Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Joint Metastasis Research Society-AACR Conference on Metastasis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siegfried, G.
Right arrow Articles by Seidah, N. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siegfried, G.
Right arrow Articles by Seidah, N. G.
[Cancer Research 63, 1458-1463, April 1, 2003]
© 2003 American Association for Cancer Research


Biochemistry and Biophysics

The Proteolytic Processing of Pro-Platelet-derived Growth Factor-A at RRKR86 by Members of the Proprotein Convertase Family Is Functionally Correlated to Platelet-derived Growth Factor-A-induced Functions and Tumorigenicity1

Géraldine Siegfried, Abdel-Majid Khatib, Suzanne Benjannet, Michel Chrétien and Nabil G. Seidah2

Laboratory of Biochemical Neuroendocrinology Clinical Research Institute of Montreal, Montreal, Quebec, H2W 1R7 [G. S., A-M. K., S. B., N. G. S.], and Regional Protein Chemistry Centre, Diseases of Ageing Program, Ottawa Health Research Institute, Ottawa, Ontario, K1Y 4E9 [A-M. K., M. C.] Canada


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although altered expression of platelet-derived growth factor (PDGF)-A is a hallmark of many cancers, the importance of pro-PDGF-A conversion to PDGF-A in tumorigenesis and the cognate protease(s) is unknown. Pro-PDGF-A processing occurs at pairs of basic residues, likely involving the proprotein convertases (PCs). In the colon carcinoma cell line LoVo, we found that Furin is the most potent PDGF-A convertase. Mutation of the PC-site RRKR86 to ARKA86 inhibited pro-PDGF-A processing, its receptor tyrosine phosphorylation, and cell proliferation. This processing is also blocked by the PC preprosegments (pps) ppFurin, ppPC5, and ppPACE4, and by the Furin-variants of {alpha}2-macroglobulin and {alpha}1-antitrypsin. Chinese hamster ovary cells overexpressing pro-PDGF-A (ARKA86) failed to induce tumors in nude mice. Thus, PC-directed inhibitors might represent new agents for therapy in neoplasia induced by PDGF-A.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Many reports have cited the coexpression of PDGF3 and its receptors in various tumor cells, suggesting both autocrine and paracrine mechanisms for PDGF-mediated tumor growth and invasion (1, 2, 3) . The expression of PDGF and its receptors is up-regulated in diverse human cancers (1, 2, 3) , and has been associated directly with metastases (4) and angiogenesis (5) . PDGF is a disulfide-linked dimer composed of two polypeptide chains, denoted A and B, and represented in vivo by three PDGFs, PDGF-AA, PDGF-AB, and PDGF-BB (6, 7, 8, 9) . These isoforms bind to and activate two tyrosine kinase receptors, PDGF receptor-{alpha} and PDGF receptor-ß (6, 7, 8, 9) . The {alpha}-receptor binds both the A and B chains of PDGF, but the ß-receptor binds only the B chain. Two new members of the PDGF family, PDGF-C and PDGF-D were reported recently, exhibiting similar binding properties to PDGF-AB (10, 11, 12, 13, 14) . Alternative splicing of the PDGF-A mRNA results in a long and short form. The longer variant (211 aa) is less common and differs from the shorter one (196 aa) by a COOH-terminal extension of 15 aa (8 , 4 , 15) . After dimerization of PDGF-A monomers in the ER into a Mr ~50,000 form, this complex transits through the Golgi apparatus toward the trans Golgi Network where it is proteolytically cleaved at the sequence RRKR86{downarrow} and secreted as a Mr ~30,000 dimeric product (15) . However, nothing is known about the enzymes involved in this processing event, likely leading to the activation of PDGF-A. The RRKR86{downarrow} cleavage site suggested that the dibasic-specific PCs could be implicated in this process (16) . The mammalian subtilisin-like PCs constitute a family of seven known dibasic-specific proteinases, namely, Furin, PC1, PC2, PC4, PACE4, PC5, and PC7, as well as the two nonbasic specific convertase SKI-1 (16 , 17) and NARC-1 (18) . The PCs are implicated in the processing of multiple protein precursors, including proteases, growth factors, and receptors at multibasic recognition sites exhibiting the general motif (K/R)-(X)n-(K/R){downarrow} (n = 0, 2, 4, or 6; Refs. 16 , 17 ). The enzyme SKI-1 recognizes the motif (R/K)-X-(L,V)-Z{downarrow}, where Z is any aa except Pro, Cys, Glu, and Val (17) and NARC-1 prefers the motif Y-X-(V/I)-X-(L/M){downarrow} (18) . The purpose of this study was to identify the protease(s) involved in the processing of PDGF-A, and to evaluate the importance of this cleavage in PDGF-A-mediated ex vivo functions and in vivo tumor growth.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pro-PDGF-A Constructs.
The human pro-PDGF-A cDNA was kindly provided by Dr. Carl-Henrik Heldin (Ludwig Institute for Cancer Research, Uppsala, Sweden). Pro-PDGF-A-V5 (with a COOH-terminal V5-tag) was cloned into XhoI/BamHI-digested pIRES2-EGFP vector (Clontech, Palo Alto, CA) to generate pIRES2-EGFP-PDGF-A-V5. Mutagenesis was done by PCR using the primers: 5'CCCATTGCGAGGAAGGCAAGCATC3' and 5' GATGCTTGCCTTCCTCGCAATGGG3' for the mutant RRKR86 into ARKA86, 5'CCCATTCGGAGGCTGAGAAGCATC3' and 5'GATGCTTCTCAGCCTCCGAATGGG for the mutant RRKR86 into RRKL86, and 5'CCCATTCGGAGGCTGCTAAGCATC3' and 5'GATGCTTAGCAGCCTCCGAATGGG3' for the mutant RRKR86 into RRLL86. The PDGF-A cDNA mutants were transferred into the pIRES2-EGFP-V5 vector and their integrity confirmed by DNA sequencing.

