Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, H.
Right arrow Articles by Yang, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, H.
Right arrow Articles by Yang, J.-M.
[Cancer Research 63, 1515-1519, April 1, 2003]
© 2003 American Association for Cancer Research


Experimental Therapeutics

Small Interfering RNA-induced Suppression of MDR1 (P-Glycoprotein) Restores Sensitivity to Multidrug-resistant Cancer Cells1

Hao Wu, William N. Hait2 and Jin-Ming Yang2

Departments of Pharmacology and Medicine, The Cancer Institute of New Jersey, University of Medicine and Dentistry of New Jersey/Robert Wood Johnson Medical School, New Brunswick, New Jersey 08901


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Overexpression of P-glycoprotein (P-gp), the MDR1 gene product, confers multidrug resistance (MDR) to cancer cells. Clinically, MDR is one of the major causes for chemotherapeutic treatment failure in cancer patients. To explore a new approach to circumventing MDR, we adopted RNA interference to target MDR1 gene expression. RNA interference is a conserved biological response to double-stranded RNA, which results in sequence-specific gene silencing [G. J. Hannon, Nature (Lond.), 418: 244–251, 2002]. We report that introduction of an MDR1-targeted small interfering RNA duplex into drug-resistant cancer cells markedly inhibited the expression of MDR1 mRNA and P-gp, as determined by reverse transcription-PCR and Western blot. Inhibition of P-gp expression by small interfering RNA enhanced the intracellular accumulation of and selectively restored sensitivity to drugs transported by P-gp. These studies indicate that RNA interference can modulate MDR in preclinical models.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Drug resistance hampers successful chemotherapy in cancer patients. One form of MDR3 is caused by overexpression of P-gp, the MDR1 gene product (1 , 2) . P-gp is a transmembrane phosphoglycoprotein capable of transporting a variety of structurally and functionally diverse chemotherapeutic drugs such as vinblastine, doxorubicin, and paclitaxel, leading to reduced intracellular drug concentration and decreased cytotoxicity (3) . Despite promising early studies showing that P-gp antagonists could reverse MDR (4, 5, 6, 7) , the clinical goal of restoring drug sensitivity to drug-resistant human cancer has been elusive. Successful reversal or prevention of drug resistance is still awaiting new therapeutic strategies or pharmaceuticals. In this study, we tested the feasibility of using siRNA to inhibit P-gp expression and reverse MDR. siRNA generated from double-stranded RNA can trigger silencing of homologous gene expression by inducing degradation of the complementary mRNA, an evolutionarily conserved mechanism termed RNA interference or post-transcriptional gene silencing (8 , 9) . Using the RNA interference approach, we show that the expression of the endogenous as well as transfected MDR1 gene can be effectively inhibited, and that the sensitivity to P-gp-transportable drugs can be restored. Our study demonstrates the utility of siRNA for therapeutically modulating P-gp-mediated drug resistance.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Culture.
The MDR human breast cancer cell lines, MCF-7/AdrR and MCF-7/BC-19, and their parental, sensitive line, MCF-7, were kindly supplied by Dr. Kenneth Cowan of the Eppley Institute for Research in Cancer (Omaha, NE). They were maintained in RPMI 1640 containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2/95% air. MCF-7/AdrR was developed by step-wise selection (10) , and MCF-7/BC-19 is a MDR1 transfectant (11) . Human ovarian carcinoma cell lines, A2780 and A2780Dx5, were provided by Dr. Youcef Rustum (Roswell Park Cancer Institute, Buffalo, NY) and were grown in DMEM containing 10% fetal bovine serum under the identical condition as described above except that for A2780Dx5, 2 µM of doxorubicin was added to the medium for the maintenance of the MDR phenotype (12) . Cells were checked routinely and found to be free of contamination by Mycoplasma or fungi. All of the cell lines were discarded after 3 months and new lines obtained from frozen stocks.

siRNA Preparation and Transfection.
The siRNA sequence targeting MDR1 corresponded to the coding region 79–99 (5'-AAGGAAAAGAAACCAACTGTC-3') relative to the start codon. The siRNA duplex with the following sense and antisense sequences was used: 5'-GGAAAAGAAACCAACUGUCdTdT (sense) and dTdTCCUUUUCUUUGGUUGACAG-5' (antisense). Lamin A/C siRNA duplex has the following sequences: 5'-CUGGACUUCCAGAAGAACAdTdT (sense) and dTdTGACCUGAAGGUCUUCUUGU-5' (antisense).

All of the siRNA duplexes were synthesized by Dharmacon Research, Inc. (Lafayette, CO) using 2'-ACE protection chemistry.

Cells in exponential phase of growth were plated in six-well plates at 5 x 105 cells/well, grown for 24 h then transfected with siRNA (P-gp siRNA: 200 nM; lamin A/C siRNA: 100 nM) using oligofectamine and OPTI-MEM I reduced serum medium (Invitrogen Life Technologies, Inc., Carlsbad, CA), according to the manufacturer’s protocol. The concentrations of siRNAs were chosen based on dose-response studies. Silencing was examined 24–48 h after transfection. Control cells were treated with oligofectamine and serum-reduced medium (mock).

Reverse Transcription-PCR.
Total RNA was extracted from cells with TRIzol reagent (Invitrogen Life Technologies, Inc.) and quantified by UV absorbance spectroscopy. The reverse transcription reaction was performed using the Superscript First-Strand Synthesis System (Invitrogen Life Technologies, Inc.) in a final volume of 20 µl containing 5 µg of total RNA, 200 ng of random hexamers, 1x reverse transcription buffer, 2.5 mM MgCl2, 1 mM deoxynucleotide triphosphate mixture, 10 mM DTT, RNaseOUT recombinant ribonuclease inhibitor, 50 units of Superscript reverse transcriptase, and diethylpyrocarbonate-treated water. After incubation at 42°C for 80 min, the reverse transcription reaction was terminated by heating at 70°C for 15 min. The newly synthesized cDNA was amplified by PCR. The reaction mixture contained 2 µl of cDNA template, 1.5 mM MgCl2, 2.5 units of Tag polymerase, and 0.5 µM of MDR1 primer (5'-ATATCAGCAGCCCACATCAT-3'; 5'-GAAGCACTGGGATGTCCGGT-3'; Ref. 13 ). GAPDH primer (5'-GCCAAAAGGGTCATCATCTC-3'; 5'-GTAGAGGCAGGGATGATGTTC-3') was used as an internal control. Amplication cycles were: 94°C for 3 min, then 33 cycles at 94°C for 1 min, 58°C for 1 min, 72°C for 1.5 min, followed by 72°C for 15 min. Aliquots of PCR product were electrophoresed on 1.5% agarose gels, and PCR fragments were visualized by ethidium bromide staining.

Western Blot Analysis.
Cells were washed twice with PBS containing 1 mM phenylmethylsulphonyl fluoride, scraped off the dishes, and pelleted at 500 x g for 10 min. Cell pellets were then lysed in cold TNT buffer [20 mM Tris-HCl (pH 7.4), 200 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulphonyl fluoride, and 1% aprotinin) for 45 min with occasional rocking. The lysates were transferred to Eppendorf tubes and clarified by centrifugation at 12,000 x g for 40 min at 4°C. Identical amounts (50 µg of protein) of cell lysates were resolved by 8% SDS-PAGE. Transfer of proteins to nitrocellulose was carried out by the method of Towbin et al. (14) . The membranes were incubated in blocking solution consisting of 5% powered milk in TBST [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.1% Tween 20] at room temperature for 1 h, then immunoblotted with monoclonal anti-P-gp antibody C219 (Calbiochem, San Diego, CA), antilamin A/C antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), or antitubulin antibody (Sigma-Aldrich, St. Louis, MO). Detection by enzyme-linked chemiluminescence was performed according to the manufacturer’s protocol (ECL; Amersham Pharmacia Biotech, Piscataway, NJ). Protein expression was quantified by Molecular Analyst software (Bio-Rad Laboratories, Hercules, CA).

Paclitaxel and Doxorubicin Accumulation.
Steady-state paclitaxel accumulation was assayed by a method described previously by our laboratory (15) . Briefly, sensitive and MDR MCF-7 cells transfected with siRNA or mock were seeded in 24-well plates and grown for 48 h. Then, the growth medium was aspirated and replaced with 0.25 ml of RPMI 1640 containing 25 mM HEPES (pH 7.4) and 50 nM of [3H]paclitaxel (10.0 Ci/mmol; Moravek Biochemicals, Inc., Brea, CA). Cells were incubated with [3H]paclitaxel for 2 h and were then cooled on ice, washed three times with ice-cold PBS, and solubilized with 0.25 ml of 1% SDS. The radioactivity in each sample was determined by scintillation counting.

To assess steady-state doxorubicin accumulation, sensitive and MDR MCF-7 cells transfected with siRNA or mock were incubated with 25 µM of doxorubicin for 1 (sensitive MCF-7) or 2 h (MCF-7/AdrR). At the end of incubation, cells were washed three times with PBS and observed under a fluorescence microscope with 100x lens (Nikon ECLIPSE TE200 microscope; Nikon Inc., Melville, NY).

Clonogenic Assay.
siRNA-transfected cells were plated in 60-mm cell culture dishes (250 cells/dish) and incubated at 37°C in a humidified atmosphere containing 5% CO2/95% air for 12 days in the presence of various concentrations of vinblastine, doxorubicin, or hydroxyurea. At the end of the incubation period, cells were stained with 1% methylene blue in 50% methanol for 30 min, washed with water, and colonies counted. IC50 was defined as the concentration of drug that inhibited colony formations by 50% as compared with that of vehicle-treated control. Student’s t test was used to determine the degree of significance. Fold reversal was the IC50 for cytotoxic drug in mock-treated cells divided by the IC50 for drug in siRNA-treated cells.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To test whether siRNA could be used to modulate MDR, we treated MDR cells overexpressing P-gp with an siRNA duplex designed to target coding region 79–99 after the start codon of MDR1. Fig. 1Citation shows that as compared with mock transfection, the siRNA duplex reduced the levels of the endogenous (Fig. 1A)Citation as well as the transfected (Fig. 1B)Citation MDR1 mRNA in drug-resistant cells at 24 and 48 h after treatment, as determined by reverse transcription-PCR. The siRNA had no effect on GAPDH RNA (Fig. 1)Citation .



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Effect of siRNA on MDR1 mRNA expression in MDR cancer cells. MDR MCF-7 and A2780 (A) or MCF-7/BC-19 (B) cells were treated with 200 nM of MDR1 siRNA or mock, which only consisted of oligofectamine and OPTI-MEM I reduced serum medium. Twenty-four and 48 h later, total RNA was extracted from the cells and the reverse transcription reaction was performed using the Superscript First-Strand Synthesis System (Invitrogen Life Technologies, Inc.). The newly synthesized MDR1 cDNA was amplified by PCR using the MDR1 primer (5'-ATATCAGCAGCCCACATCAT-3'; 5'-GAAGCACTGGGATGTCCGGT-3'). GAPDH primer (GCCAAAAGGGTCATCATCTC; GTAGAGGCAGGGATGATGTTC) was used as an internal control. Aliquots of PCR product were electrophoresed on 1.5% agarose gels, and PCR fragments were visualized by ethidium bromide staining. Results are the representative of three similar experiments.

 
To determine the effect of siRNA on target protein expression, cell lysates from the treated cells were analyzed by Western blot. Fig. 2ACitation demonstrates that the expression of P-gp was decreased by 24 h in all three of the cell lines. The P-gp content remained lower in siRNA-treated A2780Dx5 and MCF-7/BC-19 cell lines at 48 h after treatment as compared with the controls. However, the protein level began to increase in MCF-7/AdrR cells 48 h after treatment (Fig. 2A)Citation . MDR1 siRNA did not affect {alpha}-tubulin expression (Fig. 2A)Citation . To confirm the specificity of the siRNA-mediated silencing of P-gp expression, we tested an unrelated sequence, lamin A/C siRNA (16) , on gene expression. Fig. 2BCitation demonstrates that treatment of P-gp-overexpressing MDR cells with lamin A/C siRNA reduced the expression of lamin A protein but had no effect on the expression of P-gp.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Effect of siRNA on P-gp expression in MDR cancer cells. MDR MCF-7 and A2780 cells were treated with 200 nM of MDR1 siRNA, 100 nM of lamin A/C siRNA, or mock. Twenty-four and 48 h later, cell lysates were prepared from the siRNA- or mock-treated cells. Equal amounts (50 µg proteins) of cell lysates were separated by 8% SDS-PAGE, then transferred onto nitrocellulose membrane. The membranes were immunoblotted with monoclonal anti-P-gp antibody C219, antilamin A/C antibody, or antitubulin antibody. Detection of P-gp was performed using enzyme-linked chemiluminescence. Protein expression was quantified by Molecular Analyst software. Results are the representative of three similar experiments.

 
Treatment of cells with the siRNA enhanced intracellular drug accumulation. Fig. 3ACitation shows that in siRNA-treated MCF-7/AdrR cells, the accumulation of paclitaxel, a P-gp-transportable compound, was increased significantly as compared with that of the mock-transfected cells (P < 0.01). The accumulation of doxorubicin, another drug that is transported by P-gp, was also increased in the siRNA-treated MDR MCF-7 cells in comparison with the mock-transfected controls (Fig. 3B)Citation .



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Effect of siRNA on accumulation of paclitaxel and doxorubicin in MDR cancer cells. A, sensitive and MDR MCF-7 cells treated with MDR1 siRNA or mock were seeded in 24-well plates and grown for 48 h. Cells were then incubated with 50 nM [3H]paclitaxel for 2 h at 37°C. At the end of incubation, cells were cooled on ice, washed three times with ice-cold PBS, and solubilized with 0.25 ml of 1% SDS. The radioactivity in each sample was determined by scintillation counting. Bar, ± SD of triplicate determinations. B. siRNA- or mock-transfected MDR MCF-7 and sensitive MCF-7 cells were treated with 25 µM of doxorubin for 1 (sensitive MCF-7) or 2 h (MCF-7/AdrR). At the end of incubation, cells were washed three times with PBS, then observed under a fluorescence microscope with x100 lens. Results are the representative of two similar experiments.

 
To assess whether siRNA-directed suppression of P-gp sensitized MDR cancer cells to cytotoxic agents, we compared the drug sensitivity of the siRNA-treated to that of the mock-treated MDR cells using clonogenic assay. As shown in Table 1Citation and Fig. 4Citation , the sensitivity of the MDR cells to vinblastine, doxorubicin, and paclitaxel was increased significantly by the introduction of MDR1-targeted siRNA (P < 0.05). For example, in MCF-7/AdrR, MCF-7/BC-19, and A2780Dx5 cell lines, siRNA caused a 232-, 49-, and 4-fold reversal of cellular resistance to vinblastine, respectively. In MCF-7/AdrR cells, treatment with siRNA caused a 12-fold reversal of resistance to doxorubicin and 95-fold reversal of resistance to paclitaxel. The sensitivity to hydroxyurea, a drug that is not transported by P-gp, was not affected by silencing of P-gp expression (Table 1Citation ; Fig. 4Citation ).


View this table:
[in this window]
[in a new window]

 
Table 1 Effect of siRNA on sensitivity of MDR cells to chemotherapeutic drugs

Cells were plated in 60-mm cell culture dishes (200 cells/dish) and exposed to various concentrations of cytotoxic drugs for 12 days. At the end of incubation, cells were stained with 1% methylene blue and the colonies counted. IC50 is the concentration that produced 50% inhibition of colony formation compared to vehicle-treated controls. Results represent the mean of two or mean ± standard error of three separate experiments.

 


View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effect of siRNA on sensitivity of MDR cancer cells to vinblastine, doxorubicin, and hydroxyurea. MDR1 siRNA- or mock-treated MCF-7/AdrR cells plated in 60-mm cell culture dishes were incubated at 37°C in a humidified atmosphere containing 5% CO2/95% air for 12 days in the presence of a series of concentrations of vinblastine, doxorubicin, or hydroxyurea. At the end of incubation, cells were stained with 1% methylene blue in 50% methanol for 30 min, washed with water, and the colony number counted. Results are the representative of two similar experiments; bars, ± SD.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Because Elbashir et al. (16) reported that RNA interference can be triggered in mammalian cells by introduction of 21-nucleotide siRNA, siRNA has been shown to be an effective approach for silencing gene expression that has been applied recently to inhibiting HIV-1 replication and infection in cell cultures (17, 18, 19, 20) . We now demonstrate that introduction of an siRNA duplex decreases the expression of P-gp (Fig. 2)Citation , increases intracellular drug accumulation (Fig. 3)Citation , and restores drug sensitivity (Fig. 4)Citation in human MDR cancer cells. We also found that the modulation of MDR results from the siRNA-directed degradation of MDR1 mRNA (Fig. 1)Citation .

P-gp is expressed in many human tumors either at the time of diagnosis or after treatment. Inhibition of the function or expression of P-gp can sensitize MDR cells to chemotherapeutic drugs (3 , 21) . Although modulations of MDR by pharmacological agents (3) , antibodies (22) , antisense oligonucleotides (23) , and inhibitors of signal transduction (24) have been reported, the clinical benefit of these approaches has not been realized. Gene silencing induced by RNA interference was shown to be specific and potent (16 , 25) . siRNAs target the expression of the genes from which the siRNA sequences are derived without detectable effects on the expression of unrelated genes (16 , 25) . In Caenorhabditis elegans, only a few molecules of siRNA per cell are required for silencing and the spread of the silencing effect through a broad region of the organism (25) ; a greater number of molecules per cell may be required to acquire the desired result in mammalian cells. Nevertheless, siRNA-induced RNA interference may offer an alternative strategy for overcoming drug resistance.

This report demonstrates the feasibility of using siRNA to specifically and effectively modulate MDR. MDR1-targeted siRNA inhibits the expression of MDR1 RNA and P-gp with minimum effect on GAPDH and tubulin expression in comparison with mock treatment (Fig. 1Citation and Fig. 2ACitation ); lamin A/C siRNA decreased lamin A expression but had no effect on the expression of P-gp (Fig. 2B)Citation . Furthermore, MDR1-targeted siRNA reversed resistance to P-gp-transportable drugs, but did not affect the sensitivity to hydroxyurea, a non-P-gp substrate (Table 1Citation ; Fig. 4Citation ). These data suggest that silencing of P-gp expression mediated by siRNA is specific. Despite using the optimum concentration (200 nM) of siRNA determined by dose-response studies, the maximum inhibition of P-gp expression was 65% (Fig. 2A)Citation . The lack of complete inhibition is likely because of the high content of P-gp (10, 11, 12) , the relatively long half-life (14–17 h) of the protein (26) , and transfection efficiency. The incomplete inhibition of P-gp expression may explain the incomplete restoration of drug sensitivity in MCF-/AdrR and A2780Dx5 (Table 1)Citation , two highly resistant MDR cell lines (10) . Furthermore, because MCF-7/AdrR and A2780Dx5 are lines selected by prolonged exposure to doxorubicin, additional mechanisms of drug resistance are known to exist (12 , 27) . In contrast, siRNA was more effective against the MDR1-transfected MCF-7/BC-19 cell line, which is 10–50-fold less resistant than the MCF-7/AdrR line (11) . The effect of siRNA on drug resistance was similar to that reported for chemical modulators (3, 4, 5, 6, 7) .

Similar to several other studies using siRNA (17 , 18) , the silencing effect on P-gp expression is short-lived. The maximum decreases in MDR1 mRNA are seen at 24 h, and begin to recover 24 h later. By 72 h, the message had returned to baseline values (data not shown). As anticipated, the recovery of P-gp expression tends to lag behind that of the RNA (Fig. 2A)Citation . Because the half-life of P-gp is 14–17 h (26) , a greater decrease in P-gp expression may be attained through the use of a DNA vector-based siRNA expression system (28, 29, 30, 31) .

Treatment of MDR cells with P-gp siRNA increases the intracellular accumulation of paclitaxel and doxorubicin, two P-gp substrates (Fig. 3)Citation , enhances the sensitivity to doxorubicin, paclitaxel, and vinblastine, but has no effect on the non-P-gp transportable drug, hydroxyurea (Fig. 4Citation ; Table 1Citation ). Successful delivery of siRNA to postnatal and adult mice by high-pressure tail-vein injection has been reported recently (32 , 33) . Therefore, studies in animals harboring MDR tumors are warranted as precursors to testing this approach in humans.

In summary, our study demonstrates the effectiveness of siRNA in reversing MDR. Therefore, the RNA interference approach may hold promise for the treatment of drug-resistant cancer.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the United States Public Health Service National Cancer Institute CA 66077 and CA 72720. Back

2 To whom requests for reprints should be addressed, at The Cancer Institute of New Jersey, University of Medicine and Dentistry of New Jersey/Robert Wood Johnson Medical School, 195 Little Albany Street, New Brunswick, NJ 08901. Phone: (732) 235-8075; Fax: (732) 235-8098; E-mail address: jyang{at}umdnj.edu (to J-M. Y.) and haitwn{at}umdnj.edu (to W. N. H.). Back

3 The abbreviations used are: MDR, multidrug resistant or multidrug resistance; P-gp, P-glycoprotein; siRNA, small interfering RNA; GAPDH, glyceraldehydes-3-phosphate dehydrogenase. Back

Received 10/25/02. Accepted 2/18/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ling V. Multidrug resistance and P-glycoprotein expression. Ann. N. Y. Acad. Sci., 507: 7-8, 1987.[Medline]
  2. Roninson I. B., Chin J. E., Choi K. G., Gros P., Housman D. E., Fojo A., Shen D. W., Gottesman M. M., Pastan I. Isolation of human mdr DNA sequences amplified in multidrug-resistant KB carcinoma cells. Proc. Natl. Acad. Sci. USA, 83: 4538-4542, 1986.[Abstract/Free Full Text]
  3. Ford J. M., Hait W. N. Pharmacology of drugs that alter multidrug resistance in cancer. Pharmacol. Rev., 42: 155-199, 1990.[Medline]
  4. Yahanda A. M., Adler K. M., Fisher G. M., Brophy N. A., Halsy J., Hardy R. I., Gosland M. P., Lum B. L., Sikic B. I. Phase I trial of etoposide with cyclosporine as a modulator of multidrug resistance. J. Clin. Oncol., 10: 1624-1634, 1992.[Abstract/Free Full Text]
  5. Dalton W. S., Grogan T. M., Meltzer P. S., Scheper R. J., Durie B. G. M., Taylor C. W., Miller T. P., Salmon S. E. Drug-resistance in multiple myeloma and nonHodgkin’s lymphoma: detection of P-glycoprotein and potential circumvention by addition of verapamil to chemotherapy. J. Clin. Oncol., 7: 415-424, 1989.[Abstract]
  6. Sonneveld P., Durie B. G. M., Lokhurst H. M., Marie J. P., Solbu B., Suciu S., Zittoun R., Lowenberg B., Nooter K. Modulation of multidrug-resistant multiple myeloma by cyclosporin. Lancet, 340: 255-259, 1992.[Medline]
  7. Hait W. N., Stein J. M., Koletsky A. J., Harding M. W., Handschumacher R. E. Activity of cyclosporin A and a non-immunosuppressive cyclosporin against multidrug resistant leukemic cell lines. Cancer Commun., 1: 35-43, 1989.[Medline]
  8. Hannon G. J. RNA interference. Nature (Lond.), 418: 244-251, 2002.[Medline]
  9. Tuschl T., Zamore P. D., Lehmann R., Bartel D. P., Sharp P. A. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev., 13: 3191-3197, 1999.[Abstract/Free Full Text]
  10. Cohen J. S., Lyon R. C., Chen C., Faustino P. J., Batist G., Shoemaker M., Rubalcaba E., Cowan K. H. Differences in phosphate metabolite levels in drug-sensitive and -resistant human breast cancer cell lines determined by 31P magnetic resonance spectroscopy. Cancer Res., 46: 4087-4090, 1986.[Abstract/Free Full Text]
  11. Yu G., Ahmad S., Aquino A., Fairchild C. R., Trepel J. B., Ohno S., Suzuki K., Tsuruo T., Cowan K. H., Glazer R. I. Transfection with protein kinase C {alpha} confers increased multidrug resistance to MCF-7 cells expressing P-glycoprotein. Cancer Commun., 3: 181-189, 1991.[Medline]
  12. Alaoui Jamali M. A., Yin M. B., Mazzoni A., Bankusli I., Rustum Y. M. Relationship between cytotoxicity, drug accumulation. DNA damage and repair of human ovarian cancer cells treated with doxorubicin: modulation by the tiapamil analog RO11–2933. Cancer Chemother Pharmacol., 25: 77-83, 1989.[Medline]
  13. Mi Q., Cui B., Silva G. L., Lantvit D., Lim E., Chai H., You M., Hollingshead M. G., Mayo J. G., Kinghorn A. D., Pezzuto J. M. Pervilleine A, a novel tropane alkaloid that reverses the multidrug-resistance phenotype. Cancer Res., 61: 4030-4037, 2001.[Abstract/Free Full Text]
  14. Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA, 76: 4350-4354, 1979.[Abstract/Free Full Text]
  15. Yang J. M., Sullivan G. F., Hait W. N. Regulation of the function of P-glycoprotein by epidermal growth factor through phospholipase C. Biochem. Pharmacol., 53: 1597-604, 1997.[Medline]
  16. Elbashir S. M., Harborth J., Lendeckel W., Yalcin A., Weber K., Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond.), 411: 494-498, 2001.[Medline]
  17. Jacque J. M., Triques K., Stevenson M. Modulation of HIV-1 replication by RNA interference. Nature (Lond.), 418: 435-438, 2002.[Medline]
  18. Novina C. D., Murray M. F., Dykxhoorn D. M., Beresford P. J., Riess J., Lee S. K., Collman R. G., Lieberman J., Shankar P., Sharp P. A. siRNA-directed inhibition of HIV-1 infection. Nat. Med., 8: 681-686, 2002.[Medline]
  19. Coburn G. A., Cullen B. R. Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference. J. Virol., 76: 9225-9231, 2002.[Abstract/Free Full Text]
  20. Lee N. S., Dohjima T., Bauer G., Li H., Li M. J., Ehsani A., Salvaterra P., Rossi J. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol., 20: 500-505, 2002.[Medline]
  21. Xu D., Ye D., Fisher M., Juliano R. L. Selective inhibition of P-glycoprotein expression in multidrug-resistant tumor cells by a designed transcriptional regulator. J. Pharmacol. Exp. Ther., 302: 963-971, 2002.[Abstract/Free Full Text]
  22. Mechetner E. B., Roninson I. B. Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc. Natl. Acad. Sci. USA, 89: 5824-5828, 1992.[Abstract/Free Full Text]
  23. Astriab-Fisher A., Sergueev D. S., Fisher M., Shaw B. R., Juliano R. L. Antisense inhibition of P-glycoprotein expression using peptide-oligonucleotide conjugates. Biochem. Pharmacol., 60: 83-90, 2000.[Medline]
  24. Yang J. M., Vassil A. D., Hait W. N. Activation of phospholipase C induces the expression of the multidrug resistance (MDR1) gene through the Raf-MAPK pathway. Mol. Pharmacol., 60: 674-680, 2001.[Abstract/Free Full Text]
  25. Fire A., Xu S., Montgomery M. K., Kostas S. A., Driver S. E., Mello C. C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature (Lond.), 391: 806-811, 1998.[Medline]
  26. Muller C., Laurent G., Ling V. P-glycoprotein stability is affected by serum deprivation and high cell density in multidrug-resistant cells. J. Cell Physiol., 163: 538-544, 1995.[Medline]
  27. Wells W. W., Rocque P. A., Xu D. P., Meyer E. B., Charamella L. J., Dimitrov N. V. Ascorbic acid and cell survival of adriamycin resistant and sensitive MCF-7 breast tumor cells. Free Radic. Biol. Med., 18: 699-708, 1995.[Medline]
  28. Sui G., Soohoo C., Affar el B., Gay F., Shi Y., Forrester W. C. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. USA, 99: 5515-5520, 2002.[Abstract/Free Full Text]
  29. Paddison P. J., Caudy A. A., Hannon G. J. Stable suppression of gene expression by RNAi in mammalian cells. Proc. Natl. Acad. Sci. USA, 99: 1443-1448, 2002.[Abstract/Free Full Text]
  30. Miyagishi M., Taira K. U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat. Biotechnol., 20: 497-500, 2002.[Medline]
  31. Paul C. P., Good P. D., Winer I., Engelke D. R. Effective expression of small interfering RNA in human cells. Nat. Biotechnol., 20: 505-508, 2002.[Medline]
  32. Lewis D. L., Hagstrom J. E., Loomis A. G., Wolff J. A., Herweijer H. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat. Genet., 32: 107-108, 2002.[Medline]
  33. McCaffrey A. P., Meuse L., Pham T. T., Conklin D. S., Hannon G. J., Kay M. A. RNA interference in adult mice. Nature (Lond.), 418: 38-39, 2002.[Medline]



This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
B. Marquez, N. E. Caceres, M.-P. Mingeot-Leclercq, P. M. Tulkens, and F. Van Bambeke
Identification of the Efflux Transporter of the Fluoroquinolone Antibiotic Ciprofloxacin in Murine Macrophages: Studies with Ciprofloxacin-Resistant Cells
Antimicrob. Agents Chemother., June 1, 2009; 53(6): 2410 - 2416.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
W. Zhang, J. Li, S. M. Allen, E. A. Weiskircher, Y. Huang, R. A. George, R. G. Fong, A. Owen, and I. J. Hidalgo
Silencing the Breast Cancer Resistance Protein Expression and Function in Caco-2 Cells Using Lentiviral Vector-Based Short Hairpin RNA
Drug Metab. Dispos., April 1, 2009; 37(4): 737 - 744.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. S. Carey, M. Gleason-Guzman, V. Gokhale, and L. H. Hurley
Psorospermin structural requirements for P-glycoprotein resistance reversal
Mol. Cancer Ther., November 1, 2008; 7(11): 3617 - 3623.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Doublier, C. Riganti, C. Voena, C. Costamagna, E. Aldieri, G. Pescarmona, D. Ghigo, and A. Bosia
RhoA Silencing Reverts the Resistance to Doxorubicin in Human Colon Cancer Cells
Mol. Cancer Res., October 1, 2008; 6(10): 1607 - 1620.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
S.-Y. Park, W. Kwak, N. Tapha, M.-Y. Jung, J.-O. Nam, I.-S. So, S.-Y. Kim, J. Yoo, J. Lee, and I.-S. Kim
Combination Therapy and Noninvasive Imaging with a Dual Therapeutic Vector Expressing MDR1 Short Hairpin RNA and a Sodium Iodide Symporter
J. Nucl. Med., September 1, 2008; 49(9): 1480 - 1488.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
V. Stierle, M. Duca, L. Halby, C. Senamaud-Beaufort, M. L. Capobianco, A. Laigle, B. Jolles, and P. B. Arimondo
Targeting MDR1 Gene: Synthesis and Cellular Study of Modified Daunomycin-Triplex-Forming Oligonucleotide Conjugates Able to Inhibit Gene Expression in Resistant Cell Lines
Mol. Pharmacol., May 1, 2008; 73(5): 1568 - 1577.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. Masuyama, H. Nakatsukasa, N. Takamoto, and Y. Hiramatsu
Down-Regulation of Pregnane X Receptor Contributes to Cell Growth Inhibition and Apoptosis by Anticancer Agents in Endometrial Cancer Cells
Mol. Pharmacol., October 1, 2007; 72(4): 1045 - 1053.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Fantappie, M. Solazzo, N. Lasagna, F. Platini, L. Tessitore, and R. Mazzanti
P-Glycoprotein Mediates Celecoxib-Induced Apoptosis in Multiple Drug-Resistant Cell Lines
Cancer Res., May 15, 2007; 67(10): 4915 - 4923.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Ludwig, G. Szakacs, S. E. Martin, B. F. Chu, C. Cardarelli, Z. E. Sauna, N. J. Caplen, H. M. Fales, S. V. Ambudkar, J. N. Weinstein, et al.
Selective Toxicity of NSC73306 in MDR1-Positive Cells as a New Strategy to Circumvent Multidrug Resistance in Cancer.
Cancer Res., May 1, 2006; 66(9): 4808 - 4815.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. Gianni, M. Zambetti, K. Clark, J. Baker, M. Cronin, J. Wu, G. Mariani, J. Rodriguez, M. Carcangiu, D. Watson, et al.
Gene Expression Profiles in Paraffin-Embedded Core Biopsy Tissue Predict Response to Chemotherapy in Women With Locally Advanced Breast Cancer
J. Clin. Oncol., October 10, 2005; 23(29): 7265 - 7277.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. E. Miletti-Gonzalez, S. Chen, N. Muthukumaran, G. N. Saglimbeni, X. Wu, J. Yang, K. Apolito, W. J. Shih, W. N. Hait, and L. Rodriguez-Rodriguez
The CD44 Receptor Interacts with P-Glycoprotein to Promote Cell Migration and Invasion in Cancer
Cancer Res., August 1, 2005; 65(15): 6660 - 6667.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
F. Teraishi, S. Wu, J. Sasaki, L. Zhang, H.-B. Zhu, J. J. Davis, and B. Fang
P-Glycoprotein-Independent Apoptosis Induction by a Novel Synthetic Compound, MMPT [5-[(4-Methylphenyl)methylene]-2-(phenylamino)-4(5H)-thiazolone]
J. Pharmacol. Exp. Ther., July 1, 2005; 314(1): 355 - 362.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Pichler, N. Zelcer, J. L. Prior, A. J. Kuil, and D. Piwnica-Worms
In vivo RNA Interference-Mediated Ablation of MDR1 P-Glycoprotein
Clin. Cancer Res., June 15, 2005; 11(12): 4487 - 4494.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
M. Nakajima, Y. Fujiki, S. Kyo, T. Kanaya, M. Nakamura, Y. Maida, M. Tanaka, M. Inoue, and T. Yokoi
Pharmacokinetics of Paclitaxel in Ovarian Cancer Patients and Genetic Polymorphisms of CYP2C8, CYP3A4, and MDR1
J. Clin. Pharmacol., June 1, 2005; 45(6): 674 - 682.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Gouaze, Y.-Y. Liu, C. S. Prickett, J. Y. Yu, A. E. Giuliano, and M. C. Cabot
Glucosylceramide Synthase Blockade Down-Regulates P-Glycoprotein and Resensitizes Multidrug-Resistant Breast Cancer Cells to Anticancer Drugs
Cancer Res., May 1, 2005; 65(9): 3861 - 3867.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
P.L. R. Ee, X. He, D. D. Ross, and W. T. Beck
Modulation of breast cancer resistance protein (BCRP/ABCG2) gene expression using RNA interference
Mol. Cancer Ther., December 1, 2004; 3(12): 1577 - 1584.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
X. Tian, M. J. Zamek-Gliszczynski, P. Zhang, and K. L. R. Brouwer
Modulation of Multidrug Resistance-Associated Protein 2 (Mrp2) and Mrp3 Expression and Function with Small Interfering RNA in Sandwich-Cultured Rat Hepatocytes
Mol. Pharmacol., October 1, 2004; 66(4): 1004 - 1010.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Arora, J.-M. Yang, R. Utsumi, T. Okamoto, T. Kitayama, and W. N. Hait
P-Glycoprotein Mediates Resistance to Histidine Kinase Inhibitors
Mol. Pharmacol., September 1, 2004; 66(3): 460 - 467.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Kang, M. H. Fisher, D. Xu, Y. J. Miyamoto, A. Marchand, A. Van Aerschot, P. Herdewijn, and R. L. Juliano
Inhibition of MDR1 gene expression by chimeric HNA antisense oligonucleotides
Nucleic Acids Res., August 17, 2004; 32(14): 4411 - 4419.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Xu, H. Kang, M. Fisher, and R. L. Juliano
Strategies for Inhibition of MDR1 Gene Expression
Mol. Pharmacol., August 1, 2004; 66(2): 268 - 275.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Z. Duan, K. A. Brakora, and M. V. Seiden
Inhibition of ABCB1 (MDR1) and ABCB4 (MDR3) expression by small interfering RNA and reversal of paclitaxel resistance in human ovarian cancer cells
Mol. Cancer Ther., July 1, 2004; 3(7): 833 - 838.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
S. P. PERSENGIEV, X. ZHU, and M. R. GREEN
Nonspecific, concentration-dependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs)
RNA, January 1, 2004; 10(1): 12 - 18.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, H.
Right arrow Articles by Yang, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, H.
Right arrow Articles by Yang, J.-M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online