Ran. We have found that E1A, like E7, deregulates the centrosome duplication cycle. This effect depends on both the ability of E1A to interact with Ran and on the functional integrity of the Ran network.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines.
BHK21 baby hamster kidney epithelial cells, and its derivative tsBN2 cell line, carrying a temperature-sensitive RCC1 allele (S256F; Ref. 30
), were kindly provided by T. Nishimoto (University of Fukuoka, Fukuoka, Japan) and routinely maintained at the permissive temperature of 32°C or shifted to 39°C, as indicated in the text. NIH/3T3 murine embryo fibroblasts, L929 murine epithelial cells, PtK kangoroo-rat epithelial cells, and 293 human embryo kidney epithelial cells were cultured at 37°C. All of the cell lines were grown in DMEM containing 10% FCS in a 5% CO2 atmosphere.
Plasmids and Constructs.
Constructs expressing wild-type Ran, or T24N, Q69L, T42A, and C-del mutants (the latter lacking the six most COOH-terminal amino acids) were kind gifts from M. Rush and P. DEustachio (New York University, New York, NY). GST-tagged Ran was described by Dasso et al. (31)
. The human RCC1 coding region (obtained from I. Mattaj, EMBL, Heidelberg, Germany) was PCR-amplified using a reverse primer encoding an in-frame HA tag (forward oligonucleotide: 5'CCAAGCTTATGGCCTCACCCAAGCGCATAGCTAAA3'; reverse oligonucleotide: 5'CGCGTCGACCTAAGCGTAGTCTGGGACGTCGTATGGGTAGCTCTGTTCTTTGTCCTTGAC3') and cloned in the pBluescript-derived pX expression vector (32)
. Cytomegalovirus-based eukaryotic expression constructs and GST chimeric constructs for human adenovirus 2 E1A, E1A1-36 (amino acids 1 to 36) and E1A
2-36 were described (12)
. Constructs for E1A
2-36/CR2, E1A
15-35, and E1A
121-128, described elsewhere (33)
, were obtained from A. Felsani (Consiglio Nazionale delle Ricerche, Rome, Italy). The E1A
121-128 construct was also cloned into the cytomegalovirus-based Gateway system pDEST12.2 vector (Invitrogen, Carlsbad, CA). The pCDNA3-FADD construct was a kind gift from V. M. Dixit (University of Michigan, Ann Arbor, MI). The pEGFPN1 vector was from BD Clontech.
In Vitro Binding Assays.
One µg of plasmid encoding wild-type or mutant Ran was used to program a TnT rabbit reticulocyte lysate (Promega, Madison, WI) under the control of the T7 polymerase, in the presence of [35S]methionine (Amersham, Piscataway, NJ). Aliquots of the reaction mixture were added to glutathione/Sepharose beads coupled with 4 µg of GST chimerized with E1A wild-type, E1A
2-36, E1A
15-35, or E1A
121-128. Incubation was carried out in NENT buffer [20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5% NP40, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin] for 60 min at 4°C with gentle rocking. Beads were washed three times in NENT buffer, and electrophoresis was performed on 12% acrylamide SDS-PAGE. When higher ionic strength was required, NENT buffer was modified to bring the NaCl concentration to 250 mM and was used for both incubation and washes. Gels were dried and exposed at -70°C using Kodak Biomax MS films. When the ability of Ran to bind to different viral oncoproteins was assayed, 1 µg of plasmid encoding adenovirus E1A, HPV-16 E7, SV40 large T Ag, RanBP1 or FADD were used to program a TnT rabbit reticulocyte lysate as described above. The obtained radiolabeled proteins were incubated with glutathione/Sepharose beads coupled with 4 µg of GST-Ran. Incubation and washes were carried out in NENT buffer; then electrophoresis was performed on 10% acrylamide (for large T Ag, E1A, and RanBP1) or 12% acrylamide (for FADD and E7) SDS-PAGE. Detection was performed as described above.
In Vivo Coimmunoprecipitation.
