| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Division of Endocrinology and Metabolism [E. T. K., J. A. K., J. A. F.] and Department of Pathology [M. N. N., Z. Z., Y. E. N.], University of Cincinnati College of Medicine, Cincinnati, Ohio 45267
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Constitutive activation of RET/PTC kinase activity promotes the interaction with Shc, an intermediate in the RAS pathway. RET-mediated transformation of NIH3T3 cells requires signaling via SHC-RAS-RAF-MEK (9) . In mammalian cells, there are three isoforms of the serine-threonine kinase RAF: ARAF, BRAF, and CRAF or RAF1, with different tissue distribution of expression (10) . Although all of the RAF isoforms activate MEK phosphorylation, they are differentially activated by oncogenic Ras. In addition, BRAF has higher affinity for MEK1 and MEK2, and is more efficient in phosphorylating MEKs than other RAF isoforms (11) . BRAF somatic mutations were reported recently in 66% of malignant melanomas (12) , and in <15% of colorectal (12 , 13) and ovarian cancers (12) . A total of 98% of the mutations in melanomas resulted from thymine-to-adenine transversions at nucleotide position 1796, resulting in a valine-to-glutamate substitution at residue 599 (V599E). This mutation is believed to mimic the phosphorylation in the activation segment by insertion of an acidic residue close to a site of regulated phosphorylation at serine 598. BRAFV599E exhibits elevated basal kinase activity and has diminished responsiveness to stimulation by oncogenic H-RAS. BRAFV599E also transformed NIH3T3 cells with higher efficiency than the wild-type form of the kinase, consistent with it functioning as an oncogene. Cancers with BRAFV599E had no mutations in RAS, presumably because of lack of cooperativity between these activating mutants, consistent with their transforming properties being relayed through the same signaling pathway (12) . Here we report that BRAF mutations are the most common genetic abnormality associated with thyroid papillary carcinomas and not present in any of the other types of differentiated follicular neoplasm we tested. Moreover, PTC had mutations in RET/PTC, RAS, or BRAF, with no overlap among them. These data provide genetic evidence that thyroid cell transformation to papillary cancers takes place through constitutive activation of effectors along the RET/PTC-RAS-BRAF signaling pathway.
| Materials and Methods |
|---|
|
|
|---|
Detection of BRAF Mutations.
Mutations of BRAF reported recently in melanomas and colorectal cancers are confined to exons 11 and 15 (12
, 13)
. DNA samples were screened by SSCP for mutations within these regions, as well as sequencing of gel-extracted and/or whole-sample PCR products. Primer pairs were designed flanking BRAF exons 11 and 15, respectively. PCR primer sequences were as follows: exon 11: 5'tctgtttggcttgacttgacttt 3' and 5'catgccactttcccttgtagac 3'; and exon 15: 5'aaactcttcataatgcttgctctg 3' and 5'ggccaaaaatttaatcagtgga 3'. Amplifications were carried out for 35 cycles with annealing temperatures optimized for each primer pair. Twenty five-µl PCR reactions were performed on 100 ng genomic DNA, 7.5 pmol of each primer, 100 µM deoxynucleoside triphosphates, 5 µCi [
32P]dCTP, 1.5 mM MgCl2, Platinum TaqDNA polymerase high fidelity (Invitrogen, Carlsbad, CA), and buffer. SSCP analysis was performed using a method reported previously (16)
. The PCR reaction mixture was diluted in DNA gel-loading buffer (95% formamide, 10 mM NaOH, 0.25% bromphenol blue, and 0.25% xylene cyanol), denatured by incubating at 94 C for 5 min, placed on ice, and loaded onto a 0.6% mutation detection enhancement gel solution (BioWhittaker Molecular Applications, Rockland, ME) with 10% glycerol. Gels were run with 0.6x Tris-borate EDTA buffer at 8W for 710 h at room temperature. Autoradiography was performed with an intensifying screen at -70°C for 1224 h. All of the PCR reactions from PTC samples were repeated at least twice.
Sequencing.
Genomic PCR products or aberrant SSCP bands cut directly from dried gels were sequenced. PCR reactions in 50 µl of final volume were performed as described above but with omission of radioactive nucleotide. A 2-µl aliquot was run on an agarose gel to verify the adequacy of the reaction, and the rest purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). Direct sequencing was performed using the BigDye v3.03 cycle sequencing kit (Applied Biosystems, Foster City, CA) in a capillary automatic sequencer (ABI PRISM 3100 Genetic Analyzer; Applied Biosystems) at the Cincinnati Childrens Hospital DNA Core Facility. Sequence comparisons were carried out using the BLAST Program (17)
.4
Detection of RAS Mutations.
Sixty-seven human tumor samples were analyzed for point mutations in codons 12/13, and 61 of the N-RAS, H-RAS, and K-RAS genes using LightCycler (Roche) fluorescence melting curve analysis. Briefly, 100 ng of DNA from each tumor was amplified with primers flanking codons 12/13 or 61 of each RAS gene using a hybridization probe format followed by fluorescence melting curve analysis (18
, 19)
. All of the PCR products that displayed a deviation from normal (placental DNA) melting pick were directly sequenced to verify the presence of RAS mutation and detect the exact nucleotide change.
Detection of RET Rearrangements.
Rearrangements of the RET gene were analyzed in 67 human tumor samples by Southern blot analysis. Briefly, 10 µg of DNA was digested separately with EcoRI, HindIII, BamHI, and BglII (Invitrogen), electrophoresed in 0.8% agarose gel, and transferred to nylon filters (Osmonics Inc., Minnetonka, MN). Hybridization was performed with a 1-kb BamHI-BglII RET-specific probe (20)
32P-labeled using a random oligonucleotide primer kit (Amersham Biosciences, Piscataway. NJ).
The researchers screening tumors for BRAF mutations and those genotyping for RET/PTC or RAS were blinded to their respective results until all of the experiments were concluded.
| Results |
|---|
|
|
|---|
|
|
A total of 67 papillary thyroid carcinomas were also analyzed for mutations in the known hot spots in the three RAS genes, as well as for RET/PTC rearrangements. The relative distribution of mutations of these genes in this large sample cohort is shown in Table 2
. BRAF was the most commonly mutated gene. Of those tumors positive for BRAF (22 of 67; 33%), none were positive for either RAS or RET/PTC. Of those that were RET/PTC positive (11 of 67; 16%), none had either BRAF or RAS mutations. Finally, none of the 11 PTCs with RAS mutations had BRAF or RET/PTC mutations.
|
| Discussion |
|---|
|
|
|---|
Until this report, PTC was known to be associated primarily with rearrangements of genes coding for the tyrosine kinase receptor RET, and less commonly TRK. In this series, RET/PTC mutations were seen in 16% of PTCs, which is quite consistent with data in the literature from patients without documented history of radiation exposure (22) . As stated, one of the major risk factors for development of PTC is a history of prior exposure to radiation, and it is these particular tumors that have a high prevalence of rearranged oncogenic forms of RET (3 , 23 , 24) . Radiation-induced RET/PTC chimeric genes have been proposed to form because of direct double-strand DNA breaks resulting in illegitimate reciprocal recombination (25) favored by spatial juxtaposition of the participating loci during interphase in thyroid cells (6) . However, the great majority of patients with PTC do not have a history of radiation exposure. The fact that point mutations of BRAF and RAS may account for many of these provides a more plausible genetic mechanism for generation of these tumors in the general population.
It is notable that BRAF mutations are common in melanomas and thyroid cancers, because growth of melanocytes and thyrocytes is positively regulated by cAMP. In both cell types, cAMP activates MEK1 and extracellular signal-regulated kinases through mechanisms that may differ but that converge on BRAF. In thyroid cells, cAMP activates RAP1 guanine nucleotide exchange possibly via EPAC (26) , whereas in melanocytes cAMP activates RAS through a yet-unidentified exchange factor (27) . A similar cAMP-RAS mediated pathway has also been proposed in thyroid cells (28) . Regardless, BRAF is thought to be the key RAF isoform transducing the cAMP-dependent growth signal in both these cell types (27 , 29) , which may account for their vulnerability to transformation by activating mutations of this particular kinase.
This study was initiated with the presumption that follicular adenomas or carcinomas would be good candidates to harbor BRAF mutations, because
25% of them have RAS mutations (8
, 30)
. Therefore, the fact that we did not find BRAF mutations in follicular or Hürthle cell neoplasms was a notable and unexpected result. It is tempting to speculate based on these genetic data that the dominant type of RAS downstream effector pathway used may be important in thyroid tumor fate, with RAS acting via BRAF predisposing to PTC, and RAS through yet-unknown effectors favoring transformation to follicular neoplasms.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported in part by NIH Grants CA50706 and CA72597 (to J. A. F.), GCRC Grant MOIRR08084 and American Cancer Society grant RSG-03-027-01-CCE (to Y. E. N.). E. T. K. is recipient of Coordenaçao de Aperfeiçoamento de Pessoal de Nível Superior Grant BEX1891/01-4 from the Ministry of Education of Brazil, and is on leave from the Institute of Biomedical Science, University of São Paulo, São Paulo, Brazil. ![]()
2 To whom requests for reprints should be addressed, at Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0547. Phone: (513) 558-4444; Fax: (513) 558-8581; E-mail: james.fagin{at}uc.edu ![]()
3 The abbreviations used are: PTC, papillary thyroid cancer; MEK, mitogen-activated protein/extracellular signal-regulated kinase kinase; EPAC, exchange factor directly activated by cyclic AMP; GCRC, General Clinical Research Center; SSCP, single-strand conformational polymorphism; cAMP, cyclic AMP. ![]()
4 Internet address: http://www.ncbi.nlm.nih.gov/BLAST/. ![]()
Received 11/27/02. Accepted 2/18/03.
| REFERENCES |
|---|
|
|
|---|
rearrangement in thyroid tumors: evidence for distinct molecular pathways in thyroid follicular carcinoma. J. Clin. Endocrinol. Metab., in press, 2003.
This article has been cited by other articles:
![]() |
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K. A. Carson, M. Kim, A. Tufaro, P. Ladenson, M. Zeiger, et al. BRAF Mutation Testing of Thyroid Fine-Needle Aspiration Biopsy Specimens for Preoperative Risk Stratification in Papillary Thyroid Cancer J. Clin. Oncol., June 20, 2009; 27(18): 2977 - 2982. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kotoula, E. Sozopoulos, H. Litsiou, G. Fanourakis, T. Koletsa, G. Voutsinas, S. Tseleni-Balafouta, C. S Mitsiades, A. Wellmann, and N. Mitsiades Mutational analysis of the BRAF, RAS and EGFR genes in human adrenocortical carcinomas Endocr. Relat. Cancer, June 1, 2009; 16(2): 565 - 572. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fedele, D. Palmieri, G. Chiappetta, R. Pasquinelli, I. De Martino, C. Arra, G. Palma, T. Valentino, G. M Pierantoni, G. Viglietto, et al. Impairment of the p27kip1 function enhances thyroid carcinogenesis in TRK-T1 transgenic mice Endocr. Relat. Cancer, June 1, 2009; 16(2): 483 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Ricarte-Filho, M. Ryder, D. A. Chitale, M. Rivera, A. Heguy, M. Ladanyi, M. Janakiraman, D. Solit, J. A. Knauf, R. M. Tuttle, et al. Mutational Profile of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA, and AKT1 Cancer Res., June 1, 2009; 69(11): 4885 - 4893. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. E. Nikiforov, D. L. Steward, T. M. Robinson-Smith, B. R. Haugen, J. P. Klopper, Z. Zhu, J. A. Fagin, M. Falciglia, K. Weber, and M. N. Nikiforova Molecular Testing for Mutations in Improving the Fine-Needle Aspiration Diagnosis of Thyroid Nodules J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2092 - 2098. [Abstract] [Full Text] [PDF] |
||||
![]() |
J P. Couto, H Prazeres, P Castro, J Lima, V Maximo, P Soares, and M Sobrinho-Simoes How molecular pathology is changing and will change the therapeutics of patients with follicular cell-derived thyroid cancer J. Clin. Pathol., May 1, 2009; 62(5): 414 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Kloos, M. D. Ringel, M. V. Knopp, N. C. Hall, M. King, R. Stevens, J. Liang, P. E. Wakely Jr, V. V. Vasko, M. Saji, et al. Phase II Trial of Sorafenib in Metastatic Thyroid Cancer J. Clin. Oncol., April 1, 2009; 27(10): 1675 - 1684. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nellore, K. Paziana, C. Ma, O. M. Tsygankova, Y. Wang, K. Puttaswamy, A. U. Iqbal, S. R. Franks, Y. Lv, A. B. Troxel, et al. Loss of Rap1GAP in Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., March 1, 2009; 94(3): 1026 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. W. Ngan, B. H. H. Lang, T. Liu, C. K. Y. Shum, M.-T. So, D. K. C. Lau, T. Y. Y. Leon, S. S. Cherny, S. Y. Tsai, C.-Y. Lo, et al. A Germline Mutation (A339V) in Thyroid Transcription Factor-1 (TITF-1/NKX2.1) in Patients With Multinodular Goiter and Papillary Thyroid Carcinoma J Natl Cancer Inst, February 4, 2009; 101(3): 162 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. He, R. Nagy, S. Liyanarachchi, H. Jiao, W. Li, S. Suster, J. Kere, and A. de la Chapelle A Susceptibility Locus for Papillary Thyroid Carcinoma on Chromosome 8q24 Cancer Res., January 15, 2009; 69(2): 625 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. C. Henderson, T. D. Shellenberger, M. D. Williams, A. K. El-Naggar, M. J. Fredrick, K. M. Cieply, and G. L. Clayman High Rate of BRAF and RET/PTC Dual Mutations Associated with Recurrent Papillary Thyroid Carcinoma Clin. Cancer Res., January 15, 2009; 15(2): 485 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Pratilas, A. J. Hanrahan, E. Halilovic, Y. Persaud, J. Soh, D. Chitale, H. Shigematsu, H. Yamamoto, A. Sawai, M. Janakiraman, et al. Genetic Predictors of MEK Dependence in Non-Small Cell Lung Cancer Cancer Res., November 15, 2008; 68(22): 9375 - 9383. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zang, J. Gong, L. Luo, J. Zhou, X. Xiang, W. Huang, Q. Huang, X. Luo, M. Olbrot, Y. Peng, et al. Characterization of Ser338 Phosphorylation for Raf-1 Activation J. Biol. Chem., November 14, 2008; 283(46): 31429 - 31437. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Schweppe, J. P. Klopper, C. Korch, U. Pugazhenthi, M. Benezra, J. A. Knauf, J. A. Fagin, L. A. Marlow, J. A. Copland, R. C. Smallridge, et al. Deoxyribonucleic Acid Profiling Analysis of 40 Human Thyroid Cancer Cell Lines Reveals Cross-Contamination Resulting in Cell Line Redundancy and Misidentification J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4331 - 4341. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Johnson and M. E. Tublin Postoperative Surveillance of Differentiated Thyroid Carcinoma: Rationale, Techniques, and Controversies Radiology, November 1, 2008; 249(2): 429 - 444. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Pfister and J. A. Fagin Refractory Thyroid Cancer: A Paradigm Shift in Treatment Is Not Far Off J. Clin. Oncol., October 10, 2008; 26(29): 4701 - 4704. [Full Text] [PDF] |
||||
![]() |
X. Lin, S. D Finkelstein, B. Zhu, and J. F Silverman Molecular analysis of multifocal papillary thyroid carcinoma J. Mol. Endocrinol., October 1, 2008; 41(4): 195 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Elisei, C. Ugolini, D. Viola, C. Lupi, A. Biagini, R. Giannini, C. Romei, P. Miccoli, A. Pinchera, and F. Basolo BRAFV600E Mutation and Outcome of Patients with Papillary Thyroid Carcinoma: A 15-Year Median Follow-Up Study J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3943 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. R M Latini, J. P Hemerly, G. Oler, G. J Riggins, and J. M Cerutti Re-expression of ABI3-binding protein suppresses thyroid tumor growth by promoting senescence and inhibiting invasion Endocr. Relat. Cancer, September 1, 2008; 15(3): 787 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hamatani, H. Eguchi, R. Ito, M. Mukai, K. Takahashi, M. Taga, K. Imai, J. Cologne, M. Soda, K. Arihiro, et al. RET/PTC Rearrangements Preferentially Occurred in Papillary Thyroid Cancer among Atomic Bomb Survivors Exposed to High Radiation Dose Cancer Res., September 1, 2008; 68(17): 7176 - 7182. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zeng, Y. Geng, M. Tretiakova, X. Yu, P. Sicinski, and T. G. Kroll Peroxisome Proliferator-Activated Receptor-{delta} Induces Cell Proliferation by a Cyclin E1-Dependent Mechanism and Is Up-regulated in Thyroid Tumors Cancer Res., August 15, 2008; 68(16): 6578 - 6586. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Oler, C. P. Camacho, F. C. Hojaij, P. Michaluart Jr., G. J. Riggins, and J. M. Cerutti Gene Expression Profiling of Papillary Thyroid Carcinoma Identifies Transcripts Correlated with BRAF Mutational Status and Lymph Node Metastasis Clin. Cancer Res., August 1, 2008; 14(15): 4735 - 4742. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Leboeuf, J. E. Baumgartner, M. Benezra, R. Malaguarnera, D. Solit, C. A. Pratilas, N. Rosen, J. A. Knauf, and J. A. Fagin BRAFV600E Mutation Is Associated with Preferential Sensitivity to Mitogen-Activated Protein Kinase Kinase Inhibition in Thyroid Cancer Cell Lines J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2194 - 2201. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Jazdzewski, E. L. Murray, K. Franssila, B. Jarzab, D. R. Schoenberg, and A. de la Chapelle Common SNP in pre-miR-146a decreases mature miR expression and predisposes to papillary thyroid carcinoma PNAS, May 20, 2008; 105(20): 7269 - 7274. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boulay, M. Breuleux, C. Stephan, C. Fux, C. Brisken, M. Fiche, M. Wartmann, M. Stumm, H. A. Lane, and N. E. Hynes The Ret Receptor Tyrosine Kinase Pathway Functionally Interacts with the ER{alpha} Pathway in Breast Cancer Cancer Res., May 15, 2008; 68(10): 3743 - 3751. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Nikiforova, G. C. Tseng, D. Steward, D. Diorio, and Y. E. Nikiforov MicroRNA Expression Profiling of Thyroid Tumors: Biological Significance and Diagnostic Utility J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1600 - 1608. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M Cavaco, P. F Batista, C. Martins, A. Banito, F. do Rosario, E. Limbert, L. G Sobrinho, and V. Leite Familial non-medullary thyroid carcinoma (FNMTC): analysis of fPTC/PRN, NMTC1, MNG1 and TCO susceptibility loci and identification of somatic BRAF and RAS mutations Endocr. Relat. Cancer, March 1, 2008; 15(1): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Abubaker, Z. Jehan, P. Bavi, M. Sultana, S. Al-Harbi, M. Ibrahim, A. Al-Nuaim, M. Ahmed, T. Amin, M. Al-Fehaily, et al. Clinicopathological Analysis of Papillary Thyroid Cancer with PIK3CA Alterations in a Middle Eastern Population J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 611 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Salajegheh, E B Petcu, R A Smith, and A K-Y Lam Follicular variant of papillary thyroid carcinoma: a diagnostic challenge for clinicians and pathologists Postgrad. Med. J., February 1, 2008; 84(988): 78 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Klein, L. S. Spofford, E. V. Abel, A. Ortiz, and A. E. Aplin B-RAF Regulation of Rnd3 Participates in Actin Cytoskeletal and Focal Adhesion Organization Mol. Biol. Cell, February 1, 2008; 19(2): 498 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mariggio, B. M. Filippi, C. Iurisci, L. K. Dragani, V. De Falco, M. Santoro, and D. Corda Cytosolic Phospholipase A2{alpha} Regulates Cell Growth in RET/PTC-Transformed Thyroid Cells Cancer Res., December 15, 2007; 67(24): 11769 - 11778. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al. Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications Endocr. Rev., December 1, 2007; 28(7): 742 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Solit, E. Santos, C. A. Pratilas, J. Lobo, M. Moroz, S. Cai, R. Blasberg, J. Sebolt-Leopold, S. Larson, and N. Rosen 3'-Deoxy-3'-[18F]Fluorothymidine Positron Emission Tomography Is a Sensitive Method for Imaging the Response of BRAF-Dependent Tumors to MEK Inhibition Cancer Res., December 1, 2007; 67(23): 11463 - 11469. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Ball, N. Jin, D. M. Rosen, A. Dackiw, D. Sidransky, M. Xing, and B. D. Nelkin Selective Growth Inhibition in BRAF Mutant Thyroid Cancer by the Mitogen-Activated Protein Kinase Kinase 1/2 Inhibitor AZD6244 J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4712 - 4718. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R Rowe, B. G Bentz, and J. S Bentz Detection of BRAF V600E activating mutation in papillary thyroid carcinoma using PCR with allele-specific fluorescent probe melting curve analysis J. Clin. Pathol., November 1, 2007; 60(11): 1211 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Ridgway, Y. Tomer, and S. M. McLachlan Update in Thyroidology J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3755 - 3761. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Wang, Y.-W. Huang, J.-S. Huang, C.-H. Wang, V. C. Kok, C.-M. Hung, H.-M. Chen, and C.-Y. Tzen Anaplastic Carcinoma of the Thyroid Arising More Often from Follicular Carcinoma than Papillary Carcinoma Ann. Surg. Oncol., October 1, 2007; 14(10): 3011 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishii, H. Sootome, Y. Yagi, K. Yamashita, T. Noumi, and N. Noro A Selective Cellular Screening Assay for B-Raf and c-Raf Kinases J Biomol Screen, September 1, 2007; 12(6): 818 - 827. [Abstract] [PDF] |
||||
![]() |
K. D. McCall, N. Harii, C. J. Lewis, R. Malgor, W. Bae Kim, M. Saji, A. D. Kohn, R. T. Moon, and L. D. Kohn High Basal Levels of Functional Toll-Like Receptor 3 (TLR3) and Noncanonical Wnt5a Are Expressed in Papillary Thyroid Cancer and Are Coordinately Decreased by Phenylmethimazole Together with Cell Proliferation and Migration Endocrinology, September 1, 2007; 148(9): 4226 - 4237. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Davies, A. Logie, J. S. McKay, P. Martin, S. Steele, R. Jenkins, M. Cockerill, S. Cartlidge, and P. D. Smith AZD6244 (ARRY-142886), a potent inhibitor of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2 kinases: mechanism of action in vivo, pharmacokinetic/pharmacodynamic relationship, and potential for combination in preclinical models Mol. Cancer Ther., August 1, 2007; 6(8): 2209 - 2219. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Akeno-Stuart, M. Croyle, J. A. Knauf, R. Malaguarnera, D. Vitagliano, M. Santoro, C. Stephan, K. Grosios, M. Wartmann, R. Cozens, et al. The RET Kinase Inhibitor NVP-AST487 Blocks Growth and Calcitonin Gene Expression through Distinct Mechanisms in Medullary Thyroid Cancer Cells Cancer Res., July 15, 2007; 67(14): 6956 - 6964. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ciampi, T. J Giordano, K. Wikenheiser-Brokamp, R. J Koenig, and Y. E Nikiforov HOOK3-RET: a novel type of RET/PTC rearrangement in papillary thyroid carcinoma Endocr. Relat. Cancer, June 1, 2007; 14(2): 445 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kondo, L. Zheng, W. Liu, J. Kurebayashi, S. L. Asa, and S. Ezzat Epigenetically Controlled Fibroblast Growth Factor Receptor 2 Signaling Imposes on the RAS/BRAF/Mitogen-Activated Protein Kinase Pathway to Modulate Thyroid Cancer Progression Cancer Res., June 1, 2007; 67(11): 5461 - 5470. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, Z. Liu, S. Condouris, and M. Xing BRAF V600E Maintains Proliferation, Transformation, and Tumorigenicity of BRAF-Mutant Papillary Thyroid Cancer Cells J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2264 - 2271. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eszlinger, K. Krohn, A. Kukulska, B. Jarzab, and R. Paschke Perspectives and Limitations of Microarray-Based Gene Expression Profiling of Thyroid Tumors Endocr. Rev., May 1, 2007; 28(3): 322 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Chen, S. M. McLachlan, and B. Rapoport Suppression of Thyrotropin Receptor Constitutive Activity by a Monoclonal Antibody with Inverse Agonist Activity Endocrinology, May 1, 2007; 148(5): 2375 - 2382. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Fecher, S. D. Cummings, M. J. Keefe, and R. M. Alani Toward a Molecular Classification of Melanoma J. Clin. Oncol., April 20, 2007; 25(12): 1606 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Strumberg, J. W. Clark, A. Awada, M. J. Moore, H. Richly, A. Hendlisz, H. W. Hirte, J. P. Eder, H.-J. Lenz, and B. Schwartz Safety, Pharmacokinetics, and Preliminary Antitumor Activity of Sorafenib: A Review of Four Phase I Trials in Patients with Advanced Refractory Solid Tumors Oncologist, April 1, 2007; 12(4): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ciampi and Y. E. Nikiforov RET/PTC Rearrangements and BRAF Mutations in Thyroid Tumorigenesis Endocrinology, March 1, 2007; 148(3): 936 - 941. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al. Targeting BRAFV600E in thyroid carcinoma: therapeutic implications Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-J. Kim, H. C. Kang, S. G. Jang, S.-A Ahn, H.-J. Yoon, and J.-G. Park Development and Applications of a BRAF Oligonucleotide Microarray J. Mol. Diagn., February 1, 2007; 9(1): 55 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gridelli, P. Maione, F. Del Gaizo, G. Colantuoni, C. Guerriero, C. Ferrara, D. Nicolella, D. Comunale, A. De Vita, and A. Rossi Sorafenib and Sunitinib in the Treatment of Advanced Non-Small Cell Lung Cancer Oncologist, February 1, 2007; 12(2): 191 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hmitou, S. Druillennec, A. Valluet, C. Peyssonnaux, and A. Eychene Differential Regulation of B-Raf Isoforms by Phosphorylation and Autoinhibitory Mechanisms Mol. Cell. Biol., January 1, 2007; 27(1): 31 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Paternot, J. E. Dumont, and P. P. Roger Differential Utilization of Cyclin D1 and Cyclin D3 in the Distinct Mitogenic Stimulations by Growth Factors and TSH of Human Thyrocytes in Primary Culture Mol. Endocrinol., December 1, 2006; 20(12): 3279 - 3292. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Palona, H. Namba, N. Mitsutake, D. Starenki, A. Podtcheko, I. Sedliarou, A. Ohtsuru, V. Saenko, Y. Nagayama, K. Umezawa, et al. BRAFV600E Promotes Invasiveness of Thyroid Cancer Cells through Nuclear Factor {kappa}B Activation Endocrinology, December 1, 2006; 147(12): 5699 - 5707. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Mittendorf, A. Khiyami, and C. R. McHenry When Fine-Needle Aspiration Biopsy Cannot Exclude Papillary Thyroid Cancer: A Therapeutic Dilemma Arch Surg, October 1, 2006; 141(10): 961 - 966. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Lubitz, S. K. Ugras, J. J. Kazam, B. Zhu, T. Scognamiglio, Y.-T. Chen, and T. J. Fahey III Microarray Analysis of Thyroid Nodule Fine-Needle Aspirates Accurately Classifies Benign and Malignant Lesions J. Mol. Diagn., September 1, 2006; 8(4): 490 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsukuma, M. Yoshihara, F. Kasai, A. Kato, A. Yoshida, M. Akaike, O. Kobayashi, H. Nakayama, Y. Sakuma, T. Yoshida, et al. Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay J. Mol. Diagn., September 1, 2006; 8(4): 504 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Weber, R. E. Teresi, C. E. Broelsch, A. Frilling, and C. Eng A Limited Set of Human MicroRNA Is Deregulated in Follicular Thyroid Carcinoma J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3584 - 3591. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. James, T. Dumeni, M. S. Stark, D. L. Duffy, G. W. Montgomery, N. G. Martin, and N. K. Hayward Rapid Screening of 4000 Individuals for Germ-line Variations in the BRAF Gene Clin. Chem., September 1, 2006; 52(9): 1675 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mesa Jr., M. Mirza, N. Mitsutake, M. Sartor, M. Medvedovic, C. Tomlinson, J. A Knauf, G. F. Weber, and J. A. Fagin Conditional Activation of RET/PTC3 and BRAFV600E in Thyroid Cells Is Associated with Gene Expression Profiles that Predict a Preferential Role of BRAF in Extracellular Matrix Remodeling. Cancer Res., July 1, 2006; 66(13): 6521 - 6529. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Bakhsh, G Kirov, J W Gregory, E D Williams, and M Ludgate A new form of familial multi-nodular goitre with progression to differentiated thyroid cancer. Endocr. Relat. Cancer, June 1, 2006; 13(2): 475 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al. RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eszlinger, M. Wiench, B. Jarzab, K. Krohn, M. Beck, J. Lauter, E. Gubala, K. Fujarewicz, A. Swierniak, and R. Paschke Meta- and Reanalysis of Gene Expression Profiles of Hot and Cold Thyroid Nodules and Papillary Thyroid Carcinoma for Gene Groups J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1934 - 1942. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. McCarthy, M. Wang, T. D. Jones, R. W. Strate, and L. Cheng Molecular Evidence for the Same Clonal Origin of Multifocal Papillary Thyroid Carcinomas Clin. Cancer Res., April 15, 2006; 12(8): 2414 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Giordano, A. Y.M. Au, R. Kuick, D. G. Thomas, D. R. Rhodes, K. G. Wilhelm Jr., M. Vinco, D. E. Misek, D. Sanders, Z. Zhu, et al. Delineation, Functional Validation, and Bioinformatic Evaluation of Gene Expression in Thyroid Follicular Carcinomas with the PAX8-PPARG Translocation. Clin. Cancer Res., April 1, 2006; 12(7): 1983 - 1993. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiloeches and R. Marais Is BRAF the Achilles' Heel of Thyroid Cancer? Clin. Cancer Res., March 15, 2006; 12(6): 1661 - 1664. [Full Text] [PDF] |
||||
![]() |
B. Ouyang, J. A. Knauf, E. P. Smith, L. Zhang, T. Ramsey, N. Yusuff, D. Batt, and J. A. Fagin Inhibitors of Raf Kinase Activity Block Growth of Thyroid Cancer Cells with RET/PTC or BRAF Mutations In vitro and In vivo. Clin. Cancer Res., March 15, 2006; 12(6): 1785 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Canchola, P. L. Horn-Ross, and D. M. Purdie Risk of Second Primary Malignancies in Women with Papillary Thyroid Cancer Am. J. Epidemiol., March 15, 2006; 163(6): 521 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salvatore, V. De Falco, P. Salerno, T. C. Nappi, S. Pepe, G. Troncone, F. Carlomagno, R. M. Melillo, S. M. Wilhelm, and M. Santoro BRAF Is a Therapeutic Target in Aggressive Thyroid Carcinoma Clin. Cancer Res., March 1, 2006; 12(5): 1623 - 1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sapio, D. Posca, G. Troncone, G. Pettinato, L. Palombini, G. Rossi, G. Fenzi, and M. Vitale Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA) Eur. J. Endocrinol., February 1, 2006; 154(2): 341 - 348. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Panka, W. Wang, M. B. Atkins, and J. W. Mier The Raf Inhibitor BAY 43-9006 (Sorafenib) Induces Caspase-Independent Apoptosis in Melanoma Cells Cancer Res., February 1, 2006; 66(3): 1611 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsutake, M. Miyagishi, S. Mitsutake, N. Akeno, C. Mesa Jr, J. A. Knauf, L. Zhang, K. Taira, and J. A. Fagin BRAF Mediates RET/PTC-Induced Mitogen-Activated Protein Kinase Activation in Thyroid Cells: Functional Support for Requirement of the RET/PTC-RAS-BRAF Pathway in Papillary Thyroid Carcinogenesis Endocrinology, February 1, 2006; 147(2): 1014 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Castro, A. P. Rebocho, R. J. Soares, J. Magalhaes, L. Roque, V. Trovisco, I. Vieira de Castro, M. Cardoso-de-Oliveira, E. Fonseca, P. Soares, et al. PAX8-PPAR{gamma} Rearrangement Is Frequently Detected in the Follicular Variant of Papillary Thyroid Carcinoma J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 213 - 220. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al. PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth Endocrinology, January 1, 2006; 147(1): 367 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. He, K. Jazdzewski, W. Li, S. Liyanarachchi, R. Nagy, S. Volinia, G. A. Calin, C.-g. Liu, K. Franssila, S. Suster, et al. The role of microRNA genes in papillary thyroid carcinoma PNAS, December 27, 2005; 102(52): 19075 - 19080. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mercer, S. Giblett, S. Green, D. Lloyd, S. DaRocha Dias, M. Plumb, R. Marais, and C. Pritchard Expression of Endogenous Oncogenic V600EB-raf Induces Proliferation and Developmental Defects in Mice and Transformation of Primary Fibroblasts Cancer Res., December 15, 2005; 65(24): 11493 - 11500. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Jarzab, D Handkiewicz-Junak, and J Wloch Juvenile differentiated thyroid carcinoma and the role of radioiodine in its treatment: a qualitative review Endocr. Relat. Cancer, December 1, 2005; 12(4): 773 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, W. H. Westra, R. P. Tufano, Y. Cohen, E. Rosenbaum, K. J. Rhoden, K. A. Carson, V. Vasko, A. Larin, G. Tallini, et al. BRAF Mutation Predicts a Poorer Clinical Prognosis for Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6373 - 6379. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Garcia-Rostan, A. M. Costa, I. Pereira-Castro, G. Salvatore, R. Hernandez, M. J.A. Hermsem, A. Herrero, A. Fusco, J. Cameselle-Teijeiro, and M. Santoro Mutation of the PIK3CA Gene in Anaplastic Thyroid Cancer Cancer Res., November 15, 2005; 65(22): 10199 - 10207. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Borrello, L. Alberti, A. Fischer, D. Degl'Innocenti, C. Ferrario, M. Gariboldi, F. Marchesi, P. Allavena, A. Greco, P. Collini, et al. Induction of a proinflammatory program in normal human thyrocytes by the RET/PTC1 oncogene PNAS, October 11, 2005; 102(41): 14825 - 14830. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beeram, A. Patnaik, and E. K. Rowinsky Raf: A Strategic Target for Therapeutic Development Against Cancer J. Clin. Oncol., September 20, 2005; 23(27): 6771 - 6790. [Abstract] [Full Text] [PDF] |
||||
![]() |
A B Hassan and C Paraskeva Colorectal cancer prognosis: is it all mutation, mutation, mutation? Gut, September 1, 2005; 54(9): 1209 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Guarino, P. Faviana, G. Salvatore, M. D. Castellone, A. M. Cirafici, V. De Falco, A. Celetti, R. Giannini, F. Basolo, R. M. Melillo, et al. Osteopontin Is Overexpressed in Human Papillary Thyroid Carcinomas and Enhances Thyroid Carcinoma Cell Invasiveness J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5270 - 5278. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vasko, S. Hu, G. Wu, J. C. Xing, A. Larin, V. Savchenko, B. Trink, and M. Xing High Prevalence and Possible de Novo Formation of BRAF Mutation in Metastasized Papillary Thyroid Cancer in Lymph Nodes J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5265 - 5269. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Z. Feng, T. Shiozawa, T. Miyamoto, H. Kashima, M. Kurai, A. Suzuki, and I. Konishi BRAF Mutation in Endometrial Carcinoma and Hyperplasia: Correlation with KRAS and p53 Mutations and Mismatch Repair Protein Expression Clin. Cancer Res., September 1, 2005; 11(17): 6133 - 6138. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hatch, E. Ron, A. Bouville, L. Zablotska, and G. Howe The Chernobyl Disaster: Cancer following the Accident at the Chernobyl Nuclear Power Plant Epidemiol. Rev., July 1, 2005; 27(1): 56 - 66. [Full Text] [PDF] |
||||
![]() |
M. O. Hoque, E. Rosenbaum, W. H. Westra, M. Xing, P. Ladenson, M. A. Zeiger, D. Sidransky, and C. B. Umbricht Quantitative Assessment of Promoter Methylation Profiles in Thyroid Neoplasms J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4011 - 4018. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Shattuck, W. H. Westra, P. W. Ladenson, and A. Arnold Independent Clonal Origins of Distinct Tumor Foci in Multifocal Papillary Thyroid Carcinoma N. Engl. J. Med., June 9, 2005; 352(23): 2406 - 2412. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Xing BRAF mutation in thyroid cancer Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Rossi, L Fugazzola, L De Pasquale, P Braidotti, V Cirello, P Beck-Peccoz, S Bosari, and A Bastagli Medullary and papillary carcinoma of the thyroid gland occurring as a collision tumour: report of three cases with molecular analysis and review of the literature Endocr. Relat. Cancer, June 1, 2005; 12(2): 281 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Krohn, D. Fuhrer, Y. Bayer, M. Eszlinger, V. Brauer, S. Neumann, and R. Paschke Molecular Pathogenesis of Euthyroid and Toxic Multinodular Goiter Endocr. Rev., June 1, 2005; 26(4): 504 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Knauf, X. Ma, E. P. Smith, L. Zhang, N. Mitsutake, X.-H. Liao, S. Refetoff, Y. E. Nikiforov, and J. A. Fagin Targeted Expression of BRAFV600E in Thyroid Cells of Transgenic Mice Results in Papillary Thyroid Cancers that Undergo Dedifferentiation Cancer Res., May 15, 2005; 65(10): 4238 - 4245. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Illario, A. L. Cavallo, S. Monaco, E. Di Vito, F. Mueller, L. A. Marzano, G. Troncone, G. Fenzi, G. Rossi, and M. Vitale Fibronectin-Induced Proliferation in Thyroid Cells Is Mediated by {alpha}v{beta}3 Integrin through Ras/Raf-1/MEK/ERK and Calcium/CaMKII Signals J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2865 - 2873. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Caudill, Z. Zhu, R. Ciampi, J. R. Stringer, and Y. E. Nikiforov Dose-Dependent Generation of RET/PTC in Human Thyroid Cells after in Vitro Exposure to {gamma}-Radiation: A Model of Carcinogenic Chromosomal Rearrangement Induced by Ionizing Radiation J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2364 - 2369. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |