Cancer Research Targets  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Luca, A.
Right arrow Articles by Paggi, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Luca, A.
Right arrow Articles by Paggi, M. G.
[Cancer Research 63, 1430-1437, March 15, 2003]
© 2003 American Association for Cancer Research


Virology

E1A Deregulates the Centrosome Cycle in a Ran GTPase-dependent Manner1

Antonio De Luca2, Rosamaria Mangiacasale2, Anna Severino2, Lorenzo Malquori, Alfonso Baldi, Antonella Palena, Anna Maria Mileo, Patrizia Lavia3 and Marco G. Paggi3

Department for the Development of Therapeutic Programs, Laboratory "C," Regina Elena Cancer Institute, CRS, Rome [A. D. L., A. S., A. B., A. M. M., M. G. P.], and Section of Genetics, Institute of Molecular Biology and Pathology, National Research Council, Rome [R. M., L. M., A. P., P. L.], Italy


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
By means of the yeast two-hybrid system, we have discovered a novel physical interaction between the adenovirus E1A oncoprotein and Ran, a small GTPase which regulates nucleocytoplasmic transport, cell cycle progression, and mitotic spindle organization. Expression of E1A elicits induction of S phase and centrosome amplification in a variety of rodent cell lines. The induction of supernumerary centrosomes requires functional RCC1, the nucleotide exchange factor for Ran and, hence, a functional Ran network. The E1A portion responsible for the interaction with Ran is the extreme NH2-terminal region (amino acids 1–36), which is also required for the induction of centrosome amplification. In an in vitro assay with recombinant proteins, wild-type E1A interferes with nucleotide exchange on Ran, whereas an E1A mutant, deleted from the extreme NH2-terminal region, does not. In addition, we detected an in vitro interaction between Ran and HPV-16 E7 and SV40 large T antigen, two oncoproteins functionally related to E1A. These findings suggest a common pathway of these oncoproteins in eliciting virus-induced genomic instability.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenovirus E1A are potent oncoproteins engineered to heavily reprogram gene expression and, ultimately, the fate of host cells (1) . The 289R and 243R forms of E1A are the most abundant translated products and are synthesized immediately after infection (2) . Multiple, sometimes antithetical, functions have been attributed to these proteins, including as diverse effects as induction of cellular proliferation and transformation, inhibition of differentiation (3 , 4) , induction of apoptosis (5, 6, 7) , and tumor suppression (8, 9, 10, 11) . Viral oncoproteins disrupt the coordination of cell cycle events mainly by modifying the activity of endogenous cellular factors. The identification of such factors, therefore, is of fundamental relevance to thoroughly understand cell cycle regulatory networks and can help to devise novel targets that may be sensitive to anticancer therapies.

To expand our current knowledge of these multifaceted viral tools and their molecular targets in host cells, we have focused on the ENT4 region (amino acids 1–36), common to both 289R E1A and 243R E1A oncoproteins from human adenovirus (2) . Recently, we identified RACK1, a receptor for activated C kinase, as an E1A antagonizing factor, that physically interacts with the ENT region of E1A (12) . By means of the yeast two-hybrid system, we have now identified a novel physical interaction between adenovirus 2 E1A and the Ran GTPase. The Ran GTPase is the central element in a regulatory network that includes a GTPase-activating protein (RanGAP1), which catalyzes GTP hydrolysis on Ran producing RanGDP, and a guanine exchange factor termed RCC1, which catalyzes nucleotide exchange on Ran; both of these activities are modulated by RanBP1, which increases GTP hydrolysis by RanGAP1 and inhibits the exchange activity of RCC1. Activity of the network requires a full nucleotide exchange-and-hydrolysis cycle on Ran (13, 14, 15) . Ran plays a primary regulatory role in nucleocytoplasmic transport and cell cycle progression (reviewed in Refs. 14 and 16 ). Growing evidence also indicates a regulatory role of Ran in mitotic spindle organization (reviewed in Refs. 17 and 18 ). Ran network components specifically associate with mitotic structures in mammalian cells (19, 20, 21) . In addition, the induction of imbalance among components by overexpressing the RanBP1 protein yields abnormal mitoses, often with monopolar or multipolar spindles (19) . Spindle poles are organized by centrosomes, the major microtubule-organizing centers in eukaryotic cells. To ensure bipolarity in the mitotic spindle, centrosomes duplicate only once per cell cycle during S phase and separate in late G2 to give rise to two spindle poles. Errors in the centrosome duplication cycle give rise to multipolar spindles and, therefore, are regarded as a major cause of genomic instability (reviewed in Refs. 22, 23, 24, 25 ). Centrosome amplification occurs in many tumors and, in particular, in human carcinomas expressing the HPV16-derived E7 transforming protein (26 , 27) .

Here we have sought to dissect the functional significance of the interaction between E1A and Ran. We have found that E1A, like E7, deregulates the centrosome duplication cycle. This effect depends on both the ability of E1A to interact with Ran and on the functional integrity of the Ran network.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Yeast Two-Hybrid Selection.
The NH2-terminal region (nt 1–108, corresponding to amino acids 1–36) of the adenovirus 2 E1A 243R gene product was cloned into the EcoRI-BamHI sites of vector pGBKT7 (BD Clontech, Palo Alto, CA) in frame with the GAL4 binding domain. The yeast strain AH109 (28) , carrying UAS-His3, UAS-LacZ, and UAS-ADE2 reporter genes, was cotransformed with the pGBKT7-E1A1-36 bait and with a human HeLa cDNA library (BD Clontech) fused to the GAL4 activation domain in the pACT2 vector (BD Clontech). Transformation was carried out using the lithium acetate method (29) . Cells were plated on minimal synthetic defined medium (BD Clontech) supplemented with the required bases and amino acids, and lacking tryptophan (Trp), leucine (Leu), histidine (His), and adenine (Ade). Plates were incubated for 7 days at 30°C, then His+ Ade+ transformants were isolated. The His+ Ade+ colonies, replica-plated on synthetic defined Leu-Trp-His-Ade medium and LacZ+, were identified by a filter-lifting assay for ß-galactosidase activity. Plasmid DNA was prepared from candidate clones and transformed into Escherichia coli XL1-blue cells (Stratagene, La Jolla, CA). Recovered library-derived plasmids were analyzed by DNA sequencing.

Cell Lines.
BHK21 baby hamster kidney epithelial cells, and its derivative tsBN2 cell line, carrying a temperature-sensitive RCC1 allele (S256F; Ref. 30 ), were kindly provided by T. Nishimoto (University of Fukuoka, Fukuoka, Japan) and routinely maintained at the permissive temperature of 32°C or shifted to 39°C, as indicated in the text. NIH/3T3 murine embryo fibroblasts, L929 murine epithelial cells, PtK kangoroo-rat epithelial cells, and 293 human embryo kidney epithelial cells were cultured at 37°C. All of the cell lines were grown in DMEM containing 10% FCS in a 5% CO2 atmosphere.

