Cancer Research Grants  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kimura, E. T.
Right arrow Articles by Fagin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kimura, E. T.
Right arrow Articles by Fagin, J. A.
[Cancer Research 63, 1454-1457, April 1, 2003]
© 2003 American Association for Cancer Research


Advances in Brief

High Prevalence of BRAF Mutations in Thyroid Cancer

Genetic Evidence for Constitutive Activation of the RET/PTC-RAS-BRAF Signaling Pathway in Papillary Thyroid Carcinoma1

Edna T. Kimura, Marina N. Nikiforova, Zhaowen Zhu, Jeffrey A. Knauf, Yuri E. Nikiforov and James A. Fagin2

Division of Endocrinology and Metabolism [E. T. K., J. A. K., J. A. F.] and Department of Pathology [M. N. N., Z. Z., Y. E. N.], University of Cincinnati College of Medicine, Cincinnati, Ohio 45267


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Thyroid papillary cancers (PTCs) are associated with activating mutations of genes coding for RET or TRK tyrosine kinase receptors, as well as of RAS genes. Activating mutations of BRAF were reported recently in most melanomas and a small proportion of colorectal tumors. Here we show that a somatic mutation of BRAF, V599E, is the most common genetic change in PTCs (28 of 78; 35.8%). BRAFV599E mutations were unique to PTCs, and not found in any of the other types of differentiated follicular neoplasms arising from the same cell type (0 of 46). Moreover, there was no overlap between PTC with RET/PTC, BRAF, or RAS mutations, which altogether were present in 66% of cases. The lack of concordance for these mutations was highly unlikely to be a chance occurrence. Because these signaling proteins function along the same pathway in thyroid cells, this represents a unique paradigm of human tumorigenesis through mutation of three signaling effectors lying in tandem.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
PTCs3 are the most common thyroid malignant tumor. Characteristic chromosomal rearrangements linking the promoter and NH2-terminal domains of unrelated gene(s) to the COOH terminus of RET resulting in constitutively activated chimeric forms of the receptor (RET/PTC) are the genetic hallmark of this type of cancer. RET/PTC rearrangements are thought to be tumor-initiating events (1) and are specific to PTC. They are found in the majority of pediatric PTCs (2 , 3) and in most tumors from patients exposed to external radiation during childhood (4) , or to ionizing radiation after environmental disasters such as the Chernobyl nuclear reactor accident (3 , 5 , 6) . However, in PTC from adult patients, prevalence of RET/PTC rearrangements is much lower, usually between 5 and 30%, and quite variable in different reported series. Rearrangements of the tyrosine kinase receptor TRK have also been observed but are extremely rare (7) . Activating mutations of RAS, commonly found in follicular thyroid neoplasms, are also seen in a small subset of PTCs (8) . Taken together, these known oncogenes only account for a small fraction of adult PTCs, which in most cases are not associated with an identifiable genetic defect.

Constitutive activation of RET/PTC kinase activity promotes the interaction with Shc, an intermediate in the RAS pathway. RET-mediated transformation of NIH3T3 cells requires signaling via SHC-RAS-RAF-MEK (9) . In mammalian cells, there are three isoforms of the serine-threonine kinase RAF: ARAF, BRAF, and CRAF or RAF1, with different tissue distribution of expression (10) . Although all of the RAF isoforms activate MEK phosphorylation, they are differentially activated by oncogenic Ras. In addition, BRAF has higher affinity for MEK1 and MEK2, and is more efficient in phosphorylating MEKs than other RAF isoforms (11) . BRAF somatic mutations were reported recently in 66% of malignant melanomas (12) , and in <15% of colorectal (12 , 13) and ovarian cancers (12) . A total of 98% of the mutations in melanomas resulted from thymine-to-adenine transversions at nucleotide position 1796, resulting in a valine-to-glutamate substitution at residue 599 (V599E). This mutation is believed to mimic the phosphorylation in the activation segment by insertion of an acidic residue close to a site of regulated phosphorylation at serine 598. BRAFV599E exhibits elevated basal kinase activity and has diminished responsiveness to stimulation by oncogenic H-RAS. BRAFV599E also transformed NIH3T3 cells with higher efficiency than the wild-type form of the kinase, consistent with it functioning as an oncogene. Cancers with BRAFV599E had no mutations in RAS, presumably because of lack of cooperativity between these activating mutants, consistent with their transforming properties being relayed through the same signaling pathway (12) . Here we report that BRAF mutations are the most common genetic abnormality associated with thyroid papillary carcinomas and not present in any of the other types of differentiated follicular neoplasm we tested. Moreover, PTC had mutations in RET/PTC, RAS, or BRAF, with no overlap among them. These data provide genetic evidence that thyroid cell transformation to papillary cancers takes place through constitutive activation of effectors along the RET/PTC-RAS-BRAF signaling pathway.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Sample Selection and DNA Isolation.
We analyzed 124 snap-frozen tumor samples including 78 papillary carcinomas, 10 follicular carcinomas, 12 Hürthle cell carcinomas, 14 follicular adenomas, and 10 Hürthle cell adenomas. Hürthle or oncocytic cell tumors are derived from follicular cells and are thought to represent a distinct variant of follicular neoplasms. Tissues were obtained from the Department of Pathology at the University Hospital in Cincinnati with the help of the University of Cincinnati GCRC Tissue Procurement Facility, or through the Tissue Procurement Facility of the Cedars-Sinai Medical Center GCRC. Normal thyroid tissue from the same patients was also available in 6 papillary carcinoma cases. In addition, the following human cancer cell lines were studied: NPA and TPC1 (PTC), WRO (thyroid follicular carcinoma; Ref. 14 ), SKMel 28 (melanoma), and NCI-H1755 (non-small cell lung cancer). NPA and WRO cells were originally obtained from Guy Juilliard (University of California Los Angeles, Los Angeles, CA), TPC1 cells were obtained from Sissy M Jhiang (Ohio State University, Columbus, OH), and SKMel28 and NCI-HI1755 were from the American Type Culture Collection. DNA from tumor samples was extracted using phenol-chloroform method as described previously (15) and from cell lines with the Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN).

Detection of BRAF Mutations.
Mutations of BRAF reported recently in melanomas and colorectal cancers are confined to exons 11 and 15 (12 , 13) . DNA samples were screened by SSCP for mutations within these regions, as well as sequencing of gel-extracted and/or whole-sample PCR products. Primer pairs were designed flanking BRAF exons 11 and 15, respectively. PCR primer sequences were as follows: exon 11: 5'tctgtttggcttgacttgacttt 3' and 5'catgccactttcccttgtagac 3'; and exon 15: 5'aaactcttcataatgcttgctctg 3' and 5'ggccaaaaatttaatcagtgga 3'. Amplifications were carried out for 35 cycles with annealing temperatures optimized for each primer pair. Twenty five-µl PCR reactions were performed on 100 ng genomic DNA, 7.5 pmol of each primer, 100 µM deoxynucleoside triphosphates, 5 µCi [{alpha}32P]dCTP, 1.5 mM MgCl2, Platinum TaqDNA polymerase high fidelity (Invitrogen, Carlsbad, CA), and buffer. SSCP analysis was performed using a method reported previously (16) . The PCR reaction mixture was diluted in DNA gel-loading buffer (95% formamide, 10 mM NaOH, 0.25% bromphenol blue, and 0.25% xylene cyanol), denatured by incubating at 94 C for 5 min, placed on ice, and loaded onto a 0.6% mutation detection enhancement gel solution (BioWhittaker Molecular Applications, Rockland, ME) with 10% glycerol. Gels were run with 0.6x Tris-borate EDTA buffer at 8W for 7–10 h at room temperature. Autoradiography was performed with an intensifying screen at -70°C for 12–24 h. All of the PCR reactions from PTC samples were repeated at least twice.

Sequencing.
Genomic PCR products or aberrant SSCP bands cut directly from dried gels were sequenced. PCR reactions in 50 µl of final volume were performed as described above but with omission of radioactive nucleotide. A 2-µl aliquot was run on an agarose gel to verify the adequacy of the reaction, and the rest purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). Direct sequencing was performed using the BigDye v3.03 cycle sequencing kit (Applied Biosystems, Foster City, CA) in a capillary automatic sequencer (ABI PRISM 3100 Genetic Analyzer; Applied Biosystems) at the Cincinnati Children’s Hospital DNA Core Facility. Sequence comparisons were carried out using the BLAST Program (17) .4

Detection of RAS Mutations.
Sixty-seven human tumor samples were analyzed for point mutations in codons 12/13, and 61 of the N-RAS, H-RAS, and K-RAS genes using LightCycler (Roche) fluorescence melting curve analysis. Briefly, 100 ng of DNA from each tumor was amplified with primers flanking codons 12/13 or 61 of each RAS gene using a hybridization probe format followed by fluorescence melting curve analysis (18 , 19) . All of the PCR products that displayed a deviation from normal (placental DNA) melting pick were directly sequenced to verify the presence of RAS mutation and detect the exact nucleotide change.

Detection of RET Rearrangements.
Rearrangements of the RET gene were analyzed in 67 human tumor samples by Southern blot analysis. Briefly, 10 µg of DNA was digested separately with EcoRI, HindIII, BamHI, and BglII (Invitrogen), electrophoresed in 0.8% agarose gel, and transferred to nylon filters (Osmonics Inc., Minnetonka, MN). Hybridization was performed with a 1-kb BamHI-BglII RET-specific probe (20) 32P-labeled using a random oligonucleotide primer kit (Amersham Biosciences, Piscataway. NJ).

The researchers screening tumors for BRAF mutations and those genotyping for RET/PTC or RAS were blinded to their respective results until all of the experiments were concluded.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Altogether we identified 28 cancers with mutations in exon 15 of the BRAF gene of 124 samples studied. All had the same thymine-to-adenine transversion at nucleotide 1796, resulting in a valine-to-glutamate substitution at residue 599 (V599E). All of the BRAFV599E mutations were in papillary carcinomas (28 of 78: 36%; Table 1Citation ). By contrast, all 46 of the follicular neoplasms (follicular carcinomas, Hürthle cell carcinomas, follicular adenomas, and Hürthle cell adenomas) examined were wild-type. Of the four thyroid cancer cell lines examined, only the PTC line NPA had the BRAFV599E mutation. The TPC1 line, which is also derived from a PTC and is known to have the RET/PTC1 rearrangement, was wild-type for BRAF. The WRO cell line, derived from a follicular thyroid carcinomas did not have the BRAF mutation.


View this table:
[in this window]
[in a new window]

 
Table 1 Prevalence of BRAF mutations in thyroid neoplasms: BRAF mutations are unique to papillary thyroid cancers

 
A representative SSCP gel for exon 15 of BRAF is shown in Fig. 1Citation . As a positive control we used the melanoma cell line SKMel28, which, as reported, has the BRAFV599E mutation (12) . Both SKMel28 and NPA cells had a similar conformer pattern, consistent with the presence of only the mutant BRAF allele (Fig. 1, A and B)Citation , which was confirmed by sequencing (Fig. 1Citation , bottom panel). Also shown in Fig. 1ACitation is the SSCP pattern for 18 PTCs, 7 of which showed an aberrantly migrating band, which was confirmed by sequencing to correspond to BRAFV599E. The intensity of the abnormal BRAF band in PTC samples was consistently less than that of the wild-type allele. This is likely because of admixture of stromal tissue within the tumor sample, a known histopathological feature of this type of cancer. Mutations were somatic, as determined by analysis of 6 normal thyroid tissues from patients with PTC, 4 carrying the BRAF mutation (Fig. 1B)Citation . On microscopical examination, all of the PTCs positive for BRAF mutations were of classic papillary histotype.



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, SSCP analysis for BRAF exon 15 mutations in papillary thyroid carcinomas. M, SKMel 28 melanoma line, Positive control (BRAFV599E); L, normal subject blood lymphocytes; NPA, papillary carcinoma cell line. DNA from SKMel 28 and NPA lines had identical band shifts. Several papillary carcinoma tissue samples also had a similar band patterns. Samples with an abnormal band pattern are indicated by *. Aberrant bands were confirmed to have the BRAF mutation (V599E) by direct sequencing. B, the BRAF mutation in PTCs is somatic. Top, aberrant bands are shown in tumors, but not normal thyroid tissue, of cases 1–4. The papillary carcinoma for case 5 is wild-type. Bottom, sequence chromatogram of PCR product from normal tissue and corresponding tumor for cases 2 and 3. Tumors displaying altered SSCP banding pattern present a double peak ({downarrow}) at position 1796 in BRAF exon 15. This thymine (T) to adenine (A) transition introduces a substitution of amino acid valine to glutamic acid at codon 599 (V599E).

 
We found no mutations in exon 11 of BRAF in any of the 128 thyroid tumor samples or in the cell lines. SSCP gels were run under multiple conditions, using DNA from the NCI-H1755 non-small cell lung cancer cell line as a positive control (BRAFG468A; Ref. 12 ). Despite clear resolution of the known mutant sample, all of the PTCs exhibited a normal SSCP pattern (data not shown). Nine PTC samples with normal SSCP patterns that were also negative for BRAFV599E were randomly selected for sequencing, and all were found to be wild-type for exon 11.

A total of 67 papillary thyroid carcinomas were also analyzed for mutations in the known hot spots in the three RAS genes, as well as for RET/PTC rearrangements. The relative distribution of mutations of these genes in this large sample cohort is shown in Table 2Citation . BRAF was the most commonly mutated gene. Of those tumors positive for BRAF (22 of 67; 33%), none were positive for either RAS or RET/PTC. Of those that were RET/PTC positive (11 of 67; 16%), none had either BRAF or RAS mutations. Finally, none of the 11 PTCs with RAS mutations had BRAF or RET/PTC mutations.


View this table:
[in this window]
[in a new window]

 
Table 2 Lack of overlap among BRAF, RAS, and RET/PTC mutations in papillary carcinomas

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this article we show that a mutation in BRAF, in all likelihood somatic, is the most common genetic change in adult PTC, the most frequent type of endocrine malignant tumor. A single type of mutation was found, consistent with findings in human melanomas and colorectal carcinomas (12 , 13) . The BRAFV599E oncogene was found only in PTCs, and not in benign or malignant follicular neoplasms, indicating that this genetic event is likely to be one of the key determinants of the papillary cancer phenotype. In the original reports about this new oncogene, there was essentially no overlap between melanomas harboring RAS and BRAFV599E mutations (12 , 13) . This was interpreted as evidence that the constitutively active function of this particular BRAF mutant could not be additionally driven by oncogenic RAS, which was also demonstrated experimentally (12) . Here we show that two-thirds of PTCs harbored mutations of RET, RAS or BRAF, but in no single case was there a mutation in two of these genes. Of the two PTC cell lines studied, one had a mutation in RET/PTC (TPC1) and the other of BRAF (NPA). The human tumor data are unlikely be a chance occurrence and have potentially significant implications. They point to the centrality of the RET-SHC-RAS-BRAF pathway in thyroid cell transformation to papillary cancer, although they do not entirely negate a potential contribution of other effectors systems cooperative with either RET/PTC or RAS in thyroid cells. Constitutive activation of RET kinase is known to result in autophosphorylation of Y1062 in the COOH terminus of the receptor, which couples to SHC-RAS and drives transformation by RET in NIH3T3 cells (9) . Although this residue also mediates signaling along this pathway in rat thyroid cell lines, neither RET nor RAS are sufficient by themselves to induce thyroid cell transformation in vitro (21) . However, after co-overexpression of both of these effectors in rat thyroid cells, clones with a completely undifferentiated and transformed phenotype were observed (21) . Taken together, these data and the human tumor genetic evidence presented here support the notion that activating mutations of components of the RET-RAS-BRAF pathway are required but not sufficient for development of PTC. Whether RET and one of these two downstream effector mutants may cooperate in the development of more aggressive tumors is possible but unlikely based on our data and on the fact that RET/PTC rearrangements are uncommon in undifferentiated thyroid cancers.

Until this report, PTC was known to be associated primarily with rearrangements of genes coding for the tyrosine kinase receptor RET, and less commonly TRK. In this series, RET/PTC mutations were seen in 16% of PTCs, which is quite consistent with data in the literature from patients without documented history of radiation exposure (22) . As stated, one of the major risk factors for development of PTC is a history of prior exposure to radiation, and it is these particular tumors that have a high prevalence of rearranged oncogenic forms of RET (3 , 23 , 24) . Radiation-induced RET/PTC chimeric genes have been proposed to form because of direct double-strand DNA breaks resulting in illegitimate reciprocal recombination (25) favored by spatial juxtaposition of the participating loci during interphase in thyroid cells (6) . However, the great majority of patients with PTC do not have a history of radiation exposure. The fact that point mutations of BRAF and RAS may account for many of these provides a more plausible genetic mechanism for generation of these tumors in the general population.

It is notable that BRAF mutations are common in melanomas and thyroid cancers, because growth of melanocytes and thyrocytes is positively regulated by cAMP. In both cell types, cAMP activates MEK1 and extracellular signal-regulated kinases through mechanisms that may differ but that converge on BRAF. In thyroid cells, cAMP activates RAP1 guanine nucleotide exchange possibly via EPAC (26) , whereas in melanocytes cAMP activates RAS through a yet-unidentified exchange factor (27) . A similar cAMP-RAS mediated pathway has also been proposed in thyroid cells (28) . Regardless, BRAF is thought to be the key RAF isoform transducing the cAMP-dependent growth signal in both these cell types (27 , 29) , which may account for their vulnerability to transformation by activating mutations of this particular kinase.

This study was initiated with the presumption that follicular adenomas or carcinomas would be good candidates to harbor BRAF mutations, because ~25% of them have RAS mutations (8 , 30) . Therefore, the fact that we did not find BRAF mutations in follicular or Hürthle cell neoplasms was a notable and unexpected result. It is tempting to speculate based on these genetic data that the dominant type of RAS downstream effector pathway used may be important in thyroid tumor fate, with RAS acting via BRAF predisposing to PTC, and RAS through yet-unknown effectors favoring transformation to follicular neoplasms.


    ACKNOWLEDGMENTS
 
We thank Massimo Santoro for the RET-specific probe used for Southern blot analysis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by NIH Grants CA50706 and CA72597 (to J. A. F.), GCRC Grant MOIRR08084 and American Cancer Society grant RSG-03-027-01-CCE (to Y. E. N.). E. T. K. is recipient of Coordenaçao de Aperfeiçoamento de Pessoal de Nível Superior Grant BEX1891/01-4 from the Ministry of Education of Brazil, and is on leave from the Institute of Biomedical Science, University of São Paulo, São Paulo, Brazil. Back

2 To whom requests for reprints should be addressed, at Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0547. Phone: (513) 558-4444; Fax: (513) 558-8581; E-mail: james.fagin{at}uc.edu Back

3 The abbreviations used are: PTC, papillary thyroid cancer; MEK, mitogen-activated protein/extracellular signal-regulated kinase kinase; EPAC, exchange factor directly activated by cyclic AMP; GCRC, General Clinical Research Center; SSCP, single-strand conformational polymorphism; cAMP, cyclic AMP. Back

4 Internet address: http://www.ncbi.nlm.nih.gov/BLAST/. Back

Received 11/27/02. Accepted 2/18/03.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Viglietto G., Chiappetta G., Martinez-Tello F. J., Fukunaga F. H., Tallini G., Rigopoulou D., Visconti R., Mastro A., Santoro M., Fusco A. RET/PTC oncogene activation is an early event in thyroid carcinogenesis. Oncogene, 11: 1207-1210, 1995.[Medline]
  2. Fugazzola L., Pilotti S., Pinchera A., Vorontsova T. V., Mondellini P., Bongarzone I., Greco A., Astakhova L., Butti M. G., Demidchik E. P., et al Oncogenic rearrangements of the RET proto-oncogene in papillary thyroid carcinomas from children exposed to the Chernobyl nuclear accident. Cancer Res., 55: 5617-5620, 1995.[Abstract/Free Full Text]
  3. Nikiforov Y. E., Rowland J. M., Bove K. E., Monforte-Munoz H., Fagin J. A. Distinct pattern of ret oncogene rearrangements in morphological variants of radiation-induced and sporadic thyroid papillary carcinomas in children. Cancer Res., 57: 1690-1694, 1997.[Abstract/Free Full Text]
  4. Bounacer A., Wicker R., Caillou B., Cailleux A. F., Sarasin A., Schlumberger M., Suarez H. G. High prevalence of activating ret proto-oncogene rearrangements, in thyroid tumors from patients who had received external radiation. Oncogene, 15: 1263-1273, 1997.[Medline]
  5. Klugbauer S., Lengfelder E., Demidchik E. P., Rabes H. M. High prevalence of RET rearrangement in thyroid tumors of children from Belarus after the Chernobyl reactor accident. Oncogene, 11: 2459-2467, 1995.[Medline]
  6. Nikiforova M. N., Stringer J. R., Blough R., Medvedovic M., Fagin J. A., Nikiforov Y. E. Proximity of chromosomal loci that participate in radiation-induced rearrangements in human cells. Science (Wash. DC), 290: 138-141, 2000.[Abstract/Free Full Text]
  7. Pierotti M. A., Bongarzone I., Borrello M. G., Mariani C., Miranda C., Sozzi G., Greco A. Rearrangements of TRK proto-oncogene in papillary thyroid carcinomas. J. Endocrinol. Investig., 18: 130-133, 1995.[Medline]
  8. Namba H., Rubin S. A., Fagin J. A. Point mutations of ras oncogenes are an early event in thyroid tumorigenesis. Mol. Endocrinol., 4: 1474-1479, 1990.[Abstract/Free Full Text]
  9. Asai N., Murakami H., Iwashita T., Takahashi M. A mutation at tyrosine 1062 in MEN2A-Ret and MEN2B-Ret impairs their transforming activity and association with shc adaptor proteins. J. Biol. Chem., 271: 17644-17649, 1996.[Abstract/Free Full Text]
  10. Daum G., Eisenmann-Tappe I., Fries H. W., Troppmair J., Rapp U. R. The ins and outs of Raf kinases. Trends Biochem. Sci., 19: 474-480, 1994.[Medline]
  11. Peyssonnaux C., Eychene A. The Raf/MEK/ERK pathway: new concepts of activation. Biol. Cell., 93: 53-62, 2001.[Medline]
  12. Davies H., Bignell G. R., Cox C., Stephens P., Edkins S., Clegg S., Teague J., Woffendin H., Garnett M. J., Bottomley W., Davis N., Dicks E., Ewing R., Floyd Y., Gray K., Hall S., Hawes R., Hughes J., Kosmidou V., Menzies A., Mould C., Parker A., Stevens C., Watt S., Hooper S., Wilson R., Jayatilake H., Gusterson B. A., Cooper C., Shipley J., Hargrave D., Pritchard-Jones K., Maitland N., Chenevix-Trench G., Riggins G. J., Bigner D. D., Palmieri G., Cossu A., Flanagan A., Nicholson A., Ho J. W., Leung S. Y., Yuen S. T., Weber B. L., Seigler H. F., Darrow T. L., Paterson H., Marais R., Marshall C. J., Wooster R., Stratton M. R., Futreal P. A. Mutations of the BRAF gene in human cancer. Nature (Lond.), 417: 949-954, 2002.[Medline]
  13. Rajagopalan H., Bardelli A., Lengauer C., Kinzler K. W., Vogelstein B., Velculescu V. E. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature (Lond.), 418: 934 2002.[Medline]
  14. Fagin J. A., Matsuo K., Karmakar A., Chen D. L., Tang S. H., Koeffler H. P. High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. J. Clin. Investig., 91: 179-184, 1993.
  15. Nikiforov Y. E., Nikiforova M. N., Gnepp D. R., Fagin J. A. Prevalence of mutations of ras and p53 in benign and malignant thyroid tumors from children exposed to radiation after the Chernobyl nuclear accident. Oncogene, 13: 687-693, 1996.[Medline]
  16. Zeki K., Spambalg D., Sharifi N., Gonsky R., Fagin J. A. Mutations of the adenomatous polyposis coli gene in sporadic thyroid neoplasms. J. Clin. Endocrinol., 79: 1317-1321, 1994.[Abstract]
  17. Tatusova T. A., Madden T. L. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett., 174: 247-250, 1999.[Medline]
  18. Elenitoba-Johnson K. S., Bohling S. D., Wittwer C. T., King T. C. Multiplex PCR by multicolor fluorimetry and fluorescence melting curve analysis. Nat. Med., 7: 249-253, 2001.[Medline]
  19. Nikiforova, M. N., Lynch, R. A., Biddinger, P. W., Alexander, E. K., Dorn, G. W., Tallini, G., Kroll, T. G., and Nikiforov, Y. E. RAS point mutations and PAX8-PPAR{gamma} rearrangement in thyroid tumors: evidence for distinct molecular pathways in thyroid follicular carcinoma. J. Clin. Endocrinol. Metab., in press, 2003.
  20. Santoro M., Carlomagno F., Hay I. D., Herrmann M. A., Grieco M., Melillo R., Pierotti M. A., Bongarzone I., Della Porta G., Berger N., et al Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. J. Clin. Investig., 89: 1517-1522, 1992.
  21. Santoro M., Melillo R. M., Grieco M., Berlingieri M. T., Vecchio G., Fusco A. The TRK and RET tyrosine kinase oncogenes cooperate with ras in the neoplastic transformation of a rat thyroid epithelial cell line. Cell Growth Differ., 4: 77-84, 1993.[Abstract]
  22. Santoro M., Melillo R. M., Carlomagno F., Fusco A., Vecchio G. Molecular mechanisms of RET activation in human cancer. Ann. N. Y. Acad. Sci., 963: 116-121, 2002.[Medline]
  23. Klugbauer S., Pfeiffer P., Gassenhuber H., Beimfohr C., Rabes H. M. RET rearrangements in radiation-induced papillary thyroid carcinomas: high prevalence of topoisomerase I sites at breakpoints and microhomology-mediated end joining in ELE1 and RET chimeric genes. Genomics, 73: 149-160, 2001.[Medline]
  24. Fugazzola L., Pierotti M. A., Vigano E., Pacini F., Vorontsova T. V., Bongarzone I. Molecular and biochemical analysis of RET/PTC4, a novel oncogenic rearrangement between RET and ELE1 genes, in a post-Chernobyl papillary thyroid cancer. Oncogene, 13: 1093-1097, 1996.[Medline]
  25. Nikiforov Y. E., Koshoffer A., Nikiforova M., Stringer J., Fagin J. A. Chromosomal breakpoint positions suggest a direct role for radiation in inducing illegitimate recombination between the ELE1 and RET genes in radiation-induced thyroid carcinomas. Oncogene, 18: 6330-6334, 1999.[Medline]
  26. Ribeiro-Neto F., Urbani J., Lemee N., Lou L., Altschuler D. L. On the mitogenic properties of Rap1b: cAMP-induced G(1)/S entry requires activated and phosphorylated Rap1b. Proc. Natl. Acad. Sci. USA, 99: 5418-5423, 2002.[Abstract/Free Full Text]
  27. Busca R., Abbe P., Mantoux F., Aberdam E., Peyssonnaux C., Eychene A., Ortonne J. P., Ballotti R. Ras mediates the cAMP-dependent activation of extracellular signal-regulated kinases (ERKs) in melanocytes. EMBO J., 19: 2900-2910, 2000.[Medline]
  28. Tsygankova O. M., Kupperman E., Wen W., Meinkoth J. L. Cyclic AMP activates Ras. Oncogene, 19: 3609-3615, 2000.[Medline]
  29. Iacovelli L., Capobianco L., Salvatore L., Sallese M., D’Ancona G. M., De Blasi A. Thyrotropin activates mitogen-activated protein kinase pathway in FRTL- 5 by a cAMP-dependent protein kinase A-independent mechanism. Mol. Pharmacol., 60: 924-933, 2001.[Abstract/Free Full Text]
  30. Esapa C. T., Johnson S. J., Kendall-Taylor P., Lennard T. W., Harris P. E. Prevalence of Ras mutations in thyroid neoplasia. Clin. Endocrinol. (Oxf.), 50: 529-535, 1999.[Medline]



This article has been cited by other articles:


Home page
JCOHome page
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K. A. Carson, M. Kim, A. Tufaro, P. Ladenson, M. Zeiger, et al.
BRAF Mutation Testing of Thyroid Fine-Needle Aspiration Biopsy Specimens for Preoperative Risk Stratification in Papillary Thyroid Cancer
J. Clin. Oncol., June 20, 2009; 27(18): 2977 - 2982.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
V. Kotoula, E. Sozopoulos, H. Litsiou, G. Fanourakis, T. Koletsa, G. Voutsinas, S. Tseleni-Balafouta, C. S Mitsiades, A. Wellmann, and N. Mitsiades
Mutational analysis of the BRAF, RAS and EGFR genes in human adrenocortical carcinomas
Endocr. Relat. Cancer, June 1, 2009; 16(2): 565 - 572.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. Fedele, D. Palmieri, G. Chiappetta, R. Pasquinelli, I. De Martino, C. Arra, G. Palma, T. Valentino, G. M Pierantoni, G. Viglietto, et al.
Impairment of the p27kip1 function enhances thyroid carcinogenesis in TRK-T1 transgenic mice
Endocr. Relat. Cancer, June 1, 2009; 16(2): 483 - 490.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. C. Ricarte-Filho, M. Ryder, D. A. Chitale, M. Rivera, A. Heguy, M. Ladanyi, M. Janakiraman, D. Solit, J. A. Knauf, R. M. Tuttle, et al.
Mutational Profile of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA, and AKT1
Cancer Res., June 1, 2009; 69(11): 4885 - 4893.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. E. Nikiforov, D. L. Steward, T. M. Robinson-Smith, B. R. Haugen, J. P. Klopper, Z. Zhu, J. A. Fagin, M. Falciglia, K. Weber, and M. N. Nikiforova
Molecular Testing for Mutations in Improving the Fine-Needle Aspiration Diagnosis of Thyroid Nodules
J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2092 - 2098.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
J P. Couto, H Prazeres, P Castro, J Lima, V Maximo, P Soares, and M Sobrinho-Simoes
How molecular pathology is changing and will change the therapeutics of patients with follicular cell-derived thyroid cancer
J. Clin. Pathol., May 1, 2009; 62(5): 414 - 421.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. T. Kloos, M. D. Ringel, M. V. Knopp, N. C. Hall, M. King, R. Stevens, J. Liang, P. E. Wakely Jr, V. V. Vasko, M. Saji, et al.
Phase II Trial of Sorafenib in Metastatic Thyroid Cancer
J. Clin. Oncol., April 1, 2009; 27(10): 1675 - 1684.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Nellore, K. Paziana, C. Ma, O. M. Tsygankova, Y. Wang, K. Puttaswamy, A. U. Iqbal, S. R. Franks, Y. Lv, A. B. Troxel, et al.
Loss of Rap1GAP in Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., March 1, 2009; 94(3): 1026 - 1032.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
E. S. W. Ngan, B. H. H. Lang, T. Liu, C. K. Y. Shum, M.-T. So, D. K. C. Lau, T. Y. Y. Leon, S. S. Cherny, S. Y. Tsai, C.-Y. Lo, et al.
A Germline Mutation (A339V) in Thyroid Transcription Factor-1 (TITF-1/NKX2.1) in Patients With Multinodular Goiter and Papillary Thyroid Carcinoma
J Natl Cancer Inst, February 4, 2009; 101(3): 162 - 175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. He, R. Nagy, S. Liyanarachchi, H. Jiao, W. Li, S. Suster, J. Kere, and A. de la Chapelle
A Susceptibility Locus for Papillary Thyroid Carcinoma on Chromosome 8q24
Cancer Res., January 15, 2009; 69(2): 625 - 631.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. C. Henderson, T. D. Shellenberger, M. D. Williams, A. K. El-Naggar, M. J. Fredrick, K. M. Cieply, and G. L. Clayman
High Rate of BRAF and RET/PTC Dual Mutations Associated with Recurrent Papillary Thyroid Carcinoma
Clin. Cancer Res., January 15, 2009; 15(2): 485 - 491.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. A. Pratilas, A. J. Hanrahan, E. Halilovic, Y. Persaud, J. Soh, D. Chitale, H. Shigematsu, H. Yamamoto, A. Sawai, M. Janakiraman, et al.
Genetic Predictors of MEK Dependence in Non-Small Cell Lung Cancer
Cancer Res., November 15, 2008; 68(22): 9375 - 9383.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zang, J. Gong, L. Luo, J. Zhou, X. Xiang, W. Huang, Q. Huang, X. Luo, M. Olbrot, Y. Peng, et al.
Characterization of Ser338 Phosphorylation for Raf-1 Activation
J. Biol. Chem., November 14, 2008; 283(46): 31429 - 31437.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. E. Schweppe, J. P. Klopper, C. Korch, U. Pugazhenthi, M. Benezra, J. A. Knauf, J. A. Fagin, L. A. Marlow, J. A. Copland, R. C. Smallridge, et al.
Deoxyribonucleic Acid Profiling Analysis of 40 Human Thyroid Cancer Cell Lines Reveals Cross-Contamination Resulting in Cell Line Redundancy and Misidentification
J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4331 - 4341.
[Abstract] [Full Text] [PDF]


Home page
RadiologyHome page
N. A. Johnson and M. E. Tublin
Postoperative Surveillance of Differentiated Thyroid Carcinoma: Rationale, Techniques, and Controversies
Radiology, November 1, 2008; 249(2): 429 - 444.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. G. Pfister and J. A. Fagin
Refractory Thyroid Cancer: A Paradigm Shift in Treatment Is Not Far Off
J. Clin. Oncol., October 10, 2008; 26(29): 4701 - 4704.
[Full Text] [PDF]


Home page
J Mol EndocrinolHome page
X. Lin, S. D Finkelstein, B. Zhu, and J. F Silverman
Molecular analysis of multifocal papillary thyroid carcinoma
J. Mol. Endocrinol., October 1, 2008; 41(4): 195 - 203.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Elisei, C. Ugolini, D. Viola, C. Lupi, A. Biagini, R. Giannini, C. Romei, P. Miccoli, A. Pinchera, and F. Basolo
BRAFV600E Mutation and Outcome of Patients with Papillary Thyroid Carcinoma: A 15-Year Median Follow-Up Study
J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3943 - 3949.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
F. R M Latini, J. P Hemerly, G. Oler, G. J Riggins, and J. M Cerutti
Re-expression of ABI3-binding protein suppresses thyroid tumor growth by promoting senescence and inhibiting invasion
Endocr. Relat. Cancer, September 1, 2008; 15(3): 787 - 799.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Hamatani, H. Eguchi, R. Ito, M. Mukai, K. Takahashi, M. Taga, K. Imai, J. Cologne, M. Soda, K. Arihiro, et al.
RET/PTC Rearrangements Preferentially Occurred in Papillary Thyroid Cancer among Atomic Bomb Survivors Exposed to High Radiation Dose
Cancer Res., September 1, 2008; 68(17): 7176 - 7182.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Zeng, Y. Geng, M. Tretiakova, X. Yu, P. Sicinski, and T. G. Kroll
Peroxisome Proliferator-Activated Receptor-{delta} Induces Cell Proliferation by a Cyclin E1-Dependent Mechanism and Is Up-regulated in Thyroid Tumors
Cancer Res., August 15, 2008; 68(16): 6578 - 6586.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Oler, C. P. Camacho, F. C. Hojaij, P. Michaluart Jr., G. J. Riggins, and J. M. Cerutti
Gene Expression Profiling of Papillary Thyroid Carcinoma Identifies Transcripts Correlated with BRAF Mutational Status and Lymph Node Metastasis
Clin. Cancer Res., August 1, 2008; 14(15): 4735 - 4742.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Leboeuf, J. E. Baumgartner, M. Benezra, R. Malaguarnera, D. Solit, C. A. Pratilas, N. Rosen, J. A. Knauf, and J. A. Fagin
BRAFV600E Mutation Is Associated with Preferential Sensitivity to Mitogen-Activated Protein Kinase Kinase Inhibition in Thyroid Cancer Cell Lines
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2194 - 2201.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Jazdzewski, E. L. Murray, K. Franssila, B. Jarzab, D. R. Schoenberg, and A. de la Chapelle
Common SNP in pre-miR-146a decreases mature miR expression and predisposes to papillary thyroid carcinoma
PNAS, May 20, 2008; 105(20): 7269 - 7274.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Boulay, M. Breuleux, C. Stephan, C. Fux, C. Brisken, M. Fiche, M. Wartmann, M. Stumm, H. A. Lane, and N. E. Hynes
The Ret Receptor Tyrosine Kinase Pathway Functionally Interacts with the ER{alpha} Pathway in Breast Cancer
Cancer Res., May 15, 2008; 68(10): 3743 - 3751.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. N. Nikiforova, G. C. Tseng, D. Steward, D. Diorio, and Y. E. Nikiforov
MicroRNA Expression Profiling of Thyroid Tumors: Biological Significance and Diagnostic Utility
J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1600 - 1608.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
B. M Cavaco, P. F Batista, C. Martins, A. Banito, F. do Rosario, E. Limbert, L. G Sobrinho, and V. Leite
Familial non-medullary thyroid carcinoma (FNMTC): analysis of fPTC/PRN, NMTC1, MNG1 and TCO susceptibility loci and identification of somatic BRAF and RAS mutations
Endocr. Relat. Cancer, March 1, 2008; 15(1): 207 - 215.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Abubaker, Z. Jehan, P. Bavi, M. Sultana, S. Al-Harbi, M. Ibrahim, A. Al-Nuaim, M. Ahmed, T. Amin, M. Al-Fehaily, et al.
Clinicopathological Analysis of Papillary Thyroid Cancer with PIK3CA Alterations in a Middle Eastern Population
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 611 - 618.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
A Salajegheh, E B Petcu, R A Smith, and A K-Y Lam
Follicular variant of papillary thyroid carcinoma: a diagnostic challenge for clinicians and pathologists
Postgrad. Med. J., February 1, 2008; 84(988): 78 - 82.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. M. Klein, L. S. Spofford, E. V. Abel, A. Ortiz, and A. E. Aplin
B-RAF Regulation of Rnd3 Participates in Actin Cytoskeletal and Focal Adhesion Organization
Mol. Biol. Cell, February 1, 2008; 19(2): 498 - 508.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Mariggio, B. M. Filippi, C. Iurisci, L. K. Dragani, V. De Falco, M. Santoro, and D. Corda
Cytosolic Phospholipase A2{alpha} Regulates Cell Growth in RET/PTC-Transformed Thyroid Cells
Cancer Res., December 15, 2007; 67(24): 11769 - 11778.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al.
Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Xing
BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications
Endocr. Rev., December 1, 2007; 28(7): 742 - 762.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. B. Solit, E. Santos, C. A. Pratilas, J. Lobo, M. Moroz, S. Cai, R. Blasberg, J. Sebolt-Leopold, S. Larson, and N. Rosen
3'-Deoxy-3'-[18F]Fluorothymidine Positron Emission Tomography Is a Sensitive Method for Imaging the Response of BRAF-Dependent Tumors to MEK Inhibition
Cancer Res., December 1, 2007; 67(23): 11463 - 11469.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. W. Ball, N. Jin, D. M. Rosen, A. Dackiw, D. Sidransky, M. Xing, and B. D. Nelkin
Selective Growth Inhibition in BRAF Mutant Thyroid Cancer by the Mitogen-Activated Protein Kinase Kinase 1/2 Inhibitor AZD6244
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4712 - 4718.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
L. R Rowe, B. G Bentz, and J. S Bentz
Detection of BRAF V600E activating mutation in papillary thyroid carcinoma using PCR with allele-specific fluorescent probe melting curve analysis
J. Clin. Pathol., November 1, 2007; 60(11): 1211 - 1215.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. C. Ridgway, Y. Tomer, and S. M. McLachlan
Update in Thyroidology
J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3755 - 3761.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
H.-M. Wang, Y.-W. Huang, J.-S. Huang, C.-H. Wang, V. C. Kok, C.-M. Hung, H.-M. Chen, and C.-Y. Tzen
Anaplastic Carcinoma of the Thyroid Arising More Often from Follicular Carcinoma than Papillary Carcinoma
Ann. Surg. Oncol., October 1, 2007; 14(10): 3011 - 3018.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
T. Ishii, H. Sootome, Y. Yagi, K. Yamashita, T. Noumi, and N. Noro
A Selective Cellular Screening Assay for B-Raf and c-Raf Kinases
J Biomol Screen, September 1, 2007; 12(6): 818 - 827.
[Abstract] [PDF]


Home page
EndocrinologyHome page
K. D. McCall, N. Harii, C. J. Lewis, R. Malgor, W. Bae Kim, M. Saji, A. D. Kohn, R. T. Moon, and L. D. Kohn
High Basal Levels of Functional Toll-Like Receptor 3 (TLR3) and Noncanonical Wnt5a Are Expressed in Papillary Thyroid Cancer and Are Coordinately Decreased by Phenylmethimazole Together with Cell Proliferation and Migration
Endocrinology, September 1, 2007; 148(9): 4226 - 4237.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
B. R. Davies, A. Logie, J. S. McKay, P. Martin, S. Steele, R. Jenkins, M. Cockerill, S. Cartlidge, and P. D. Smith
AZD6244 (ARRY-142886), a potent inhibitor of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2 kinases: mechanism of action in vivo, pharmacokinetic/pharmacodynamic relationship, and potential for combination in preclinical models
Mol. Cancer Ther., August 1, 2007; 6(8): 2209 - 2219.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Akeno-Stuart, M. Croyle, J. A. Knauf, R. Malaguarnera, D. Vitagliano, M. Santoro, C. Stephan, K. Grosios, M. Wartmann, R. Cozens, et al.
The RET Kinase Inhibitor NVP-AST487 Blocks Growth and Calcitonin Gene Expression through Distinct Mechanisms in Medullary Thyroid Cancer Cells
Cancer Res., July 15, 2007; 67(14): 6956 - 6964.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Ciampi, T. J Giordano, K. Wikenheiser-Brokamp, R. J Koenig, and Y. E Nikiforov
HOOK3-RET: a novel type of RET/PTC rearrangement in papillary thyroid carcinoma
Endocr. Relat. Cancer, June 1, 2007; 14(2): 445 - 452.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Kondo, L. Zheng, W. Liu, J. Kurebayashi, S. L. Asa, and S. Ezzat
Epigenetically Controlled Fibroblast Growth Factor Receptor 2 Signaling Imposes on the RAS/BRAF/Mitogen-Activated Protein Kinase Pathway to Modulate Thyroid Cancer Progression
Cancer Res., June 1, 2007; 67(11): 5461 - 5470.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Liu, Z. Liu, S. Condouris, and M. Xing
BRAF V600E Maintains Proliferation, Transformation, and Tumorigenicity of BRAF-Mutant Papillary Thyroid Cancer Cells
J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2264 - 2271.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Eszlinger, K. Krohn, A. Kukulska, B. Jarzab, and R. Paschke
Perspectives and Limitations of Microarray-Based Gene Expression Profiling of Thyroid Tumors
Endocr. Rev., May 1, 2007; 28(3): 322 - 338.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C.-R. Chen, S. M. McLachlan, and B. Rapoport
Suppression of Thyrotropin Receptor Constitutive Activity by a Monoclonal Antibody with Inverse Agonist Activity
Endocrinology, May 1, 2007; 148(5): 2375 - 2382.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. A. Fecher, S. D. Cummings, M. J. Keefe, and R. M. Alani
Toward a Molecular Classification of Melanoma
J. Clin. Oncol., April 20, 2007; 25(12): 1606 - 1620.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
D. Strumberg, J. W. Clark, A. Awada, M. J. Moore, H. Richly, A. Hendlisz, H. W. Hirte, J. P. Eder, H.-J. Lenz, and B. Schwartz
Safety, Pharmacokinetics, and Preliminary Antitumor Activity of Sorafenib: A Review of Four Phase I Trials in Patients with Advanced Refractory Solid Tumors
Oncologist, April 1, 2007; 12(4): 426 - 437.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Ciampi and Y. E. Nikiforov
RET/PTC Rearrangements and BRAF Mutations in Thyroid Tumorigenesis
Endocrinology, March 1, 2007; 148(3): 936 - 941.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al.
Targeting BRAFV600E in thyroid carcinoma: therapeutic implications
Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
I.-J. Kim, H. C. Kang, S. G. Jang, S.-A Ahn, H.-J. Yoon, and J.-G. Park
Development and Applications of a BRAF Oligonucleotide Microarray
J. Mol. Diagn., February 1, 2007; 9(1): 55 - 63.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
C. Gridelli, P. Maione, F. Del Gaizo, G. Colantuoni, C. Guerriero, C. Ferrara, D. Nicolella, D. Comunale, A. De Vita, and A. Rossi
Sorafenib and Sunitinib in the Treatment of Advanced Non-Small Cell Lung Cancer
Oncologist, February 1, 2007; 12(2): 191 - 200.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Hmitou, S. Druillennec, A. Valluet, C. Peyssonnaux, and A. Eychene
Differential Regulation of B-Raf Isoforms by Phosphorylation and Autoinhibitory Mechanisms
Mol. Cell. Biol., January 1, 2007; 27(1): 31 - 43.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Paternot, J. E. Dumont, and P. P. Roger
Differential Utilization of Cyclin D1 and Cyclin D3 in the Distinct Mitogenic Stimulations by Growth Factors and TSH of Human Thyrocytes in Primary Culture
Mol. Endocrinol., December 1, 2006; 20(12): 3279 - 3292.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. Palona, H. Namba, N. Mitsutake, D. Starenki, A. Podtcheko, I. Sedliarou, A. Ohtsuru, V. Saenko, Y. Nagayama, K. Umezawa, et al.
BRAFV600E Promotes Invasiveness of Thyroid Cancer Cells through Nuclear Factor {kappa}B Activation
Endocrinology, December 1, 2006; 147(12): 5699 - 5707.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
E. A. Mittendorf, A. Khiyami, and C. R. McHenry
When Fine-Needle Aspiration Biopsy Cannot Exclude Papillary Thyroid Cancer: A Therapeutic Dilemma
Arch Surg, October 1, 2006; 141(10): 961 - 966.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
T Kogai, K Taki, and G A Brent
Enhancement of sodium/iodide symporter expression in thyroid and breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
C. C. Lubitz, S. K. Ugras, J. J. Kazam, B. Zhu, T. Scognamiglio, Y.-T. Chen, and T. J. Fahey III
Microarray Analysis of Thyroid Nodule Fine-Needle Aspirates Accurately Classifies Benign and Malignant Lesions
J. Mol. Diagn., September 1, 2006; 8(4): 490 - 498.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
S. Matsukuma, M. Yoshihara, F. Kasai, A. Kato, A. Yoshida, M. Akaike, O. Kobayashi, H. Nakayama, Y. Sakuma, T. Yoshida, et al.
Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay
J. Mol. Diagn., September 1, 2006; 8(4): 504 - 512.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Weber, R. E. Teresi, C. E. Broelsch, A. Frilling, and C. Eng
A Limited Set of Human MicroRNA Is Deregulated in Follicular Thyroid Carcinoma
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3584 - 3591.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. R. James, T. Dumeni, M. S. Stark, D. L. Duffy, G. W. Montgomery, N. G. Martin, and N. K. Hayward
Rapid Screening of 4000 Individuals for Germ-line Variations in the BRAF Gene
Clin. Chem., September 1, 2006; 52(9): 1675 - 1678.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Mesa Jr., M. Mirza, N. Mitsutake, M. Sartor, M. Medvedovic, C. Tomlinson, J. A Knauf, G. F. Weber, and J. A. Fagin
Conditional Activation of RET/PTC3 and BRAFV600E in Thyroid Cells Is Associated with Gene Expression Profiles that Predict a Preferential Role of BRAF in Extracellular Matrix Remodeling.
Cancer Res., July 1, 2006; 66(13): 6521 - 6529.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al.
Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A Bakhsh, G Kirov, J W Gregory, E D Williams, and M Ludgate
A new form of familial multi-nodular goitre with progression to differentiated thyroid cancer.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 475 - 483.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al.
RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Eszlinger, M. Wiench, B. Jarzab, K. Krohn, M. Beck, J. Lauter, E. Gubala, K. Fujarewicz, A. Swierniak, and R. Paschke
Meta- and Reanalysis of Gene Expression Profiles of Hot and Cold Thyroid Nodules and Papillary Thyroid Carcinoma for Gene Groups
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1934 - 1942.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. P. McCarthy, M. Wang, T. D. Jones, R. W. Strate, and L. Cheng
Molecular Evidence for the Same Clonal Origin of Multifocal Papillary Thyroid Carcinomas
Clin. Cancer Res., April 15, 2006; 12(8): 2414 - 2418.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. J. Giordano, A. Y.M. Au, R. Kuick, D. G. Thomas, D. R. Rhodes, K. G. Wilhelm Jr., M. Vinco, D. E. Misek, D. Sanders, Z. Zhu, et al.
Delineation, Functional Validation, and Bioinformatic Evaluation of Gene Expression in Thyroid Follicular Carcinomas with the PAX8-PPARG Translocation.
Clin. Cancer Res., April 1, 2006; 12(7): 1983 - 1993.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Chiloeches and R. Marais
Is BRAF the Achilles' Heel of Thyroid Cancer?
Clin. Cancer Res., March 15, 2006; 12(6): 1661 - 1664.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Ouyang, J. A. Knauf, E. P. Smith, L. Zhang, T. Ramsey, N. Yusuff, D. Batt, and J. A. Fagin
Inhibitors of Raf Kinase Activity Block Growth of Thyroid Cancer Cells with RET/PTC or BRAF Mutations In vitro and In vivo.
Clin. Cancer Res., March 15, 2006; 12(6): 1785 - 1793.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
A. J. Canchola, P. L. Horn-Ross, and D. M. Purdie
Risk of Second Primary Malignancies in Women with Papillary Thyroid Cancer
Am. J. Epidemiol., March 15, 2006; 163(6): 521 - 527.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Salvatore, V. De Falco, P. Salerno, T. C. Nappi, S. Pepe, G. Troncone, F. Carlomagno, R. M. Melillo, S. M. Wilhelm, and M. Santoro
BRAF Is a Therapeutic Target in Aggressive Thyroid Carcinoma
Clin. Cancer Res., March 1, 2006; 12(5): 1623 - 1629.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale
Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA)
Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Panka, W. Wang, M. B. Atkins, and J. W. Mier
The Raf Inhibitor BAY 43-9006 (Sorafenib) Induces Caspase-Independent Apoptosis in Melanoma Cells
Cancer Res., February 1, 2006; 66(3): 1611 - 1619.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Mitsutake, M. Miyagishi, S. Mitsutake, N. Akeno, C. Mesa Jr, J. A. Knauf, L. Zhang, K. Taira, and J. A. Fagin
BRAF Mediates RET/PTC-Induced Mitogen-Activated Protein Kinase Activation in Thyroid Cells: Functional Support for Requirement of the RET/PTC-RAS-BRAF Pathway in Papillary Thyroid Carcinogenesis
Endocrinology, February 1, 2006; 147(2): 1014 - 1019.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Castro, A. P. Rebocho, R. J. Soares, J. Magalhaes, L. Roque, V. Trovisco, I. Vieira de Castro, M. Cardoso-de-Oliveira, E. Fonseca, P. Soares, et al.
PAX8-PPAR{gamma} Rearrangement Is Frequently Detected in the Follicular Variant of Papillary Thyroid Carcinoma
J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 213 - 220.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al.
PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth
Endocrinology, January 1, 2006; 147(1): 367 - 376.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. He, K. Jazdzewski, W. Li, S. Liyanarachchi, R. Nagy, S. Volinia, G. A. Calin, C.-g. Liu, K. Franssila, S. Suster, et al.
The role of microRNA genes in papillary thyroid carcinoma
PNAS, December 27, 2005; 102(52): 19075 - 19080.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Mercer, S. Giblett, S. Green, D. Lloyd, S. DaRocha Dias, M. Plumb, R. Marais, and C. Pritchard
Expression of Endogenous Oncogenic V600EB-raf Induces Proliferation and Developmental Defects in Mice and Transformation of Primary Fibroblasts
Cancer Res., December 15, 2005; 65(24): 11493 - 11500.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
B Jarzab, D Handkiewicz-Junak, and J Wloch
Juvenile differentiated thyroid carcinoma and the role of radioiodine in its treatment: a qualitative review
Endocr. Relat. Cancer, December 1, 2005; 12(4): 773 - 803.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al.
BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Garcia-Rostan, A. M. Costa, I. Pereira-Castro, G. Salvatore, R. Hernandez, M. J.A. Hermsem, A. Herrero, A. Fusco, J. Cameselle-Teijeiro, and M. Santoro
Mutation of the PIK3CA Gene in Anaplastic Thyroid Cancer
Cancer Res., November 15, 2005; 65(22): 10199 - 10207.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. G. Borrello, L. Alberti, A. Fischer, D. Degl'Innocenti, C. Ferrario, M. Gariboldi, F. Marchesi, P. Allavena, A. Greco, P. Collini, et al.
Induction of a proinflammatory program in normal human thyrocytes by the RET/PTC1 oncogene
PNAS, October 11, 2005; 102(41): 14825 - 14830.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Beeram, A. Patnaik, and E. K. Rowinsky
Raf: A Strategic Target for Therapeutic Development Against Cancer
J. Clin. Oncol., September 20, 2005; 23(27): 6771 - 6790.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A B Hassan and C Paraskeva
Colorectal cancer prognosis: is it all mutation, mutation, mutation?
Gut, September 1, 2005; 54(9): 1209 - 1211.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Guarino, P. Faviana, G. Salvatore, M. D. Castellone, A. M. Cirafici, V. De Falco, A. Celetti, R. Giannini, F. Basolo, R. M. Melillo, et al.
Osteopontin Is Overexpressed in Human Papillary Thyroid Carcinomas and Enhances Thyroid Carcinoma Cell Invasiveness
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5270 - 5278.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Vasko, S. Hu, G. Wu, J. C. Xing, A. Larin, V. Savchenko, B. Trink, and M. Xing
High Prevalence and Possible de Novo Formation of BRAF Mutation in Metastasized Papillary Thyroid Cancer in Lymph Nodes
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5265 - 5269.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y.-Z. Feng, T. Shiozawa, T. Miyamoto, H. Kashima, M. Kurai, A. Suzuki, and I. Konishi
BRAF Mutation in Endometrial Carcinoma and Hyperplasia: Correlation with KRAS and p53 Mutations and Mismatch Repair Protein Expression
Clin. Cancer Res., September 1, 2005; 11(17): 6133 - 6138.
[Abstract] [Full Text] [PDF]


Home page
Epidemiol RevHome page
M. Hatch, E. Ron, A. Bouville, L. Zablotska, and G. Howe
The Chernobyl Disaster: Cancer following the Accident at the Chernobyl Nuclear Power Plant
Epidemiol. Rev., July 1, 2005; 27(1): 56 - 66.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. O. Hoque, E. Rosenbaum, W. H. Westra, M. Xing, P. Ladenson, M. A. Zeiger, D. Sidransky, and C. B. Umbricht
Quantitative Assessment of Promoter Methylation Profiles in Thyroid Neoplasms
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4011 - 4018.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
T. M. Shattuck, W. H. Westra, P. W. Ladenson, and A. Arnold
Independent Clonal Origins of Distinct Tumor Foci in Multifocal Papillary Thyroid Carcinoma
N. Engl. J. Med., June 9, 2005; 352(23): 2406 - 2412.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M Xing
BRAF mutation in thyroid cancer
Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S Rossi, L Fugazzola, L De Pasquale, P Braidotti, V Cirello, P Beck-Peccoz, S Bosari, and A Bastagli
Medullary and papillary carcinoma of the thyroid gland occurring as a collision tumour: report of three cases with molecular analysis and review of the literature
Endocr. Relat. Cancer, June 1, 2005; 12(2): 281 - 289.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
K. Krohn, D. Fuhrer, Y. Bayer, M. Eszlinger, V. Brauer, S. Neumann, and R. Paschke
Molecular Pathogenesis of Euthyroid and Toxic Multinodular Goiter
Endocr. Rev., June 1, 2005; 26(4): 504 - 524.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Knauf, X. Ma, E. P. Smith, L. Zhang, N. Mitsutake, X.-H. Liao, S. Refetoff, Y. E. Nikiforov, and J. A. Fagin
Targeted Expression of BRAFV600E in Thyroid Cells of Transgenic Mice Results in Papillary Thyroid Cancers that Undergo Dedifferentiation
Cancer Res., May 15, 2005; 65(10): 4238 - 4245.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Illario, A. L. Cavallo, S. Monaco, E. Di Vito, F. Mueller, L. A. Marzano, G. Troncone, G. Fenzi, G. Rossi, and M. Vitale
Fibronectin-Induced Proliferation in Thyroid Cells Is Mediated by {alpha}v{beta}3 Integrin through Ras/Raf-1/MEK/ERK and Calcium/CaMKII Signals
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2865 - 2873.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al.
Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. M. Caudill, Z. Zhu, R. Ciampi, J. R. Stringer, and Y. E. Nikiforov
Dose-Dependent Generation of RET/PTC in Human Thyroid Cells after in Vitro Exposure to {gamma}-Radiation: A Model of Carcinogenic Chromosomal Rearrangement Induced by Ionizing Radiation
J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2364 - 2369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kimura, E. T.
Right arrow Articles by Fagin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kimura, E. T.
Right arrow Articles by Fagin, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online