293 cells were lysed in lysis buffer [50 mM Tris-HCl (pH 7.4), 5 mM EDTA, 250 mM NaCl, 50 mM NaF, 0.1% Triton X-100, 0.1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin] for 30 min on ice. Lysates were centrifuged at 14,000 x g for 10 min at 4°C. Lysates (800 µg) were cleared and incubated with anti-E1A M73 monoclonal antibody (34)
or with purified mouse immunoglobulins (Pierce, Rockford, IL; immunoprecipitation Ip control antibody) for 2 h, followed by incubation with protein G-Sepharose beads in either lysis buffer (above), or Mg2+ [20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 2.5 mM MgCl2, 0.1% Triton X-100, and 10% glycerol] or EDTA buffer [20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, and 0.1% Triton X-100]. The beads were subjected to four rounds of washing with 1 ml of the appropriate buffer, then immunoprecipitates were eluted by adding electrophoresis sample buffer. Proteins were resolved through 12% acrylamide SDS-PAGE, transferred to polyvinylidene difluoride membranes and probed with anti-Ran C-20 (sc-1156) and anti-RanBP1 C-19 (sc-1160) antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA).
Nucleotide Exchange Assay.
Nucleotide exchange assays on Ran were performed essentially as described previously (35)
. Briefly, exchange of labeled GTP for unlabeled GTP on wild-type Ran was examined using HisTag fusion protein immobilized on Ni-NTA Agarose (Qiagen GmbH, Hilden, Germany). The immobilized protein was equilibrated in 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, and 10% glycerol by washing the resin three times. Four hundred pmol of Ran fusion protein were loaded with 6 MBq of [
-32P]GTP (74 TBq/mmol; Amersham, Piscataway, NJ) and incubated for 20 min at room temperature. Excess labeled GTP was removed by washing the resin five times in 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 15 mM MgCl2. The resin was resuspended in the same buffer containing 0.5 mM unlabeled GTP, so that 50-µl aliquots contained loaded Ran at the concentration of 0.5 µM, in the presence or absence of 0.1 µM eluted HisTag-RCC1 protein. Individual aliquots were incubated for 710 min at 30°C with eluted GST-E1A wild-type, GST-E1A
2-36, or GST-E1A
121-128 (0.5 µM). Reactions were terminated by adding 500 µl of ice-cold buffer and were centrifuged. Supernatant and pellet (resin) fractions were subjected to radioactivity counting.
Transfections.
Cells were transfected in 60-mm culture dishes with 3 µg of E1A or mutagenized derivatives and 0.5 µg of pEGFPN1 as marker, using a LipofectAMINE/DNA mixture (5 µl/µg; Invitrogen, Carlsbad, CA) in DMEM containing 0.5% FCS. Six h later, the transfection medium was replaced with fresh medium, and incubation was continued for 24 h. In experiments with tsBN2 cells, transfected cells were either kept at 32°C throughout the duration of the experiment or shifted to 39°C during the last 10 h before harvesting the cells.
Cell Cycle and Apoptosis Analysis.
To analyze the cell cycle phases, 1 x 106 cells were resuspended in PBS containing 0.1% Triton X-100, stained with 20 µg/ml propidium iodide (Sigma, St. Louis, MO) and analyzed using a FACStar-Plus flow cytometer (Becton-Dickinson; 10,000 events/sample). To evaluate apoptosis induction, cells were first analyzed through FSC-H/FL1-H biparametric graphs to gate out nontransfected cells. Transfected cells were selected and analyzed on a biparametric FSC-H/SSC-H graph to identify apoptotic cells as smaller (low FSC-H), and highly condensed and granular (high SSC-H), as compared with viable cells.
IF and Centrosome Analysis.
Cells transfected with E1A or derivatives were grown on glass coverslips in Petri dishes. Cells were fixed in 3.7% formaldehyde for 15 min at 4°C and were permeabilized in PBS containing 0.1% Triton X-100 for 10 min. After quenching in 0.1 M glycine, cells were fixed again in 100% methanol for 10 min at -20°C. In some experiments, cells were directly solubilized and fixed in 100% methanol for comparison. Fixed cells were preincubated in 20% goat serum or FCS for 30 min at 37°C in a humidified chamber. The following primary antibodies were used: rabbit anti-centrin 2 (kindly provided by M. Bornens, Institut Curie, Paris, France); monoclonal (GTU-88) and rabbit polyclonal anti-
-tubulin (T3559) antibodies (1:1000 dilution; both from Sigma); mouse anti-
-tubulin (3.5 µg/ml, clone B-5-1-2, T5168; Sigma); mouse anti-Ran (0.25 µg/ml, clone 20, R32620; BD Transduction Laboratories, Franklin Lakes, NJ) and mouse M73 anti-E1A (34)
. After 1-h incubation, cells were washed three times in 0.1% Tween/PBS, further incubated for 30 min with antirabbit rhodamine-conjugated antibody (sc-2090; Santa Cruz Biotechnology Inc.) to detect centrin-2 and
-tubulin, or antimouse Texas Red-conjugated antibody (Vector Laboratories, Burlingame, CA) to detect Ran and E1A. Cell spreads were counterstained with 4',6-diamidino-2-phenylindole (DAPI; 0.1 µg/ml in distilled water) and were mounted in Vectashield (Vector Laboratories, Burlingame, CA). To monitor DNA replication, BrdUrd (45 µM final concentration) was added to the medium 1 h before harvesting; cells were then fixed and processed as above, except for a 10-min denaturation step in 4 N HCl. Mouse anti-BrdUrd antibody (20 µg/ml Clone Bu20a, M0744; Dako A/S, Glostrup, Denmark) and antimouse Texas Red-conjugated secondary antibody (see above) were used. Images were taken using an Olympus AX70 microscope configured for epifluorescence and equipped with a cooled camera device (Photometrics). For each sample, at least 100 GFP-expressing cells were counted and analyzed for centrosome number or BrdUrd incorporation.