Plasmids and Constructs.
Constructs expressing wild-type Ran, or T24N, Q69L, T42A, and C-del mutants (the latter lacking the six most COOH-terminal amino acids) were kind gifts from M. Rush and P. D’Eustachio (New York University, New York, NY). GST-tagged Ran was described by Dasso et al. (31) . The human RCC1 coding region (obtained from I. Mattaj, EMBL, Heidelberg, Germany) was PCR-amplified using a reverse primer encoding an in-frame HA tag (forward oligonucleotide: 5'CCAAGCTTATGGCCTCACCCAAGCGCATAGCTAAA3'; reverse oligonucleotide: 5'CGCGTCGACCTAAGCGTAGTCTGGGACGTCGTATGGGTAGCTCTGTTCTTTGTCCTTGAC3') and cloned in the pBluescript-derived pX expression vector (32) . Cytomegalovirus-based eukaryotic expression constructs and GST chimeric constructs for human adenovirus 2 E1A, E1A1-36 (amino acids 1 to 36) and E1A{Delta}2-36 were described (12) . Constructs for E1A{Delta}2-36/CR2, E1A{Delta}15-35, and E1A{Delta}121-128, described elsewhere (33) , were obtained from A. Felsani (Consiglio Nazionale delle Ricerche, Rome, Italy). The E1A{Delta}121-128 construct was also cloned into the cytomegalovirus-based Gateway system pDEST12.2 vector (Invitrogen, Carlsbad, CA). The pCDNA3-FADD construct was a kind gift from V. M. Dixit (University of Michigan, Ann Arbor, MI). The pEGFPN1 vector was from BD Clontech.

In Vitro Binding Assays.
One µg of plasmid encoding wild-type or mutant Ran was used to program a TnT rabbit reticulocyte lysate (Promega, Madison, WI) under the control of the T7 polymerase, in the presence of [35S]methionine (Amersham, Piscataway, NJ). Aliquots of the reaction mixture were added to glutathione/Sepharose beads coupled with 4 µg of GST chimerized with E1A wild-type, E1A{Delta}2-36, E1A{Delta}15-35, or E1A{Delta}121-128. Incubation was carried out in NENT buffer [20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5% NP40, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin] for 60 min at 4°C with gentle rocking. Beads were washed three times in NENT buffer, and electrophoresis was performed on 12% acrylamide SDS-PAGE. When higher ionic strength was required, NENT buffer was modified to bring the NaCl concentration to 250 mM and was used for both incubation and washes. Gels were dried and exposed at -70°C using Kodak Biomax MS films. When the ability of Ran to bind to different viral oncoproteins was assayed, 1 µg of plasmid encoding adenovirus E1A, HPV-16 E7, SV40 large T Ag, RanBP1 or FADD were used to program a TnT rabbit reticulocyte lysate as described above. The obtained radiolabeled proteins were incubated with glutathione/Sepharose beads coupled with 4 µg of GST-Ran. Incubation and washes were carried out in NENT buffer; then electrophoresis was performed on 10% acrylamide (for large T Ag, E1A, and RanBP1) or 12% acrylamide (for FADD and E7) SDS-PAGE. Detection was performed as described above.

In Vivo Coimmunoprecipitation.
293 cells were lysed in lysis buffer [50 mM Tris-HCl (pH 7.4), 5 mM EDTA, 250 mM NaCl, 50 mM NaF, 0.1% Triton X-100, 0.1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin] for 30 min on ice. Lysates were centrifuged at 14,000 x g for 10 min at 4°C. Lysates (800 µg) were cleared and incubated with anti-E1A M73 monoclonal antibody (34) or with purified mouse immunoglobulins (Pierce, Rockford, IL; immunoprecipitation Ip control antibody) for 2 h, followed by incubation with protein G-Sepharose beads in either lysis buffer (above), or Mg2+ [20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 2.5 mM MgCl2, 0.1% Triton X-100, and 10% glycerol] or EDTA buffer [20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, and 0.1% Triton X-100]. The beads were subjected to four rounds of washing with 1 ml of the appropriate buffer, then immunoprecipitates were eluted by adding electrophoresis sample buffer. Proteins were resolved through 12% acrylamide SDS-PAGE, transferred to polyvinylidene difluoride membranes and probed with anti-Ran C-20 (sc-1156) and anti-RanBP1 C-19 (sc-1160) antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA).

Nucleotide Exchange Assay.
Nucleotide exchange assays on Ran were performed essentially as described previously (35) . Briefly, exchange of labeled GTP for unlabeled GTP on wild-type Ran was examined using HisTag fusion protein immobilized on Ni-NTA Agarose (Qiagen GmbH, Hilden, Germany). The immobilized protein was equilibrated in 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, and 10% glycerol by washing the resin three times. Four hundred pmol of Ran fusion protein were loaded with 6 MBq of [{alpha}-32P]GTP (74 TBq/mmol; Amersham, Piscataway, NJ) and incubated for 20 min at room temperature. Excess labeled GTP was removed by washing the resin five times in 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 15 mM MgCl2. The resin was resuspended in the same buffer containing 0.5 mM unlabeled GTP, so that 50-µl aliquots contained loaded Ran at the concentration of 0.5 µM, in the presence or absence of 0.1 µM eluted HisTag-RCC1 protein. Individual aliquots were incubated for 7–10 min at 30°C with eluted GST-E1A wild-type, GST-E1A{Delta}2-36, or GST-E1A{Delta}121-128 (0.5 µM). Reactions were terminated by adding 500 µl of ice-cold buffer and were centrifuged. Supernatant and pellet (resin) fractions were subjected to radioactivity counting.

Transfections.
Cells were transfected in 60-mm culture dishes with 3 µg of E1A or mutagenized derivatives and 0.5 µg of pEGFPN1 as marker, using a LipofectAMINE/DNA mixture (5 µl/µg; Invitrogen, Carlsbad, CA) in DMEM containing 0.5% FCS. Six h later, the transfection medium was replaced with fresh medium, and incubation was continued for 24 h. In experiments with tsBN2 cells, transfected cells were either kept at 32°C throughout the duration of the experiment or shifted to 39°C during the last 10 h before harvesting the cells.

Cell Cycle and Apoptosis Analysis.
To analyze the cell cycle phases, 1 x 106 cells were resuspended in PBS containing 0.1% Triton X-100, stained with 20 µg/ml propidium iodide (Sigma, St. Louis, MO) and analyzed using a FACStar-Plus flow cytometer (Becton-Dickinson; 10,000 events/sample). To evaluate apoptosis induction, cells were first analyzed through FSC-H/FL1-H biparametric graphs to gate out nontransfected cells. Transfected cells were selected and analyzed on a biparametric FSC-H/SSC-H graph to identify apoptotic cells as smaller (low FSC-H), and highly condensed and granular (high SSC-H), as compared with viable cells.

IF and Centrosome Analysis.
Cells transfected with E1A or derivatives were grown on glass coverslips in Petri dishes. Cells were fixed in 3.7% formaldehyde for 15 min at 4°C and were permeabilized in PBS containing 0.1% Triton X-100 for 10 min. After quenching in 0.1 M glycine, cells were fixed again in 100% methanol for 10 min at -20°C. In some experiments, cells were directly solubilized and fixed in 100% methanol for comparison. Fixed cells were preincubated in 20% goat serum or FCS for 30 min at 37°C in a humidified chamber. The following primary antibodies were used: rabbit anti-centrin 2 (kindly provided by M. Bornens, Institut Curie, Paris, France); monoclonal (GTU-88) and rabbit polyclonal anti-{gamma}-tubulin (T3559) antibodies (1:1000 dilution; both from Sigma); mouse anti-{alpha}-tubulin (3.5 µg/ml, clone B-5-1-2, T5168; Sigma); mouse anti-Ran (0.25 µg/ml, clone 20, R32620; BD Transduction Laboratories, Franklin Lakes, NJ) and mouse M73 anti-E1A (34) . After 1-h incubation, cells were washed three times in 0.1% Tween/PBS, further incubated for 30 min with antirabbit rhodamine-conjugated antibody (sc-2090; Santa Cruz Biotechnology Inc.) to detect centrin-2 and {gamma}-tubulin, or antimouse Texas Red-conjugated antibody (Vector Laboratories, Burlingame, CA) to detect Ran and E1A. Cell spreads were counterstained with 4',6-diamidino-2-phenylindole (DAPI; 0.1 µg/ml in distilled water) and were mounted in Vectashield (Vector Laboratories, Burlingame, CA). To monitor DNA replication, BrdUrd (45 µM final concentration) was added to the medium 1 h before harvesting; cells were then fixed and processed as above, except for a 10-min denaturation step in 4 N HCl. Mouse anti-BrdUrd antibody (20 µg/ml Clone Bu20a, M0744; Dako A/S, Glostrup, Denmark) and antimouse Texas Red-conjugated secondary antibody (see above) were used. Images were taken using an Olympus AX70 microscope configured for epifluorescence and equipped with a cooled camera device (Photometrics). For each sample, at least 100 GFP-expressing cells were counted and analyzed for centrosome number or BrdUrd incorporation.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
E1A Interacts with the Ran GTPase in Vitro and in Vivo.
In a first set of experiments, we used the yeast two-hybrid assay to search for novel proteins capable of interacting with the ENT domain of E1A. A human HeLa cDNA library was used in the screening. Among an estimated 1 x 106 screened transformants, 80 clones proved able to proliferate on histidine-deficient media, 31 of which were positive for the ß-galactosidase assay. Among rescued plasmids, the full-length Ran GTPase cDNA (GenBank M31469) was identified by DNA sequencing. To confirm the interaction between E1A and Ran using an independent approach, Ran was translated in vitro in the presence of [35S]methionine and challenged with GST-E1A, GST-E1A{Delta}2-36, or GST-E1A1-36 chimeric constructs, or with GST alone. As shown in Fig. 1ACitation , Ran coprecipitated with GST-E1A wild-type, GST-E1A1-36 and GST-E1A{Delta}121-128 (which lacks 8 amino acids including the LXCXE motif in the CR2 region), but not with GST-E1A{Delta}2-36. Ran also interacted very weakly with the mutant GST-E1A{Delta}15-35. At higher ionic strength (250 mM NaCl), the interaction of Ran with GST-E1A{Delta}15-35 became undetectable (not shown). This indicates that disruption of the ENT-region integrity strongly impairs Ran binding, thereby confirming that the interaction between E1A and Ran is mediated by the ENT region. We next assayed in vitro translated Ran mutants as input. As shown in Fig. 1BCitation , GST-E1A interacted with Ran mutants, including T24N, which mimics RanGDP; two nonhydrolyzable mutants, i.e., Ran Q69L and RanT42A, mimicking RanGTP (35) ; and, finally, with a deletion mutant lacking the six most COOH-terminal amino acids, which mediate the interaction with Ran-binding protein(s) (36 , 37) ; in three independent experiments, the latter mutant showed a reproducibly lower affinity toward GST-E1A. We further assessed the ability of E1A to interact with Ran in vivo in 293 human embryonic kidney cells that constitutively express E1A proteins. After immunoprecipitation with M73 anti-E1A monoclonal antibody, endogenous Ran was detected by Western blot analysis in the E1A immunoprecipitate (Fig. 1C)Citation . Comparable results were obtained in conditions that favored stabilization of either RanGTP (Mg2+ buffer), or RanGDP (EDTA buffer; Ref. 38 ; Fig. 1DCitation ). The selective stabilization of GTP-bound or GDP-bound Ran from cell extract was controlled by analyzing RanBP1, which selectively interacts with RanGTP: indeed, RanBP1 was found to coprecipitate with Ran and E1A when the Mg2+ buffer was used.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Physical interaction between E1A and Ran. A, Ran association with GST-E1A, GST-E1A1-36, or GST-E1A{Delta}121-128; weak association with GST-E1A{Delta}15-35; no association with GST or GST-E1A{Delta}2-36. B, GST-E1A interacts with in vitro translated Ran T24N, Ran Q69L, Ran T42A, and Ran C-del. C, coimmunoprecipitation of endogenous E1A and Ran from 293 cell extract using M73 anti-E1A monoclonal antibody (Ab). D, same experiment as in C, performed in the presence of either Mg2+ or EDTA buffer. Ran coimmunoprecipitation is equally appreciable in both conditions, whereas RanBP1, which associates with only RanGTP, is mainly recovered in Mg2+ buffer.

 
Induction of S Phase by E1A Is Modulated by RCC1 Function.
To investigate the functional significance of the interaction between E1A and Ran, studies were carried out in cultured cells along two major experimental lines. First, we compared the effects of wild-type (243R) and mutant E1A versions. In particular, E1A{Delta}2-36, lacking the Ran-interacting ENT, was compared with E1A{Delta}121-128 [disrupted in the CR2 region responsible for the interaction with several regulators, including the Retinoblastoma family proteins (2) ] and with the double E1A{Delta}2-36/CR2 mutant, deleted in both ENT and CR2. Second, we forced E1A expression in cells proficient or defective for activity of the RCC1 nucleotide exchange factor on Ran, to determine whether the Ran background influenced the biological effects of E1A. We made use of the conditional tsBN2 cell line, derived from baby hamster kidney epithelial cells (BHK21), harboring a temperature-sensitive allele for RCC1, which encodes an active nucleotide exchange factor at the permissive temperature (32°C) but which is highly unstable at the restrictive temperature (39°C).

Dose-response experiments were first carried out in tsBN2 and BHK21 cell lines to identify a suitable dose of E1A construct that did not induce apoptosis: doses in the range of 2–3 µg of E1A DNA induced an apoptotic response similar to that induced by vector alone, i.e., not exceeding 12–15% of the cell population, in either permissive or nonpermissive conditions for RCC1 activity. To avoid detrimental effects on cell viability that may result from RCC1 inactivation during one entire cell cycle, asynchronously cycling tsBN2 cell cultures were transfected with E1A or its derivatives, were cultured for 24 h at the permissive temperature, and were then transferred to nonpermissive conditions for the last 10 h before terminating the experiment. Western blotting experiments indicated that mutant RCC1 was indeed degraded in tsBN2 but not in parental BHK21 cells, within 3 h after shifting the temperature to 39°C, whereas levels of the E1A protein were not affected (not shown).

The Ran network regulates several cell cycle transitions (16) , and in particular monitors the onset and termination of S phase (36 , 39) . As a first step to examine the effect of wild-type E1A or deleted derivatives on cell cycle progression, we evaluated the incorporation of BrdUrd in the nuclei of E1A-transfected cells, identified by fluorescent emission from a cotransfected GFP marker. The results of experiments at the permissive temperature (32°C) indicate that wild-type E1A stimulated tsBN2 cultures to enter S phase (3-fold increase; Fig. 2Citation ). E1A{Delta}2-36 was less effective in the induction of S phase (2-fold increase), similar to E1A{Delta}121-128, which cannot interact with Retinoblastoma family members. The comparable decrease in the efficiency of E1A{Delta}2-36 and E1A{Delta}121-128 mutants suggests that the ENT region plays a role in the pro-proliferative functions of E1A. When both domains were simultaneously removed (E1A{Delta}2-36/CR2), the ability of E1A to induce DNA replication was further impaired. At 39°C, fewer tsBN2 cells were found to replicate their DNA, because of RCC1 inactivation, as expected (16) . Reconstitution of the wild-type phenotype by transfecting wild-type RCC1 rescued this impairment and brought the fraction of BrdUrd-incorporating cells back to that seen in control cultures at 32°C, indicating that no other factor important for DNA replication was compromised at the restrictive temperature. E1A did still stimulate cells to enter S phase: the fraction of BrdUrd-incorporating cells increased by 3.8-fold, compared with vector-transfected cells at 39°C, and by over 2-fold relative to the level recorded in control cultures at 32°C. E1A{Delta}2-36 was only slightly less effective than wild-type E1A at 39°C (causing a 3.4-fold increase in the fraction of S-phase cells); thus, in the absence of functional RCC1, the removal of the E1A ENT region has no dramatic effect. Both E1A{Delta}121-128 and the E1A{Delta}2-36/CR2 double mutant were somewhat less active, suggesting a higher requirement of CR2 integrity for S-phase induction by E1A when RCC1/Ran functions are impaired.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Effect of E1A on the induction of S phase. The effect of wild-type or deleted E1A constructs was evaluated by IF scoring of BrdUrd-incorporating cells in tsBN2 cultures at permissive (32°C) or restrictive (39°C) temperature for RCC1 activity. Histograms, the frequency of S-phase cells; mean and SD values were calculated from four to eight independent experiments per construct per condition.

 
E1A Induces Centrosome Amplification in Rodent Cell Lines.
Because DNA replication and centrosome duplication are tightly coordinated during S phase, we asked whether E1A interfered with control of the centrosome cycle. We assayed a variety of rodent cell lines widely used for centrosome studies: L929 murine cells, used to demonstrate a centrosome-based cytokinesis checkpoint (40) ; kangoroo-rat PtK cells displaying well-formed centrosomes of large size, particularly suitable for cytological analysis; NIH/3T3 embryo fibroblasts; and, finally, BHK21 hamster cells, from which the tsBN2 cell line was derived. Cell lines were transfected with wild-type E1A, {Delta}2-36 mutant or pCDNA3 vector (negative control), together with a GFP marker. The HPV-16 E7 was used for comparison, because it is known to disrupt control of centrosome duplication (27 , 41) . GFP-positive cells were analyzed by IF to {gamma}-tubulin, a pericentriolar protein required for microtubule nucleation from centrosomes. Wild-type E1A expression yielded supernumerary centrosomes during interphase; examples from NIH/3T3 and BHK21 cell cultures are shown in Fig. 3, A and BCitation . In those cells that reached mitosis during the time of transfection, supernumerary centrosomes were associated with abnormal chromosome arrangements. The abnormal mitotic figures induced by wild-type E1A were similar to those induced by E7 in our (not shown) and other experiments (26 , 27) and were reminiscent of the aberrant arrangement typical of multipolar mitoses. To directly assess whether centrosomal abnormalities induced by E1A expression actually gave rise to abnormal spindles, cells from a parallel set of experiments were immunostained with anti-{alpha}-tubulin antibody to visualize microtubules. Examples of abnormal spindles in E1A-transfected BHK21 cell cultures are shown in Fig. 3, E and GCitation . Multipolar spindles in E1A-expressing cells yielded abnormal chromosome arrangements, similar to those associated with supernumerary centrosomes (Fig. 3, D and F)Citation . Consistent with the lack of a checkpoint devoted to monitoring the number of spindle poles in living cells (42) , these abnormal mitoses progressed to ana-telophase with unbalanced sets of chromatids segregating at multiple poles (Fig. 3, F and G)Citation . E1A-dependent abnormalities were actually distributed in all of the mitotic substages; among 400 scored mitoses, 4.76% of prophases showed abnormal asters in E1A-expressing cultures, whereas no abnormality was recorded in control cultures at that stage; 15.9% of E1A-overexpressing metaphases were misaligned versus 8.33% in control cultures; and 8.33% of ana-telophase displayed abnormal segregation patterns compared with 2.08% in controls transfected with empty vector. The induction of supernumerary centrosomes in E1A compared with vector-transfected cells was highly significant in all of the examined cell lines (Fig. 3C)Citation . In sharp contrast to these effects, expression of E1A{Delta}2-36 yielded non-statistically significant variations in centrosome numbers compared with vector-transfected controls. Thus, E1A expression yields supernumerary centrosomes and abnormal spindles, and the 1-36 ENT domain is required for this effect.



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Effect of E1A and HPV-16 E7 expression on centrosome number in rodent cells. A and B, IF analyses of centrosomes in E1A-transfected NIH/3T3 and BHK21 cells, respectively, using anti-{gamma}-tubulin antibody. C, the effect of the indicated oncoproteins was evaluated by calculating the percentage of cells displaying more than two centrosomes, among 300 scored cells for each construct in NIH/3T3 and BHK21 cultures, among 200 scored cells for each construct in L929 cultures, and among 100 scored cells for each construct in PtK cultures. *, significant; **, highly significant; Ps calculated by the {chi}2 test. D–G, mitotic figures from E1A-transfected BKH21 cell cultures, analyzed by IF against {gamma}-tubulin to visualize centrosomes (D, F) or {alpha}-tubulin (E, G) to visualize the spindle. D and E, abnormal metaphases; F and G, ana-telophases. Bar, 10 µm.

 
E1A Induction of Centrosome Amplification Requires Functional Ran.
Because the Ran-interacting ENT region of E1A is important for the induction of centrosome amplification, we next asked whether disruption of centrosome control by E1A was influenced by the RCC1 background. Transfection experiments were carried out in tsBN2 cells after incubation at the permissive or restrictive temperature, as described above, and the induction of centrosomal abnormalities was assessed by IF of centrosomal markers.

As shown in Fig. 4Citation , in tsBN2 cells cultured at 32°C, i.e., in a functional RCC1 background, wild-type E1A induced supernumerary centrosomes visualized by {gamma}-tubulin IF in a significant fraction of cells compared with vector-transfected cells (P < 0.001). Actually, nearly one-third of E1A-expressing tsBN2 cells had abnormal centrosome numbers. In tsBN2 cells that reached mitosis at the permissive temperature, centrosomal abnormalities again yielded abnormal chromosome arrangements and aberrant mitotic spindles (data not shown), as seen in other rodent cell lines (Fig. 3)Citation . As previously observed in BHK21 and NIH/3T3 cell cultures, E1A{Delta}2-36 failed to induce supernumerary centrosomes at significant levels. Interestingly, the E1A{Delta}121-128 mutant retained a somewhat higher ability to induce centrosomal abnormalities (2-fold increase relative to the basal level recorded in control cultures), whereas the E1A{Delta}2-36/CR2 was virtually ineffective. These results confirm that the ENT region is required to disrupt centrosome control. When transfected tsBN2 cell cultures were transferred to 39°C, wild-type E1A failed to induce supernumerary centrosomes to any significant extent compared with control cultures. These results do not reflect impaired E1A expression at 39°C, because E1A effectively induced supernumerary centrosomes in BHK21 cultures shifted to 39°C and in tsBN2 cells simultaneously cotransfected with wild-type RCC1 before shifting the temperature to 39°C (data not shown).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effect of E1A constructs on centrosome number in RCC1-proficient or -deficient cells. The effect of wild-type and mutant E1A constructs on centrosome number was evaluated by IF against {gamma}-tubulin in tsBN2 cell cultures after incubation in permissive (32°C) or restrictive (39°C) conditions for RCC1 activity. Histograms, the frequency of cells with more than two centrosomes; mean and SD were calculated from four to eight independent experiments per construct per condition.

 
To confirm that wild-type E1A yielded true centrosome amplification in RCC1-proficient cells, after transfection, centrioles were also analyzed by IF against centrin-2, a protein localized in the centriole lumen. These experiments indicate that wild-type E1A significantly increases the number of centrioles per cell in both BHK21 and tsBN2 cell lines at the permissive temperature (Fig. 5B)Citation . In several instances, supernumerary centrioles were organized in clusters (Fig. 5A)Citation as though they were subjected to repeated rounds of duplication. No abnormalities were observed in E1A-transfected tsBN2 cells incubated at the restrictive temperature. Thus, the induction of centrosome amplification by E1A, besides requiring integrity of the Ran-interacting region of E1A, also requires RCC1 function.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effect of E1A and E7 on centriole number. Effect of wild-type E1A and E7 on centriole number in tsBN2 cells after incubation at the permissive (32°C) or restrictive (39°C) temperature for RCC1 activity. A, an example of clustered supernumerary centrioles in a tsBN2 cell after E1A transfection at 32°. Bar, 10 µm. B, histograms, the frequency of cells with more than four centrioles after IF against centrin-2. Mean and SD values were calculated from four independent experiments per construct per condition.

 
Subcellular Localization of E1A and Ran.
E1A is targeted to the nucleus through a COOH-terminal nuclear localization signal (43) . Nuclear import of nuclear localization signal substrates does take place in tsBN2 cells at 39°C (44) , although with reduced initial rate (45) . We checked the subcellular localization of E1A in tsBN2 cells cultured at both the permissive and the restrictive temperature. Cells were fixed with either paraformaldehyde, which fixes proteins at their subcellular location, or methanol, under which condition cytosolic proteins are partly extracted, whereas proteins interacting with macromolecular complexes and/or cellular structures are fixed. We found that shifting the cultures from permissive to restrictive temperature did not substantially affect the subcellular localization of E1A; E1A was nuclear in the greatest majority of paraformaldehyde-fixed tsBN2cells and was still found to be predominantly nuclear after partial extraction in methanol, at both temperatures (Table 1)Citation . Ran was also nuclear in 85% of paraformaldehyde-fixed tsBN2 cells at 32°C, whereas at 39°C, this fraction dropped to 65%; thus, consistent with other reports (45) , nucleocytoplasmic shuttling and localization of Ran are affected by the loss of RCC1 function.


View this table:
[in this window]
[in a new window]

 
Table 1 Subcellular localization of E1A and Ran in tsBN2 cells

 
E1A Interferes with Nucleotide Exchange on Ran in Vitro.
To clarify the molecular effect of the E1A ENT region on the Ran network, we carried out a nucleotide exchange assay, with or without the addition of recombinant wild-type E1A or E1A{Delta}2-36, and tested the ability of recombinant RCC1 to exchange nucleotide on bacterially produced Ran conjugated with an insoluble matrix. GTP exchange on Ran was highly stimulated in the presence of RCC1, as described previously (46) . The addition of wild-type E1A remarkably reduced the RCC1-dependent increase in the exchange rate; instead, addition of the E1A{Delta}2-36 mutant that cannot bind Ran did not significantly affect the exchange rate (Fig. 6)Citation . Interestingly, the E1A{Delta}121-128 mutant, which can interact with Ran, exerted an intermediate effect on the RCC1-dependent nucleotide exchange. Thus, these results indicate that, although CR2 is not irrelevant, the ENT region of E1A specifically and critically interferes with the nucleotide cycle on Ran.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Interference of E1A with RCC1-mediated nucleotide exchange on Ran. Radiolabeled GTP-loaded Ran was incubated with bacterially produced RCC1. The amount of label that remained bound to Ran (resin fraction) was expressed as a percentage of the total cpm recovered from both the resin and supernatant fractions; this yielded an exchange rate value that was normalized to 100%. The basal level of exchange (in the absence of RCC1) was 27 ± 3.4% of the normalized value. The histograms show the effect of wild-type and mutant E1A proteins on the rate of nucleotide exchange on Ran. Means and SEs were calculated from three to seven experiments performed in triplicate.

 
Interaction of HPV-16 E7 and SV40 Large T Ag Viral Oncoproteins with Ran.
In the light of the comparable effects of E1A and E7 expression on centrosome amplification, we investigated whether Ran physically interacts with E1A-homologous oncoproteins encoded by other DNA tumor viruses. Indeed, chimeric GST-Ran was capable of interacting physically with radiolabeled in vitro translated E1A, E7, or large T Ag proteins in an in vitro coprecipitation assay (Fig. 7)Citation . In vitro translated RanBP1 and FADD were assayed as positive and negative controls, respectively. These results indicate that the interaction of all three oncoproteins with Ran is specific, suggesting a shared ability to interfere with Ran-dependent pathways.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. HPV-16 E7 and SV40 large T Ag interact with Ran in vitro. GST-Ran fusion protein was incubated in the presence of in vitro translated E1A, E7, or large T Ag. All of the tested oncoproteins bind specifically to GST-Ran. In vitro translated RanBP1 and FADD are shown as positive and negative controls, respectively.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Growing evidence indicates that alterations in centrosome number or function frequently occur in cancer cells, giving rise to abnormal mitotic spindles and imbalanced chromosome segregation and, hence, contributing to the genomic instability of these cells. Indeed, centrosomal alterations are observed in cells lacking major tumor suppressors such as pRb and p53, or expressing oncoproteins such as HPV E7 (reviewed in Refs. 25 and 47 ). Adenovirus E1A oncoproteins have long been known to induce mitotic abnormalities, aneuploidy, and genomic instability (48 , 49) . Here we show that interference with control of the centrosome number is a novel function of E1A that places E1A upstream of processes implicated in genomic instability.

We also demonstrate for the first time that E1A physically interacts with the Ran GTPase. This interaction involves the ENT region of E1A, namely the most NH2-terminal 1–36 amino acid residues. The ENT region is critically required for the ability of E1A to induce supernumerary centrosomes, suggesting that the physical interaction with Ran is a step toward the induction of centrosome amplification by E1A. In retrospect, these findings are consistent with, and may provide an explanation for, earlier observations that the E1A NH2-terminal region is critical in the induction of cytogenetic damage (49) . When E1A was expressed in the conditional tsBN2 cell line, expressing a thermolabile version of the RCC1 nucleotide exchange factor on Ran, supernumerary centrosomes were induced only in permissive conditions for RCC1 activity.

The conditional effect of E1A on centrosome control does not reflect failed nuclear import, or inactivity, of E1A in cultures lacking functional RCC1. E1A effectively induces S-phase entry at both the permissive and the restrictive temperatures for RCC1 function, i.e., independent on a full Ran cycle. Thus, the activating effect of E1A on DNA replication and its role in centrosome amplification are differentially sensitive to the functional integrity of the Ran network.

In normal cells, because of the high intracellular ratio of GTP:GDP, the exchange reaction catalyzed by RCC1 in the nucleus prevalently generates RanGTP. In the presence of wild-type E1A, the exchange activity on Ran is inhibited in vitro. E1A{Delta}2-36 fails to inhibit RCC1-mediated nucleotide exchange on Ran, whereas E1A{Delta}121-128, which retains the Ran-binding epitope, displays an intermediate effect. These results suggest that the ENT region, although necessary, is not absolutely sufficient for the inhibition of RCC1-mediated exchange, suggesting, therefore, that the complete structure assumed by full-length E1A is important for effective RCC1 inhibition. E1A failed to interact with RCC1 in coprecipitation assays in vitro or in the yeast two-hybrid assay in vivo (data not shown). Together, these results indicate that wild-type E1A requires a direct interaction with Ran, but not with RCC1, to inhibit RCC1-dependent nucleotide exchange on Ran. The present results also suggest that the ability of E1A to interfere with RanGTP generation by RCC1 underlies the oncoprotein ability to interfere with Ran-dependent functions.

The Ran GTPase has a clear function in interphase cells, in which the spatial regulation of GTP nucleotide hydrolysis (in the cytoplasm) and exchange (in the nucleus) on Ran controls the directionality of transport of macromolecules into and out of the nucleus (14) . Ran also acts in pathways of mitotic spindle formation. In Schizosaccharomyces pombe, the Spi1 gene, encoding the Ran GTPase, interacts genetically with cut 11, encoding a component of the spindle pole body. Spi1 and cut11 mutations are synthetically lethal, directly linking Ran function to centrosomes (50) . In addition, RanGTP regulates the release of spindle activating factors (SAFs), which can, in turn, interact with centrosomal proteins (17 , 18) . It may be hypothesized that as-yet-unidentified centrosomal activities also respond to Ran, and that E1A interferes with this control.

Regulatory mechanism(s) that ensure the occurrence of only one round of centrosome duplication per cell cycle operate at multiple steps and are coupled to cell cycle-dependent controls (51) . Positively acting factors, including E2F1 and Cdk2, activate duplication of parental centrioles during S phase (52) ; these factors are known targets of deregulation by viral oncoproteins (reviewed in Refs. 7 and 25 ). Later in the cell cycle, negatively acting regulators with a "licensing" function are thought to monitor duplication of parental centrioles to avoid reduplication within the same cell cycle (52, 53, 54) . Cytokinesis failure can also give rise to cells with abnormal centrosome numbers (55) . The latter mechanism does not appear to be targeted in the induction of centrosome amplification by E1A, because in our experiments, the rate of abnormal cytokinesis figures and binucleate cells in tsBN2 and BHK21 cultures was modified neither by RCC1 function nor by E1A expression, under conditions in which supernumerary centrosomes were instead induced (data not shown). Rather, one or more factors acting to trigger centrosome duplication or prevent reduplication may be deregulated, and/or mislocalized, when E1A interferes with Ran function. A similar model may apply to centrosomal aberrations induced by HPV-16 E7 (26) , which, in our experiments, proved capable of interacting with Ran, at least in vitro, as did SV40 large T Ag. The finding that both E1A and E7 physically interact with Ran suggests that these oncoproteins, besides their established role in interfering with pRb/E2F-dependent pathways, can deregulate the centrosome cycle by altering Ran GTPase-dependent control directly.

Interestingly E1A up-regulates expression of RanBP1 (56) by interfering with Rb/E2F-dependent control of RanBP1 transcription (57 , 58) . The increase in RanBP1 level is expected to contribute to down-regulating RCC1 exchange activity (59) , further supporting the view that E1A can disrupt multiple levels of control, culminating in the generation of genetic instability. More generally, RanBP1 is overexpressed in at least certain transformed cell lines (56) and is abnormally abundant in liver cancer samples.5 Furthermore, a recent microarray screening identifies both RanBP1 and RCC1 as down-regulated target genes of a novel anticancer drug (60) . Thus, deregulation of the Ran network may be a step in the induction of genomic instability in various pathways of cellular transformation.

In conclusion, the Ran GTPase is a novel target of E1A in the pathways controlling centrosome homeostasis. This might represent a novel shared function among the viral oncoproteins E1A, E7, and large T Ag. Acute expression of these oncoproteins can be viewed as a key event in DNA virus-induced genomic instability.


    ACKNOWLEDGMENTS
 
We are grateful to Drs. T. Nishimoto, M. Rush, P. D’Eustachio, M. Bornens, A. Felsani, and V. M. Dixit for the gifts of constructs and cell lines. We also thank Dr. X. W. Wang for communicating unpublished results, Drs. E. Cundari, M. Ciciarello, and B. Di Fiore for helpful suggestions and advice, and M. Casenghi for experimental contributions to the early phases of this work.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the National Research Council (Consiglio Nazionale delle Ricerche) and by grants from Associazione Italiana Ricerca sul Cancro (to P. L. and M. G. P.), Ministero della Sanità (to M. G. P.), and Federazione Italiana Ricerca Cancro (FIRC; to A. D. L.). A. S. is a FIRC research fellow. Back

2 A. D. L., R. M., and A. S. contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at CNR, Institute of Molecular Biology and Pathology, Section of Genetics, c/o Department of Genetics and Molecular Biology, University "La Sapienza," Via degli Apuli, 4, 00185 Rome, Italy. Phone: 39-06-4991-7536; Fax: 39-06-445-7529; E-mail: patrizia.lavia{at}uniroma1.it; or at Regina Elena Cancer Institute, CRS, Via delle Messi d’Oro, 156, 00158 Rome, Italy. Phone: 39-06-5266-2550; Fax: 39-06-5266-2572; E-mail: paggi{at}temple.edu Back

4 The abbreviations used are: ENT, extreme NH2 terminus/terminal; RanBP1, Ran-binding protein 1; GST, glutathione S-transferase; BrdUrd, bromodeoxyuridine; GFP, green fluorescent protein; IF, immunofluorescence; FADD, Fas-associating protein with death domain; T Ag, T antigen. Back

5 X. W. Wang (National Cancer Institute, NIH, Bethesda, MD), personal communication. Back

Received 8/ 1/02. Accepted 1/16/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gallimore P. H., Turnell A. S. Adenovirus E1A: remodelling the host cell, a life or death experience. Oncogene, 20: 7824-7835, 2001.[Medline]
  2. Sang N., Caro J., Giordano A. Adenoviral E1A: everlasting tool, versatile applications, continuous contributions and new hypotheses. Front. Biosci., 7: D407-D413, 2002.
  3. Shenk T., Flint J. Transcriptional and transforming activities of the adenovirus E1A proteins. Adv. Cancer Res., 57: 47-85, 1991.[Medline]
  4. Nevins J. R. Adenovirus E1A: transcription regulation and alteration of cell growth control. Curr. Top. Microbiol. Immunol., 199(Pt 3): 25-32, 1995.[Medline]
  5. Debbas M., White E. Wild-type p53 mediates apoptosis by E1A, which is inhibited by E1B. Genes Dev., 7: 546-554, 1993.[Abstract/Free Full Text]
  6. Teodoro J. G., Shore G. C., Branton P. E. Adenovirus E1A proteins induce apoptosis by both p53-dependent and p53- independent mechanisms. Oncogene, 11: 467-474, 1995.[Medline]
  7. White E. Regulation of the cell cycle and apoptosis by the oncogenes of adenovirus. Oncogene, 20: 7836-7846, 2001.[Medline]
  8. Frisch S. M. Tumor suppression activity of adenovirus E1a protein: anoikis and the epithelial phenotype. Adv. Cancer Res, 80: 39-49, 2001.[Medline]
  9. Chinnadurai G. Adenovirus E1a as a tumor-suppressor gene. Oncogene, 7: 1255-1258, 1992.[Medline]
  10. Mymryk J. S. Tumour suppressive properties of the adenovirus 5 E1A oncogene. Oncogene, 13: 1581-1589, 1996.[Medline]
  11. Frisch S. M., Mymryk J. S. Adenovirus-5 e1a: paradox and paradigm. Nat. Rev. Mol. Cell. Biol., 3: 441-452, 2002.[Medline]
  12. Sang N., Severino A., Russo P., Baldi A., Giordano A., Mileo A. M., Paggi M. G., De Luca A. RACK1 interacts with E1A and rescues E1A-induced yeast growth inhibition and mammalian cell apoptosis. J. Biol. Chem., 276: 27026-27033, 2001.[Abstract/Free Full Text]
  13. Rush M. G., Drivas G., D’Eustachio P. The small nuclear GTPase Ran: how much does it run?. Bioessays, 18: 103-112, 1996.[Medline]
  14. Sazer S., Dasso M. The ran decathlon: multiple roles of Ran. J. Cell Sci., 113(Pt 7): 1111-1118, 2000.[Abstract]
  15. Clarke P. R., Zhang C. Ran GTPase: a master regulator of nuclear structure and function during the eukaryotic cell division cycle?. Trends Cell Biol., 11: 366-371, 2001.[Medline]
  16. Moore J. D. The Ran-GTPase and cell-cycle control. Bioessays, 23: 77-85, 2001.[Medline]
  17. Dasso M. The Ran GTPase: theme and variations. Curr. Biol., 12: R502 2002.[Medline]
  18. Melchior F. Ran GTPase cycle: one mechanism—two functions. Curr. Biol., 11: R257-R260, 2001.[Medline]
  19. Guarguaglini G., Renzi L., D’Ottavio F., Di Fiore B., Casenghi M., Cundari E., Lavia P. Regulated Ran-binding protein 1 activity is required for organization and function of the mitotic spindle in mammalian cells in vivo. Cell Growth Differ., 11: 455-465, 2000.[Abstract/Free Full Text]
  20. Joseph J., Tan S. H., Karpova T. S., McNally J. G., Dasso M. SUMO-1 targets RanGAP1 to kinetochores and mitotic spindles. J. Cell Biol., 156: 595-602, 2002.[Abstract/Free Full Text]
  21. Kalab P., Weis K., Heald R. Visualization of a Ran-GTP gradient in interphase and mitotic Xenopus egg extracts. Science (Wash. DC), 295: 2452-2456, 2002.[Abstract/Free Full Text]
  22. Pihan G. A., Doxsey S. J. The mitotic machinery as a source of genetic instability in cancer. Semin. Cancer Biol., 9: 289-302, 1999.[Medline]
  23. Lingle W. L., Salisbury J. L. The role of the centrosome in the development of malignant tumors. Curr. Top. Dev. Biol., 49: 313-329, 2000.[Medline]
  24. Brinkley B. R. Managing the centrosome numbers game: from chaos to stability in cancer cell division. Trends Cell Biol., 11: 18-21, 2001.[Medline]
  25. Munger K. Disruption of oncogene/tumor suppressor networks during human carcinogenesis. Cancer Investig., 20: 71-81, 2002.[Medline]
  26. Duensing S., Lee L. Y., Duensing A., Basile J., Piboonniyom S., Gonzalez S., Crum C. P., Munger K. The human papillomavirus type 16 E6 and E7 oncoproteins cooperate to induce mitotic defects and genomic instability by uncoupling centrosome duplication from the cell division cycle. Proc. Natl. Acad. Sci. USA, 97: 10002-10007, 2000.[Abstract/Free Full Text]
  27. Duensing S., Duensing A., Crum C. P., Munger K. Human papillomavirus type 16 E7 oncoprotein-induced abnormal centrosome synthesis is an early event in the evolving malignant phenotype. Cancer Res., 61: 2356-2360, 2001.[Abstract/Free Full Text]
  28. James P., Halladay J., Craig E. A. Genomic libraries and a host strain designed for highly efficient two- hybrid selection in yeast. Genetics, 144: 1425-1436, 1996.[Abstract]
  29. Gietz D., St Jean A., Woods R. A., Schiestl R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res., 20: 1425 1992.[Free Full Text]
  30. Nishimoto T., Eilen E., Basilico C. Premature of chromosome condensation in a ts DNA-mutant of BHK cells. Cell, 15: 475-483, 1978.[Medline]
  31. Dasso M., Seki T., Azuma Y., Ohba T., Nishimoto T. A mutant form of the Ran/TC4 protein disrupts nuclear function in Xenopus laevis egg extracts by inhibiting the RCC1 protein, a regulator of chromosome condensation. EMBO J., 13: 5732-5744, 1994.[Medline]
  32. Battistoni A., Guarguaglini G., Degrassi F., Pittoggi C., Palena A., Di Matteo G., Pisano C., Cundari E., Lavia P. Deregulated expression of the RanBP1 gene alters cell cycle progression in murine fibroblasts. J. Cell Sci., 110(Pt 19): 2345-2357, 1997.[Abstract]
  33. Wang H. G., Rikitake Y., Carter M. C., Yaciuk P., Abraham S. E., Zerler B., Moran E. Identification of specific adenovirus E1A N-terminal residues critical to the binding of cellular proteins and to the control of cell growth. J. Virol., 67: 476-488, 1993.[Abstract/Free Full Text]
  34. Harlow E., Franza B. R., Jr., Schley C. Monoclonal antibodies specific for adenovirus early region 1A proteins: extensive heterogeneity in early region 1A products. J. Virol, 55: 533-546, 1985.[Abstract/Free Full Text]
  35. Murphy G. A., Moore M. S., Drivas G., Perez d. l. O., Villamarin A., D’Eustachio P., Rush M. G. A T42A Ran mutation: differential interactions with effectors and regulators, and defect in nuclear protein import. Mol. Biol. Cell, 8: 2591-2604, 1997.[Abstract/Free Full Text]
  36. Ren M., Coutavas E., D’Eustachio P., Rush M. G. Effects of mutant Ran/TC4 proteins on cell cycle progression. Mol. Cell Biol., 14: 4216-4224, 1994.[Abstract/Free Full Text]
  37. Richards S. A., Lounsbury K. M., Carey K. L., Macara I. G. A nuclear export signal is essential for the cytosolic localization of the Ran binding protein, RanBP1. J. Cell Biol., 134: 1157-1168, 1996.[Abstract/Free Full Text]
  38. Nicolas F. J., Zhang C., Hughes M., Goldberg M. W., Watton S. J., Clarke P. R. Xenopus Ran-binding protein 1: molecular interactions and effects on nuclear assembly in Xenopus egg extracts. J. Cell Sci., 110(Pt 24): 3019-3030, 1997.[Abstract]
  39. Ren M., Drivas G., D’Eustachio P., Rush M. G. Ran/TC4: a small nuclear GTP-binding protein that regulates DNA synthesis. J. Cell Biol., 120: 313-323, 1993.[Abstract/Free Full Text]
  40. Piel M., Nordberg J., Euteneuer U., Bornens M. Centrosome-dependent exit of cytokinesis in animal cells. Science (Wash. DC), 291: 1550-1553, 2001.[Abstract/Free Full Text]
  41. Duensing S., Duensing A., Flores E. R., Do A., Lambert P. F., Munger K. Centrosome abnormalities and genomic instability by episomal expression of human papillomavirus type 16 in raft cultures of human keratinocytes. J. Virol., 75: 7712-7716, 2001.[Abstract/Free Full Text]
  42. Sluder G., Thompson E. A., Miller F. J., Hayes J., Rieder C. L. The checkpoint control for anaphase onset does not monitor excess numbers of spindle poles or bipolar spindle symmetry. J. Cell Sci., 110(Pt 4): 421-429, 1997.[Abstract]
  43. Lyons R. H., Ferguson B. Q., Rosenberg M. Pentapeptide nuclear localization signal in adenovirus E1a. Mol. Cell. Biol., 7: 2451-2456, 1987.[Abstract/Free Full Text]
  44. Kadowaki T., Goldfarb D., Spitz L. M., Tartakoff A. M., Ohno M. Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily. EMBO J., 12: 2929-2937, 1993.[Medline]
  45. Smith A. E., Slepchenko B. M., Schaff J. C., Loew L. M., Macara I. G. Systems analysis of Ran transport. Science (Wash. DC), 295: 488-491, 2002.[Abstract/Free Full Text]
  46. Bischoff F. R., Ponstingl H. Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1. Nature (Lond.), 354: 80-82, 1991.[Medline]
  47. Doxsey S. J. Centrosomes as command centres for cellular control. Nat. Cell Biol., 3: E105-E108, 2001.[Medline]
  48. Braithwaite A. W., Cheetham B. F., Li P., Parish C. R., Waldron Stevens L. K., Bellett A. J. Adenovirus-induced alterations of the cell growth cycle: a requirement for expression of E1A but not of E1B. J. Virol., 45: 192-199, 1983.[Abstract/Free Full Text]
  49. Caporossi D., Bacchetti S. Definition of adenovirus type 5 functions involved in the induction of chromosomal aberrations in human cells. J. Gen. Virol., 71(Pt 4): 801-808, 1990.[Abstract/Free Full Text]
  50. Fleig U., Salus S. S., Karig I., Sazer S. The fission yeast ran GTPase is required for microtubule integrity. J. Cell Biol., 151: 1101-1111, 2000.[Abstract/Free Full Text]
  51. Meraldi P., Lukas J., Fry A. M., Bartek J., Nigg E. A. Centrosome duplication in mammalian somatic cells requires E2F and Cdk2-cyclin A. Nat. Cell Biol., 1: 88-93, 1999.[Medline]
  52. Hinchcliffe E. H., Sluder G. "It takes two to tango": understanding how centrosome duplication is regulated throughout the cell cycle. Genes Dev., 15: 1167-1181, 2001.[Free Full Text]
  53. Meraldi P., Nigg E. A. The centrosome cycle. FEBS Lett., 521: 9-13, 2002.[Medline]
  54. Haase S. B., Winey M., Reed S. I. Multi-step control of spindle pole body duplication by cyclin-dependent kinase. Nat. Cell Biol., 3: 38-42, 2001.[Medline]
  55. Meraldi P., Honda R., Nigg E. A. Aurora-A overexpression reveals tetraploidization as a major route to centrosome amplification in p53-/- cells. EMBO J., 21: 483-492, 2002.[Medline]
  56. Di Matteo G., Fuschi P., Zerfass K., Moretti S., Ricordy R., Cenciarelli C., Tripodi M., Jansen-Durr P., Lavia P. Transcriptional control of the Htf9-A/RanBP-1 gene during the cell cycle. Cell Growth Differ., 6: 1213-1224, 1995.[Abstract]
  57. Di Fiore B., Palena A., Felsani A., Palitti F., Caruso M., Lavia P. Cytosine methylation transforms an E2F site in the retinoblastoma gene promoter into a binding site for the general repressor methylcytosine-binding protein 2 (MeCP2). Nucleic Acids Res., 27: 2852-2859, 1999.[Abstract/Free Full Text]
  58. Ishida S., Huang E., Zuzan H., Spang R., Leone G., West M., Nevins J. R. Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol. Cell. Biol., 21: 4684-4699, 2001.[Abstract/Free Full Text]
  59. Bischoff F. R., Krebber H., Smirnova E., Dong W., Ponstingl H. Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1. EMBO J., 14: 705-715, 1995.[Medline]
  60. Damm K., Hemmann U., Garin-Chesa P., Hauel N., Kauffmann I., Priepke H., Niestroj C., Daiber C., Enenkel B., Guilliard B., Lauritsch I., Muller E., Pascolo E., Sauter G., Pantic M., Martens U. M., Wenz C., Lingner J., Kraut N., Rettig W. J., Schnapp A. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J., 20: 6958-6968, 2001.[Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
P. Pelka, J. N. G. Ablack, G. J. Fonseca, A. F. Yousef, and J. S. Mymryk
Intrinsic Structural Disorder in Adenovirus E1A: a Viral Molecular Hub Linking Multiple Diverse Processes
J. Virol., August 1, 2008; 82(15): 7252 - 7263.
[Full Text] [PDF]


Home page
J. Virol.Home page
M. B. Gill, J. L. Kutok, and J. D. Fingeroth
Epstein-Barr Virus Thymidine Kinase Is a Centrosomal Resident Precisely Localized to the Periphery of Centrioles
J. Virol., June 15, 2007; 81(12): 6523 - 6535.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L.-H. Yih, Y.-Y. Tseng, Y.-C. Wu, and T.-C. Lee
Induction of Centrosome Amplification during Arsenite-Induced Mitotic Arrest in CGL-2 Cells
Cancer Res., February 15, 2006; 66(4): 2098 - 2106.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Balsitis, F. Dick, D. Lee, L. Farrell, R. K. Hyde, A. E. Griep, N. Dyson, and P. F. Lambert
Examination of the pRb-Dependent and pRb-Independent Functions of E7 In Vivo
J. Virol., September 1, 2005; 79(17): 11392 - 11402.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Rasti, R. J. A. Grand, J. S. Mymryk, P. H. Gallimore, and A. S. Turnell
Recruitment of CBP/p300, TATA-Binding Protein, and S8 to Distinct Regions at the N Terminus of Adenovirus E1A
J. Virol., May 1, 2005; 79(9): 5594 - 5605.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
C. Yun, H. Cho, S.-J. Kim, J.-H. Lee, S. Y. Park, G. K. Chan, and H. Cho
Mitotic Aberration Coupled With Centrosome Amplification Is Induced by Hepatitis B Virus X Oncoprotein via the Ras-Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase-Mitogen-Activated Protein Pathway
Mol. Cancer Res., March 1, 2004; 2(3): 159 - 169.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. J. Balsitis, J. Sage, S. Duensing, K. Munger, T. Jacks, and P. F. Lambert
Recapitulation of the Effects of the Human Papillomavirus Type 16 E7 Oncogene on Mouse Epithelium by Somatic Rb Deletion and Detection of pRb-Independent Effects of E7 In Vivo
Mol. Cell. Biol., December 15, 2003; 23(24): 9094 - 9103.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Luca, A.
Right arrow Articles by Paggi, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Luca, A.
Right arrow Articles by Paggi, M. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online