Transfections and Cell Culture.
The Furin-deficient LoVo-C5 human colon adenocarcinoma cells were transiently cotransfected with the empty vector pIRES2-EGFP-V5, pIRES2-EGFP-PDGF-A-V5 construct or with the pIRES2-EGFP-PDGF-A-V5 and pIRES2-EGFP vector that expresses either full-length Furin, PACE4, PC5A, PC5B, PC7, or SKI-1 cDNAs (19) . The human embryonic kidney (HK293) cells were transiently cotransfected with the pIRES2-EGFP-V5 empty vector, pIRES2-EGFP-PDGF-A-V5 construct, or with the pIRES2-EGFP-PDGF-A-V5 and pIRES2-EGFP that express PCs inhibitors including ppFurin, ppPACE4, ppPC5, ppPC7, ppSKI-1, (wild-type) or mutated {alpha}2-MG-F, and {alpha}1-PDX (19) . In several experiments HK293 cells or CHO cells lacking SKI-1 (20) or the same cells stably expressing SKI-1 [SKI-1 (+) cells] were transiently transfected with pIRES2-EGFP-V5 vector expressing either wild-type or mutated PDGF-A cDNAs. Wild-type CHO-K1 cells were stably transfected with pIRES2-EGFP-V5 empty vectors, or pIRES2-EGFP-V5 vector containing wild PDGF-A or mutated PDGF-A (ARKA86) cDNAs. Pools of stably transfected cells were selected using G418 resistance, and controlled by Western blotting for wild-type and mutant PDGF-A expression. All of the transfections were carried out using the Effectene transfection reagent (Qiagen Inc., Mississauga, Ontario, Canada) as recommended by the manufacturer. Cells were grown in DMEM supplemented with 10% FCS, 100 units/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc., Burlington, Ontario, Canada). For the stably transfected CHO cells 400 µg/ml G418 were added.

Biosynthetic Labeling and Immunoprecipitation.
Two days after transfection, the cells were washed and then pulse-labeled for 2–3 h with 200 µCi/ml [35S]Cys. After the pulse period, cells were lysed in buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 6.8), 0.5% NP40, and 0.5% sodium deoxycholate (Roche Molecular Biochemicals), and prepared for immunoprecipitations as described previously (19) . Anti-V5 (1:1000 dilution; Invitrogen) was used as the primary antibody.

Western Blotting.
Twenty-four h after transfection, the cells were lysed in PBS containing 2% NP40, Lysates were subjected to SDS-PAGE on 8% gels, and proteins were blotted onto nitrocellulose membranes. The primary antibodies used were: monoclonal antibodies directed against either the V5 epitope (1:1000 dilution; Invitrogen) or antiphosphotyrosine (2 µg/ml; Sigma-Aldrich Ltd., Oakville, Ontario, Canada).

Tyrosine Phosphorylation Assay.
Confluent fibroblast NIH BALB/c-3T3 cells grown in 75-cm2 flask dishes were maintained in serum-free DMEM for 24 h and incubated with or without medium derived from the indicated cells. Cells were washed twice in ice-cold PBS and lysed with lysis buffer [50 mM HEPES (pH 7.6), 150 mM NaCl, 1% Triton X-100, 2 mM vanadate, 100 mM NaF, and 0.40 mg/ml phenylmethylsulfonyl fluoride], and proteins were analyzed by Western blotting.

Cell Growth Assay.
This assay was monitored as described previously elsewhere (21) . Briefly, serum-starved BALB/c-3T3 cells were incubated for 24 h in medium derived from transfected HK293 cells. For the last 6 h of incubation, 0.5 µCi/well of [3H]methyl-thymidine (Amersham) was added, and cells were harvested onto glass-fiber filters using a cell harvester (Pharmacia, Wallac Oy, Turku, Finland), and radioactivity was counted. Results were expressed as percentages of the values obtained for cells incubated with medium derived from HK293 cells transfected with empty vectors and medium derived from HK293 cells transfected with wild or mutated PDGF-A cDNAs.

In Vivo Tumorigenecity Assays.
For tumor growth measurement, pools of control CHO-K1 cells or CHO-K1 cells expressing wild-type or mutant PDGF-A cDNA (RRKR86 to ARKA86) were assessed for their ability to proliferate as indicated above and injected s.c. into 4–6-week-old male athymic mice. Animals were monitored for tumor formation every 7 days as described previously (21) , and tumors were cryosectioned and stained with H&E.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Processing of Pro-PDGF-A by the PCs.
To determine which PC cleaves pro-PDGF-A, we transiently coexpressed in LoVo cells, a Furin-deficient cell line, both pro-PDGF-A C-terminally tagged with a V5-epitope (Fig. 1A)Citation and each of the PCs. After transfection the cells were pulse-labeled for 2 h with [35S]Cys, and the medium was immunoprecipitated with anti-V5 mAb (Fig. 1B)Citation . In parallel, supernatants collected 24 h after transfection were also analyzed for pro-PDGF-A processing by immunoblotting (Fig. 1C)Citation . As illustrated in Fig. 1BCitation , LoVo cells cotransfected with pro-PDGF-A recombinant and the empty vector (Control) exhibited only one band with an apparent molecular weight of Mr ~25,000 corresponding to the intact monomeric PDGF-A precursor. Cotransfection of pro-PDGF-A with vectors encoding each of the PCs revealed that Furin, and to a much lesser extent PC5A and PC7, could process the Mr ~25,000 protein into a Mr ~15,000 product, corresponding to the mature form of monomeric PDGF-A. Western blot analysis of conditioned medium derived from LoVo cells cotransfected with pro-PDGF-A, and each of the PCs revealed that aside from Furin, PC5A > PACE4 and PC7 but not SKI-1 can process pro-PDGF-A under steady-state conditions (Fig. 1C)Citation .



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Processing of pro-PDGF-A by the PCs family members. A, schematic representation of the primary structure of the 211-aa of human pro-PDGF-A, PC-processing site (RRKR86), and the V5-tag attached to the COOH terminus. Pro-PDGF-A processing was analyzed by biosynthesis (B) and (C) Western blotting of LoVo-C5 conditioned medium obtained from transiently transfected cells with vector containing pro-PDGF-A cDNA (Control), or with vector containing pro-PDGF-A and vector that expresses full-length human Furin, PACE4, SKI-1, mouse PC5A, PC5B, or rat PC7. Inhibition of pro-PDGF-A processing by PC inhibitors was assessed by biosynthesis (D) and Western blotting (E) transiently transfected HK 293 cells with vector containing pro-PDGF-A cDNA alone (Control) or with vector that expresses ppFurin, ppPACE4, ppPC5, and ppPC7, wild-type or {alpha}2-MG-F, and {alpha}1-PDX. Band intensities of the autoluminographs were quantitated by densitometry, and the corresponding percentages of band intensities are deduced from the ratio of those of PDGF-A:(pro-PDGF-A+ PDGF-A). Shown are the results of a representative example of four independent experiments.

 
Blockade of PDGF-A Processing by PC Inhibitors.
To assess the possibility that PDGF-A is proteolytically activated by endogenous PC-like endoproteases, we cotransfected HK293 cells with vectors encoding pro-PDGF-A and each of the PC-inhibitors including the prosegments of PCs, namely, ppFurin, ppPACE4, ppPC5, ppPC7, and ppSKI-1, the Furin-motif variants of {alpha}2-MG-F, and of the serpin {alpha}1-PDX (19) . Both biosynthesis (Fig. 1D)Citation and Western blot (Fig. 1F)Citation analyses concur that endogenous convertase(s) of HK293 cells are capable of complete processing of pro-PDGF-A into PDGF-A (Control). Cotransfection of cells with PC inhibitors revealed that processing of pro-PDGF-A is blocked by ppFurin (100%), ppPC5 (~60%), and ppPACE4 (~50%), as well as by {alpha}2-MG-F (~40%) and {alpha}1-PDX (100%). In contrast, ppSKI-1 and ppPC7 or wild-type {alpha}1-AT failed to inhibit processing. Because close to complete inhibition of pro-PDGF-A cleavage occurred only with ppFurin and {alpha}1-PDX, theses results suggest that most of the PDGF-A-converting activity found in HK293 cells is related to Furin, and that ppPC5 and ppPACE4 can partially inhibit Furin (19 , 22 , 23) .

Cleavage Site Specificity of PDGF-A Processing in HK293 Cells.
To assess the cleavage site specificity of PDGF-A processing we analyzed whether Arg for Ala or Lys substitutions at the P1 and/or the P4 positions at the PC-motif RRKR86 will affect processing of pro-PDGF-A by endogenous or exogenous Furin-like activity. The results of expression of these constructs in HK293 cells and their processing by endogenous enzymes or after overexpression of Furin are shown in Fig. 2Citation . As described previously in Fig. 1Citation , when wild-type pro-PDGF-A (RRKR86) and EGFP vector are cotransfected in HK293 cells, one major band corresponding to mature PDGF-A is detected in the conditioned medium (Fig. 2A)Citation . When the PDGF-A mutant ARKA86 is transfected in these cells, the processing of pro-PDGF-A is completely blocked. These results highlight the importance of Arg at positions P1 and P4 for the processing of pro-PDGF-A. Transfection of HK293 cells with the pro-PDGF-A mutants RRKL86 or RRLL86 revealed that the processing of these mutants is not completely blocked (Fig. 2A)Citation . Overexpression of Furin in the presence of these pro-PDGF-A constructs revealed that only the processing of the mutant RRKL86 was increased from 25% to 100%. This suggested that Furin could process this mutant, possibly at the alternative dibasic RR84{downarrow}KL site, containing a favorable Leu at P2' (17) . However, because Furin cannot process precursors with a P1' Leu (17) , it is not surprising that the RRLL86 mutant is not processed by Furin. However, expression of these PDGF-A cDNA constructs in SKI-1(+) cells mainly increased the processing of the pro-PDGF-A mutant RRLL86 and much less so of the RRKL86 one, without affecting that of the wild-type86 or ARKA86 mutant (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Cleavage site specificity of pro-PDGF-A processing in HK293 cells. Conditioned medium obtained from transiently transfected HK293 cells with wild-type pro-PDGF-A (RRKR86) or mutants pro-PDGF-A ARKA86, RRKL86, or RRLL86 and analyzed by biosynthesis (B) and Western blotting (C). In several experiments, HK293 cells were cotransfected with Furin and the pro-PDGF cDNA mutant constructs. Band intensities of the autoluminographs were quantitated by densitometry, and the corresponding percentages of band intensities are deduced from the ratio of those of PDGF-A:(pro-PDGF-A+ PDGF-A). Shown are the results of one representative experiment of four performed; as means ± standard deviation (SD).

 
Tyrosine Phosphorylation of the PDGF-A Receptor.
To examine whether pro-PDGF-A processing by PCs is required for the mediation of its functions, conditioned media from transfected HK293 cells were tested for tyrosine phosphorylation of the PDGF-A receptor (PDGF-AR) and mitogenic activity. Fig. 3ACitation shows that media derived from HK293 cells transfected with wild-type or mutants PDGF-A RRLL86 and RRKL86 enhanced the tyrosine phosphorylation of PDGF receptors and [3 H]methyl-thymidine incorporation (Fig. 3B)Citation in NIH/BALB-c 3T3 cells. In contrast, media derived from cells transfected with the ARKA86 mutant were not effective.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 3. Pro-PDGF-A processing blockade inhibit in vitro and in vivo cell growth. A, starved NIH 3T3/BALB-c cells were incubated for 10 min either with the PDGF-AA ligand (10 nM) used as a positive control for PDGF-A receptor (PDGF-AR) tyrosine phosphorylation, or with medium derived from HK293 cells transfected with empty vector, vector containing wild-type pro-PDGF-A (RRKR86), or mutated pro-PDGF-A (ARKA86; RRLL86; and RRKL86) cDNAs and cell lysates were analyzed by Western blotting for tyrosine phosphorylation. B, starved NIH 3T3/BALB-c cells were incubated for 24 h in medium derived from HK293 cells transfected with empty vector, or a cDNA vector containing wild-type or mutants of pro-PDGF-A in the presence of 2% FCS. [3H]Thymidine was added for the final 6 h of incubation, and radioactivity was measured as described previously (21) . C, CHO tumor cells were stably transfected with empty vector, or vectors containing either wild-type or mutant (ARKA86) PDGF-A cDNA constructs. Pools of stably transfected cells were selected using G418 resistance and analyzed by Western blot using a V5 mAb. D, control CHO cells, expressing wild-type or mutant (ARKA86) PDGF-A were injected s.c. into 4–6-week-old male nude mice (n = 6). The animals were monitored for tumor formation every 3 days as described previously (21) . Results shown are representative of four experiments expressed as mean; bars, ± SD. E, tumors developed after 17 days post-s.c. injection were cryosectioned and stained with H&E, and observed under x200 and x400 magnifications.

 
PDGF-A Processing and Tumorigenesis.
Before any analysis, pools of CHO-K1 tumor cells stably expressing wild-type and mutant (ARKA86) pro-PDGF-A were selected, and shown to efficiently produce and secrete the expected proteins, as verified by Western blotting of the media. Thus, whereas the mature PDGF-A is secreted from wild-type PDGF-A cell-pools, mostly unprocessed pro-PDGF-A is secreted from the ARKA86-expressing cell pool (Fig. 3C)Citation . To assess the importance of pro-PDGF-A processing on the tumorigenicity of CHO cells, three groups of 6 male nude mice were s.c. inoculated with 4–5 x 106 cell pools of control CHO-K1 (empty vector), CHO-K1 cells expressing pro-PDGF-A, or the pro-PDGF-A mutant ARKA86. As illustrated in Fig. 3DCitation , expression of pro-PDGF-A in these cells increased tumor growth. Whereas tumor cells expressing mutant pro-PDGF-A developed tumors with reduced size as compared with CHO-K1 controls, analysis of the cell morphology using H&E staining revealed that tumors derived from either control or CHO-K1-PDGF-A (ARKA86) cells showed increased apoptosis, and the tumor tissue exhibited necrotic areas (Fig. 3E)Citation .


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Many normal and tumor cells express PDGF-A that stimulates their own growth in an autocrine and/or paracrine manner (1, 2, 3, 4, 5, 6) . The importance of these PDGF-A functions is reinforced by the selective expression of PDGF-A and its {alpha}-receptor but not PDGF-B during the early stage of development (24 , 25) . Defects in PDGF-A interaction with its receptors during development results in anatomical defects leading to lethality (25) . In addition, overexpression of PDGF-A mRNA in many cancers including brain and gastric carcinoma, and the lethal phenotype associated with cell hyperplasia in transgenic mice overexpressing PDGF-A (26) make this growth factor particularly interesting for proliferative disorder investigations. Upon synthesis of pre-pro-PDGF-A, the signal peptide is rapidly removed and pro-PDGF-A is then translocated to the Golgi network where other post-translational modifications occur. The newly synthesized PDGF-A chains are dimerized in the ER and thereafter transferred to the Golgi complex for proteolytic processing to produce a Mr~30,000 dimeric molecule that is carried in vesicles to the cell surface for release extracellularly by exocytosis (15) . The presence of an optimum Furin consensus cleavage motif (RRKR{downarrow}SI) in PDGF-A (16 , 17) and the ubiquitous expression of Furin suggested that this convertase is a good candidate for PDGF-A processing and activation. In pulse-chase experiments, using the Furin-deficient human colon carcinoma cell line LoVo (18) , we found that Furin is the major candidate pro-PDGF-A convertase. However, Western blotting experiments revealed that under steady-state conditions other PCs such as PC5, PACE4, and PC7, were also able to processes PDGF-A. A similar conclusion was also reached with the transforming growth factor ß (27) . The endogenous processing of PDGF-A by PCs is confirmed by the inhibition of pro-PDGF-A processing in HK293 cells by the PC prosegments of Furin, PC5, PACE4, the Furin-motif variants of {alpha}2-MG-F, and serpin {alpha}1 pdx. However, the inhibitory prosegments of PC7, SKI-1, or wild-type {alpha}2-MG- and {alpha}1-antitrypsin did not significantly affect this cleavage. Expression experiments with pro-PDGF-A mutants containing substitutions at the potential cleavage site RRKR{downarrow}SL revealed that pro-PDGF-A is processed at Arg86 in HK293 cells. Experiments with additional mutants revealed that Arg83, Lys85, and Arg86 were also required for optimal endoproteolysis, and underline the requirement for basic residues in the P1, P2, and P4 positions, which are characteristic of the substrate specificity of some members of the PC family including Furin (16 , 17) . The efficient secretion of the unprocessed pro-PDGF-A mutants indicates that the intracellular proteolytic cleavage is not a prerequisite for PDGF-A secretion. This was additionally confirmed by the accumulation of pro-PDGF-A in media derived from PDGF-A-transfected LoVo cells and HK293 cells transfected with PC inhibitors. The importance of the RRKR86 sequence in pro-PDGF-A processing was reported previously by Mercola et al. (24) . They demonstrated that alteration of the pro-PDGF-A cleavage site RRKR86 to RSNG86 resulted in the formation of a stable PDGF-A precursor. In agreement, our results demonstrated that the processing of pro-PDGF-A mutants RRKR86 into ARKA86 is completely blocked. However, transfections with the mutants RRKR86 into RRLL86 and RRKR86 into RRKL86 still produce the mature form of PDGF-A. The processing of the RRLL86 mutant is not mediated by a PC-like activity, because overexpression of Furin did not significantly affect its processing (Fig. 2B)Citation , suggesting the involvement of another protease(s) in this process. Indeed, on cotransfection of these mutants with the novel convertase SKI-1/S1P in CHO cells deficient of this enzyme (20) , only the mutants RRLL86 and RRKL86 were processed by SKI-1, suggesting that it is also the enzyme involved in the processing of the PDGF-A mutants RRLL86 and to some extent RRKL86 in HK293 cells. The convertase SKI-1 is a type I membrane-bound subtilisin-pyrolysin-like enzyme, identified to exhibit a specificity for precursor cleavage at the motif (R/K)-X-(hydrophobic)-(L,K,F,T) {downarrow}, as deduced from its ability to process brain-derived neurotrophic factor, sterol regulatory element binding proteins, and recently the ER stress-induced transcription factor ATF6 (reviewed in Ref. 17 ). This conclusion cautions the indiscriminate mutation of processing sites in precursors, as this may result in a switching of the type of convertase involved that normally does not cleave at this site.

Like the other PDGFs, PDGF-A elicits its biological activity through interactions with transmembrane high-affinity receptors. Binding of PDGF-AA ligand to its receptor results in the autophosphorylation of the latter (9) . In turn, the PDGF receptor activates an enzyme cascade that includes various phosphorylating enzymes, e.g., protein kinase C, Ras, Raf, and mitogen-activated protein kinase, and ultimately triggers cell division (6, 7, 8, 9) . Similar to vascular endothelial growth factor and basic fibroblast growth factor, PDGF acts as a "competence" factor enabling cells to enter the G1 phase, and participates with "progression" factors such as insulin-like growth factor I to move cells from the G1 into S phase, ultimately resulting in cell division. Our studies demonstrate that complete inhibition of PDGF-A processing by mutagenesis (mutant ARKA86) blocked the ability of PDGF-A to mediate PDGF-A receptor tyrosine phosphorylation and [3H]thymidine incorporation in 3T3 cells. In contrast, although the processing the PDGF-A mutants RRLL86 and RRKL86 is dramatically reduced, the low level of the produced mature PDGF-A was enough to mediate PDGF-A receptor tyrosine phosphorylation and to stimulate [3H]thymidine incorporation. To investigate the biological role of PDGF-A processing in vivo in tumor growth, we used CHO-K1 cells (that do not produce endogenous PDGF-A) to study the effects of wild and mutant PDGF-A (ARKA86) on tumor growth in nude mice. Our results demonstrated that expression of PDGF-A in these cells increased the incidence and growth rate of the developed tumors. These results are in agreement with a previous report showing that PDGF-A overexpression in various tumor cells including mesothelioma increased tumor formation (28) . In contrast, s.c. inoculation of tumor cells expressing the PDGF-A mutant ARKA86 cDNA induced tumors with reduced size as compared with tumors obtained from control or wild-type PDGF-A transfected cells. This in vivo tumor growth inhibition by the PDGF-A mutant expressed in CHO-K1 cells could be explained by the action of pro-PDGF-A as a dominant negative (29) . Like the other PDGF ligands, interaction of PDGF-A with their receptors induces the dimerization of the subunits and induces the formation of PDGF{alpha}r-PDGF{alpha}r homodimers. The absence of fully processed PDGF-A may affect the dimerization of the corresponding receptors leading to a loss of biological activity. In addition, the possible antagonist role of the PDGF-A mutant that may compete with the active PDGF-A for the PDGF receptors is not ruled out; however, additional studies are required to fully verify these hypotheses.

In conclusion, we have demonstrated that Furin, and to a lower extent PC5, PACE4, and PC7 are the cognate members of the PC family involved in the processing of pro-PDGF-A, and demonstrated that the biological functions of PDGF-A ex vivo and in vivo in tumors are critically dependent on the processing of pro-PDGF-A by the PCs. Our findings support the notion that targeting PDGF-A cleavage may provide a pharmacological complement that could be used for treatment of malignancies induced by this growth factor.


    ACKNOWLEDGMENTS
 
We thank Jadwiga Marcinkiewicz and Aida Mammarbassi for technical help, and Brigitte Mary for secretarial assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a Canadian Institute of Health Research group grant no. MGC-11474, a CIHR grant no. MGP-44363, and by the Protein Engineering Network Centers of Excellence. Back

2 To whom requests for reprints should be addressed, at Laboratory of Biochemical Neuroendocrinology, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7. Phone: (514) 987-5609; Fax: (514) 987-5542; E-mail: seidahn{at}ircm.qc.ca Back

3 The abbreviations used are: PDGF, platelet-derived growth factor; CHO, Chinese hamster ovary; aa, amino acid; {alpha}2-MG-F, {alpha}2-macroglobulin; {alpha}1-PDX, {alpha}1-antitrypsin; pp, preprosegment; PC, proprotein convertase; ER, endoplasmic reticulum; EGFP, enhanced green fluorescent protein. Back

Received 11/20/02. Accepted 1/31/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sulzbacher I., Traxler M., Mosberger I., Lang S., Chott A. Platelet-derived growth factor-AA and -{alpha} receptor expression suggests an autocrine and/or paracrine loop in osteosarcoma. Mod. Pathol., 13: 632-637, 2000.[Medline]
  2. Lokker N. A., Sullivan C. M., Hollenbach S. J., Israel M. A., Giese N. A. Platelet-derived growth factor (PDGF) autocrine signaling regulates survival and mitogenic pathways in glioblastoma cells: evidence that the novel PDGF-C and PDGF-D ligands may play a role in the development of brain tumors. Cancer Res., 62: 3729-3735, 2002.[Abstract/Free Full Text]
  3. Heldin C-H., Rönnstrand L. Growth factor receptors in cell transformation Peters G. Vousden K. eds. . Frontiers in Molecular Biology: Oncogenes and Tumor Suppressor Genes, 55-85, Oxford University Press Oxford 1997.
  4. Fitzer-Attas C. J., Do M. S., Feigelson S., Vadai E., Feldman M., Eisenbach L. Modification of PDGF{alpha} receptor expression or function alters the metastatic phenotype of 3LL cells. Oncogene, 15: 1545-1554, 1997.[Medline]
  5. Forsberg K., Valyi-Nagy I., Heldin C. H., Herlyn M., Westermark B. Platelet-derived growth factor (PDGF) in oncogenesis: development of a vascular connective tissue stroma in xenotransplanted human melanoma producing PDGF-BB. Proc. Natl. Acad. Sci. USA, 90: 393-397, 1993.[Abstract/Free Full Text]
  6. Heldin C. H., Johnsson A., Wennergren S., Wernstedt C., Betsholtz C., Westermark B. A human osteosarcoma cell line secretes a growth factor structurally related to a homodimer of PDGF A-chains. Nature (Lond.), 319: 511-514, 1986.[Medline]
  7. Hart C. E., Bailey M., Curtis D. A., Osborn S., Raines E., Ross R., Forstom J. W. Purification of PDGF-AB and PDGF-BB from human platelet extracts and identification of all three PDGF dimers in human platelets. Biochemistry, 29: 166-172, 1990.[Medline]
  8. Robbins K. C., Antoniades H. N., Devare S. G., Hunkapiller M. W., Aaronson S. A. Structural and immunological similarities between simian sarcoma virus gene product(s) and human platelet-derived growth factor. Nature (Lond.), 305: 605-608, 1983.[Medline]
  9. Heldin C. H., Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol. Rev., 79: 1283-1316, 1999.[Abstract/Free Full Text]
  10. Gilbertson D. G., Duff M. E., West J. W., Kelly J. D., Sheppard P. O., Hofstrand P. D., Gao Z., Shoemaker K., Bukowski T. R., Moore M., Feldhaus A. L., Humes J. M., Palmer T. E., Hart C. E. Platelet-derived growth factor C (PDGF-C), a novel growth factor that binds to PDGF {alpha} and ß receptor. J. Biol. Chem., 276: 27406-27414, 2001.[Abstract/Free Full Text]
  11. LaRochelle W. J., Jeffers M., McDonald W. F., Chillakuru R. A., Giese N. A., Lokker N. A., Sullivan C., Boldog F. L., Yang M., Vernet C., Burgess C. E., Fernandes E., Deegler L. L., Rittman B., Shimkets J., Shimkets R. A., Rothberg J. M., Lichenstein H. S. PDGF-D, a new protease-activated growth factor. Nat. Cell Biol., 3: 517-521, 2001.[Medline]
  12. Bergsten E., Uutela M., Li X., Pietras K., Ostman A., Heldin C. H., Alitalo K., Eriksson U. PDGF-D is a specific, protease-activated ligand for the PDGF ß- receptor. Nat. Cell Biol., 3: 512-516, 2001.[Medline]
  13. Beckmann M. P., Betsholtz C., Heldin C. H., Westermark B., Di Marco E., Di Fiore P. P., Robbins K. C., Aaronson S. A. Comparison of biological properties and transforming potential of human PDGF-A and PDGF-B chains. Science (Wash. DC), 241: 1346-1349, 1988.[Abstract/Free Full Text]
  14. Bywater M., Rorsman F., Bongcam-Rudloff E., Mark G., Hammacher A., Heldin C. H., Westermark B., Betsholtz C. Expression of recombinant platelet-derived growth factor A- and B-chain homodimers in rat-1 cells and human fibroblasts reveals differences in protein processing and autocrine effects. Mol. Cell. Biol., 8: 2753-2762, 1988.[Abstract/Free Full Text]
  15. Ostman A., Thyberg J., Westermark B., Heldin C. H. PDGF-AA and PDGF-BB biosynthesis: proprotein processing in the Golgi complex and lysosomal degradation of PDGF-BB retained intracellularly. J. Cell Biol., 118: 509-519, 1992.[Abstract/Free Full Text]
  16. Khatib A. M., Siegfried G., Chretien M., Metrakos P., Seidah N. G. Proprotein convertases in tumor progression and malignancy: novel targets in cancer therapy. Am. J. Pathol., 160: 1921-1935, 2002.[Abstract/Free Full Text]
  17. Seidah N. G., Chretien M. Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides. Brain Res., 848: 45-62, 1999.[Medline]
  18. Seidah N. G., Benjannet S., Wickham L., Marcinkiewicz J., Belanger-Jasmin S., Stifani S., Basak A., Prat A., Chretien M. The novel secretory proprotein convertase NARC-1: Its potential role in liver regeneration and neural differentiation. Proc. Natl. Acad. Sci. U.S.A., 100: 928-933, 2003.[Abstract/Free Full Text]
  19. Benjannet S., Elagoz A., Wickham L., Mamarbachi M., Munzer J. S., Basak A., Lazure C., Cromlish J. A., Sisodia S., Checler F., Chretien M., Seidah N. G. Post-translational processing of ß-secretase (ß-amyloid- converting enzyme) and its ectodomain shedding. The pro- and transmembrane/cytosolic domains affect its cellular activity and amyloid-ß production. J. Biol. Chem., 276: 10879-10887, 2001.[Abstract/Free Full Text]
  20. Rawson R. B., DeBose-Boyd R., Goldstein J. L., Brown M. S. Failure to cleave sterol regulatory element-binding proteins (SREBPs) causes cholesterol auxotrophy in Chinese hamster ovary cells with genetic absence of SREBP cleavage-activating protein. J. Biol. Chem., 274: 28549-28556, 1999.[Abstract/Free Full Text]
  21. Khatib A. M., Siegfried G., Prat A., Luis J., Chretien M., Metrakos P., Seidah N. G. Inhibition of proprotein convertases is associated with loss of growth and tumorigenicity of HT-29 human colon carcinoma cells: importance of insulin-like growth factor-1 (IGF-1) receptor processing in IGF-1- mediated functions. J. Biol. Chem., 276: 30686-30693, 2001.[Abstract/Free Full Text]
  22. Zhong M., Munzer J. S., Basak A., Benjannet S., Mowla S. J., Decroly E., Chretien M., Seidah N. G. The prosegments of furin and PC7 as potent inhibitors of proprotein convertases. In vitro and ex vivo assessment of their efficacy and selectivity. J. Biol. Chem., 274: 33913-33920, 1999.[Abstract/Free Full Text]
  23. Nour N., Basak A., Chretien M., Seidah N. G. Structure-function analysis of the prosegment of the proprotein convertase PC5A. J. Biol. Chem., 278: 2886-2895, 2003.[Abstract/Free Full Text]
  24. Mercola M., Wang C. Y., Kelly J., Brownlee C., Jackson-Grusby L., Stiles C., Bowen-Pope D. Selective expression of PDGF A and its receptor during early mouse embryogenesis. Dev. Biol., 138: 114-122, 1990.[Medline]
  25. Li L., Schatteman G. C., Oppenheim R. W., Lei M., Bowen-Pope D. F., Houenou L. J. Altered development of spinal cord in the mouse mutant (Patch) lacking the PDGF receptor {alpha}-subunit gene. Brain Res. Dev. Brain Res., 96: 204-209, 1996.[Medline]
  26. Li J., Hoyle G. W. Overexpression of PDGF-A in the lung epithelium of transgenic mice produces a lethal phenotype associated with hyperplasia of mesenchymal cells. Dev. Biol., 239: 338-349, 2001.[Medline]
  27. Dubois C. M., Blanchette F., Laprise M. H., Leduc R., Grondin F., Seidah N. G. Evidence that furin is an authentic transforming growth factor-ß1-converting enzyme. Am. J. Pathol., 158: 305-316, 2001.[Abstract/Free Full Text]
  28. Metheny-Barlow L. J., Flynn B., van Gijssel H. E., Marrogi A., Gerwin B. I. Paradoxical effects of platelet-derived growth factor-A overexpression in malignant mesothelioma. Antiproliferative effects in vitro and tumorigenic stimulation in vivo. Am. J. Respir. Cell Mol. Biol., 24: 694-702, 2001.[Abstract/Free Full Text]
  29. Mercola M., Deininger P. L., Shamah S. M., Porter J., Wang C. Y., Stiles C. D. Dominant-negative mutants of a platelet-derived growth factor gene. Genes Dev., 4: 2333-2341, 1990.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Lapierre, G. Siegfried, N. Scamuffa, Y. Bontemps, F. Calvo, N. G. Seidah, and A.-M. Khatib
Opposing Function of the Proprotein Convertases Furin and PACE4 on Breast Cancer Cells' Malignant Phenotypes: Role of Tissue Inhibitors of Metalloproteinase-1
Cancer Res., October 1, 2007; 67(19): 9030 - 9034.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
B. K. McColl, K. Paavonen, T. Karnezis, N. C. Harris, N. Davydova, J. Rothacker, E. C. Nice, K. W. Harder, S. Roufail, M. L. Hibbs, et al.
Proprotein convertases promote processing of VEGF-D, a critical step for binding the angiogenic receptor VEGFR-2
FASEB J, April 1, 2007; 21(4): 1088 - 1098.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
N. Scamuffa, F. Calvo, M. Chretien, N. G. Seidah, and A.-M. Khatib
Proprotein convertases: lessons from knockouts
FASEB J, October 1, 2006; 20(12): 1954 - 1963.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Shayan, M. G. Achen, and S. A. Stacker
Lymphatic vessels in cancer metastasis: bridging the gaps
Carcinogenesis, September 1, 2006; 27(9): 1729 - 1738.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. McMahon, M. Charbonneau, S. Grandmont, D. E. Richard, and C. M. Dubois
Transforming Growth Factor beta1 Induces Hypoxia-inducible Factor-1 Stabilization through Selective Inhibition of PHD2 Expression
J. Biol. Chem., August 25, 2006; 281(34): 24171 - 24181.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pasquato, P. Pullikotil, M.-C. Asselin, M. Vacatello, L. Paolillo, F. Ghezzo, F. Basso, C. Di Bello, M. Dettin, and N. G. Seidah
The Proprotein Convertase SKI-1/S1P: IN VITRO ANALYSIS OF LASSA VIRUS GLYCOPROTEIN-DERIVED SUBSTRATES AND EX VIVO VALIDATION OF IRREVERSIBLE PEPTIDE INHIBITORS
J. Biol. Chem., August 18, 2006; 281(33): 23471 - 23481.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Essalmani, J. Hamelin, J. Marcinkiewicz, A. Chamberland, M. Mbikay, M. Chretien, N. G. Seidah, and A. Prat
Deletion of the Gene Encoding Proprotein Convertase 5/6 Causes Early Embryonic Lethality in the Mouse
Mol. Cell. Biol., January 1, 2006; 26(1): 354 - 361.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Darie, M. L. Biniossek, M. A. Gawinowicz, Y. Milgrom, J. O. Thumfart, L. Jovine, E. S. Litscher, and P. M. Wassarman
Mass Spectrometric Evidence That Proteolytic Processing of Rainbow Trout Egg Vitelline Envelope Proteins Takes Place on the Egg
J. Biol. Chem., November 11, 2005; 280(45): 37585 - 37598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Fredriksson, M. Ehnman, C. Fieber, and U. Eriksson
Structural Requirements for Activation of Latent Platelet-derived Growth Factor CC by Tissue Plasminogen Activator
J. Biol. Chem., July 22, 2005; 280(29): 26856 - 26862.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. V. Ustach and H.-R. C. Kim
Platelet-Derived Growth Factor D Is Activated by Urokinase Plasminogen Activator in Prostate Carcinoma Cells
Mol. Cell. Biol., July 15, 2005; 25(14): 6279 - 6288.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. McMahon, F. Grondin, P. P. McDonald, D. E. Richard, and C. M. Dubois
Hypoxia-enhanced Expression of the Proprotein Convertase Furin Is Mediated by Hypoxia-inducible Factor-1: IMPACT ON THE BIOACTIVATION OF PROPROTEINS
J. Biol. Chem., February 25, 2005; 280(8): 6561 - 6569.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. L. de Cicco, J. C. Watson, D. E. Bassi, S. Litwin, and A. J. Klein-Szanto
Simultaneous Expression of Furin and Vascular Endothelial Growth Factor in Human Oral Tongue Squamous Cell Carcinoma Progression
Clin. Cancer Res., July 1, 2004; 10(13): 4480 - 4488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Pullikotil, M. Vincent, S. T. Nichol, and N. G. Seidah
Development of Protein-based Inhibitors of the Proprotein of Convertase SKI-1/S1P: PROCESSING OF SREBP-2, ATF6, AND A VIRAL GLYCOPROTEIN
J. Biol. Chem., April 23, 2004; 279(17): 17338 - 17347.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siegfried, G.
Right arrow Articles by Seidah, N. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siegfried, G.
Right arrow Articles by Seidah, N. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online