| RESULTS |
|---|
|
|
|---|
2-36, or GST-E1A1-36 chimeric constructs, or with GST alone. As shown in Fig. 1A
121-128 (which lacks 8 amino acids including the LXCXE motif in the CR2 region), but not with GST-E1A
2-36. Ran also interacted very weakly with the mutant GST-E1A
15-35. At higher ionic strength (250 mM NaCl), the interaction of Ran with GST-E1A
15-35 became undetectable (not shown). This indicates that disruption of the ENT-region integrity strongly impairs Ran binding, thereby confirming that the interaction between E1A and Ran is mediated by the ENT region. We next assayed in vitro translated Ran mutants as input. As shown in Fig. 1B
|
2-36, lacking the Ran-interacting ENT, was compared with E1A
121-128 [disrupted in the CR2 region responsible for the interaction with several regulators, including the Retinoblastoma family proteins (2)
] and with the double E1A
2-36/CR2 mutant, deleted in both ENT and CR2. Second, we forced E1A expression in cells proficient or defective for activity of the RCC1 nucleotide exchange factor on Ran, to determine whether the Ran background influenced the biological effects of E1A. We made use of the conditional tsBN2 cell line, derived from baby hamster kidney epithelial cells (BHK21), harboring a temperature-sensitive allele for RCC1, which encodes an active nucleotide exchange factor at the permissive temperature (32°C) but which is highly unstable at the restrictive temperature (39°C). Dose-response experiments were first carried out in tsBN2 and BHK21 cell lines to identify a suitable dose of E1A construct that did not induce apoptosis: doses in the range of 23 µg of E1A DNA induced an apoptotic response similar to that induced by vector alone, i.e., not exceeding 1215% of the cell population, in either permissive or nonpermissive conditions for RCC1 activity. To avoid detrimental effects on cell viability that may result from RCC1 inactivation during one entire cell cycle, asynchronously cycling tsBN2 cell cultures were transfected with E1A or its derivatives, were cultured for 24 h at the permissive temperature, and were then transferred to nonpermissive conditions for the last 10 h before terminating the experiment. Western blotting experiments indicated that mutant RCC1 was indeed degraded in tsBN2 but not in parental BHK21 cells, within 3 h after shifting the temperature to 39°C, whereas levels of the E1A protein were not affected (not shown).
The Ran network regulates several cell cycle transitions (16)
, and in particular monitors the onset and termination of S phase (36
, 39)
. As a first step to examine the effect of wild-type E1A or deleted derivatives on cell cycle progression, we evaluated the incorporation of BrdUrd in the nuclei of E1A-transfected cells, identified by fluorescent emission from a cotransfected GFP marker. The results of experiments at the permissive temperature (32°C) indicate that wild-type E1A stimulated tsBN2 cultures to enter S phase (3-fold increase; Fig. 2
). E1A
2-36 was less effective in the induction of S phase (2-fold increase), similar to E1A
121-128, which cannot interact with Retinoblastoma family members. The comparable decrease in the efficiency of E1A
2-36 and E1A
121-128 mutants suggests that the ENT region plays a role in the pro-proliferative functions of E1A. When both domains were simultaneously removed (E1A
2-36/CR2), the ability of E1A to induce DNA replication was further impaired. At 39°C, fewer tsBN2 cells were found to replicate their DNA, because of RCC1 inactivation, as expected (16)
. Reconstitution of the wild-type phenotype by transfecting wild-type RCC1 rescued this impairment and brought the fraction of BrdUrd-incorporating cells back to that seen in control cultures at 32°C, indicating that no other factor important for DNA replication was compromised at the restrictive temperature. E1A did still stimulate cells to enter S phase: the fraction of BrdUrd-incorporating cells increased by 3.8-fold, compared with vector-transfected cells at 39°C, and by over 2-fold relative to the level recorded in control cultures at 32°C. E1A
2-36 was only slightly less effective than wild-type E1A at 39°C (causing a 3.4-fold increase in the fraction of S-phase cells); thus, in the absence of functional RCC1, the removal of the E1A ENT region has no dramatic effect. Both E1A
121-128 and the E1A
2-36/CR2 double mutant were somewhat less active, suggesting a higher requirement of CR2 integrity for S-phase induction by E1A when RCC1/Ran functions are impaired.
|
2-36 mutant or pCDNA3 vector (negative control), together with a GFP marker. The HPV-16 E7 was used for comparison, because it is known to disrupt control of centrosome duplication (27
, 41)
. GFP-positive cells were analyzed by IF to
-tubulin, a pericentriolar protein required for microtubule nucleation from centrosomes. Wild-type E1A expression yielded supernumerary centrosomes during interphase; examples from NIH/3T3 and BHK21 cell cultures are shown in Fig. 3, A and B
-tubulin antibody to visualize microtubules. Examples of abnormal spindles in E1A-transfected BHK21 cell cultures are shown in Fig. 3, E and G
2-36 yielded non-statistically significant variations in centrosome numbers compared with vector-transfected controls. Thus, E1A expression yields supernumerary centrosomes and abnormal spindles, and the 1-36 ENT domain is required for this effect.
|
As shown in Fig. 4
, in tsBN2 cells cultured at 32°C, i.e., in a functional RCC1 background, wild-type E1A induced supernumerary centrosomes visualized by
-tubulin IF in a significant fraction of cells compared with vector-transfected cells (P < 0.001). Actually, nearly one-third of E1A-expressing tsBN2 cells had abnormal centrosome numbers. In tsBN2 cells that reached mitosis at the permissive temperature, centrosomal abnormalities again yielded abnormal chromosome arrangements and aberrant mitotic spindles (data not shown), as seen in other rodent cell lines (Fig. 3)
. As previously observed in BHK21 and NIH/3T3 cell cultures, E1A
2-36 failed to induce supernumerary centrosomes at significant levels. Interestingly, the E1A
121-128 mutant retained a somewhat higher ability to induce centrosomal abnormalities (2-fold increase relative to the basal level recorded in control cultures), whereas the E1A
2-36/CR2 was virtually ineffective. These results confirm that the ENT region is required to disrupt centrosome control. When transfected tsBN2 cell cultures were transferred to 39°C, wild-type E1A failed to induce supernumerary centrosomes to any significant extent compared with control cultures. These results do not reflect impaired E1A expression at 39°C, because E1A effectively induced supernumerary centrosomes in BHK21 cultures shifted to 39°C and in tsBN2 cells simultaneously cotransfected with wild-type RCC1 before shifting the temperature to 39°C (data not shown).
|
|
|
2-36, and tested the ability of recombinant RCC1 to exchange nucleotide on bacterially produced Ran conjugated with an insoluble matrix. GTP exchange on Ran was highly stimulated in the presence of RCC1, as described previously (46)
. The addition of wild-type E1A remarkably reduced the RCC1-dependent increase in the exchange rate; instead, addition of the E1A
2-36 mutant that cannot bind Ran did not significantly affect the exchange rate (Fig. 6)
121-128 mutant, which can interact with Ran, exerted an intermediate effect on the RCC1-dependent nucleotide exchange. Thus, these results indicate that, although CR2 is not irrelevant, the ENT region of E1A specifically and critically interferes with the nucleotide cycle on Ran.
|
|
| DISCUSSION |
|---|
|
|
|---|
We also demonstrate for the first time that E1A physically interacts with the Ran GTPase. This interaction involves the ENT region of E1A, namely the most NH2-terminal 136 amino acid residues. The ENT region is critically required for the ability of E1A to induce supernumerary centrosomes, suggesting that the physical interaction with Ran is a step toward the induction of centrosome amplification by E1A. In retrospect, these findings are consistent with, and may provide an explanation for, earlier observations that the E1A NH2-terminal region is critical in the induction of cytogenetic damage (49) . When E1A was expressed in the conditional tsBN2 cell line, expressing a thermolabile version of the RCC1 nucleotide exchange factor on Ran, supernumerary centrosomes were induced only in permissive conditions for RCC1 activity.
The conditional effect of E1A on centrosome control does not reflect failed nuclear import, or inactivity, of E1A in cultures lacking functional RCC1. E1A effectively induces S-phase entry at both the permissive and the restrictive temperatures for RCC1 function, i.e., independent on a full Ran cycle. Thus, the activating effect of E1A on DNA replication and its role in centrosome amplification are differentially sensitive to the functional integrity of the Ran network.
In normal cells, because of the high intracellular ratio of GTP:GDP, the exchange reaction catalyzed by RCC1 in the nucleus prevalently generates RanGTP. In the presence of wild-type E1A, the exchange activity on Ran is inhibited in vitro. E1A
2-36 fails to inhibit RCC1-mediated nucleotide exchange on Ran, whereas E1A
121-128, which retains the Ran-binding epitope, displays an intermediate effect. These results suggest that the ENT region, although necessary, is not absolutely sufficient for the inhibition of RCC1-mediated exchange, suggesting, therefore, that the complete structure assumed by full-length E1A is important for effective RCC1 inhibition. E1A failed to interact with RCC1 in coprecipitation assays in vitro or in the yeast two-hybrid assay in vivo (data not shown). Together, these results indicate that wild-type E1A requires a direct interaction with Ran, but not with RCC1, to inhibit RCC1-dependent nucleotide exchange on Ran. The present results also suggest that the ability of E1A to interfere with RanGTP generation by RCC1 underlies the oncoprotein ability to interfere with Ran-dependent functions.
The Ran GTPase has a clear function in interphase cells, in which the spatial regulation of GTP nucleotide hydrolysis (in the cytoplasm) and exchange (in the nucleus) on Ran controls the directionality of transport of macromolecules into and out of the nucleus (14) . Ran also acts in pathways of mitotic spindle formation. In Schizosaccharomyces pombe, the Spi1 gene, encoding the Ran GTPase, interacts genetically with cut 11, encoding a component of the spindle pole body. Spi1 and cut11 mutations are synthetically lethal, directly linking Ran function to centrosomes (50) . In addition, RanGTP regulates the release of spindle activating factors (SAFs), which can, in turn, interact with centrosomal proteins (17 , 18) . It may be hypothesized that as-yet-unidentified centrosomal activities also respond to Ran, and that E1A interferes with this control.
Regulatory mechanism(s) that ensure the occurrence of only one round of centrosome duplication per cell cycle operate at multiple steps and are coupled to cell cycle-dependent controls (51) . Positively acting factors, including E2F1 and Cdk2, activate duplication of parental centrioles during S phase (52) ; these factors are known targets of deregulation by viral oncoproteins (reviewed in Refs. 7 and 25 ). Later in the cell cycle, negatively acting regulators with a "licensing" function are thought to monitor duplication of parental centrioles to avoid reduplication within the same cell cycle (52, 53, 54) . Cytokinesis failure can also give rise to cells with abnormal centrosome numbers (55) . The latter mechanism does not appear to be targeted in the induction of centrosome amplification by E1A, because in our experiments, the rate of abnormal cytokinesis figures and binucleate cells in tsBN2 and BHK21 cultures was modified neither by RCC1 function nor by E1A expression, under conditions in which supernumerary centrosomes were instead induced (data not shown). Rather, one or more factors acting to trigger centrosome duplication or prevent reduplication may be deregulated, and/or mislocalized, when E1A interferes with Ran function. A similar model may apply to centrosomal aberrations induced by HPV-16 E7 (26) , which, in our experiments, proved capable of interacting with Ran, at least in vitro, as did SV40 large T Ag. The finding that both E1A and E7 physically interact with Ran suggests that these oncoproteins, besides their established role in interfering with pRb/E2F-dependent pathways, can deregulate the centrosome cycle by altering Ran GTPase-dependent control directly.
Interestingly E1A up-regulates expression of RanBP1 (56) by interfering with Rb/E2F-dependent control of RanBP1 transcription (57 , 58) . The increase in RanBP1 level is expected to contribute to down-regulating RCC1 exchange activity (59) , further supporting the view that E1A can disrupt multiple levels of control, culminating in the generation of genetic instability. More generally, RanBP1 is overexpressed in at least certain transformed cell lines (56) and is abnormally abundant in liver cancer samples.5 Furthermore, a recent microarray screening identifies both RanBP1 and RCC1 as down-regulated target genes of a novel anticancer drug (60) . Thus, deregulation of the Ran network may be a step in the induction of genomic instability in various pathways of cellular transformation.
In conclusion, the Ran GTPase is a novel target of E1A in the pathways controlling centrosome homeostasis. This might represent a novel shared function among the viral oncoproteins E1A, E7, and large T Ag. Acute expression of these oncoproteins can be viewed as a key event in DNA virus-induced genomic instability.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the National Research Council (Consiglio Nazionale delle Ricerche) and by grants from Associazione Italiana Ricerca sul Cancro (to P. L. and M. G. P.), Ministero della Sanità (to M. G. P.), and Federazione Italiana Ricerca Cancro (FIRC; to A. D. L.). A. S. is a FIRC research fellow. ![]()
2 A. D. L., R. M., and A. S. contributed equally to this work. ![]()
3 To whom requests for reprints should be addressed, at CNR, Institute of Molecular Biology and Pathology, Section of Genetics, c/o Department of Genetics and Molecular Biology, University "La Sapienza," Via degli Apuli, 4, 00185 Rome, Italy. Phone: 39-06-4991-7536; Fax: 39-06-445-7529; E-mail: patrizia.lavia{at}uniroma1.it; or at Regina Elena Cancer Institute, CRS, Via delle Messi dOro, 156, 00158 Rome, Italy. Phone: 39-06-5266-2550; Fax: 39-06-5266-2572; E-mail: paggi{at}temple.edu ![]()
4 The abbreviations used are: ENT, extreme NH2 terminus/terminal; RanBP1, Ran-binding protein 1; GST, glutathione S-transferase; BrdUrd, bromodeoxyuridine; GFP, green fluorescent protein; IF, immunofluorescence; FADD, Fas-associating protein with death domain; T Ag, T antigen. ![]()
5 X. W. Wang (National Cancer Institute, NIH, Bethesda, MD), personal communication. ![]()
Received 8/ 1/02. Accepted 1/16/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Pelka, J. N. G. Ablack, G. J. Fonseca, A. F. Yousef, and J. S. Mymryk Intrinsic Structural Disorder in Adenovirus E1A: a Viral Molecular Hub Linking Multiple Diverse Processes J. Virol., August 1, 2008; 82(15): 7252 - 7263. [Full Text] [PDF] |
||||
![]() |
M. B. Gill, J. L. Kutok, and J. D. Fingeroth Epstein-Barr Virus Thymidine Kinase Is a Centrosomal Resident Precisely Localized to the Periphery of Centrioles J. Virol., June 15, 2007; 81(12): 6523 - 6535. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-H. Yih, Y.-Y. Tseng, Y.-C. Wu, and T.-C. Lee Induction of Centrosome Amplification during Arsenite-Induced Mitotic Arrest in CGL-2 Cells Cancer Res., February 15, 2006; 66(4): 2098 - 2106. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Balsitis, F. Dick, D. Lee, L. Farrell, R. K. Hyde, A. E. Griep, N. Dyson, and P. F. Lambert Examination of the pRb-Dependent and pRb-Independent Functions of E7 In Vivo J. Virol., September 1, 2005; 79(17): 11392 - 11402. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rasti, R. J. A. Grand, J. S. Mymryk, P. H. Gallimore, and A. S. Turnell Recruitment of CBP/p300, TATA-Binding Protein, and S8 to Distinct Regions at the N Terminus of Adenovirus E1A J. Virol., May 1, 2005; 79(9): 5594 - 5605. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yun, H. Cho, S.-J. Kim, J.-H. Lee, S. Y. Park, G. K. Chan, and H. Cho Mitotic Aberration Coupled With Centrosome Amplification Is Induced by Hepatitis B Virus X Oncoprotein via the Ras-Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase-Mitogen-Activated Protein Pathway Mol. Cancer Res., March 1, 2004; 2(3): 159 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Balsitis, J. Sage, S. Duensing, K. Munger, T. Jacks, and P. F. Lambert Recapitulation of the Effects of the Human Papillomavirus Type 16 E7 Oncogene on Mouse Epithelium by Somatic Rb Deletion and Detection of pRb-Independent Effects of E7 In Vivo Mol. Cell. Biol., December 15, 2003; 23(24): 9094 - 9103. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |