Cancer Research Cell Death Mechanisms and Cancer Therapy  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Recio, J. A.
Right arrow Articles by Merlino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Recio, J. A.
Right arrow Articles by Merlino, G.
[Cancer Research 63, 1576-1582, April 1, 2003]
© 2003 American Association for Cancer Research


Molecular Biology and Genetics

Hepatocyte Growth Factor/Scatter Factor Induces Feedback Up-Regulation of CD44v6 in Melanoma Cells through Egr-1

Juan A. Recio and Glenn Merlino1

Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892-4264


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The hepatocyte growth factor/scatter factor (HGF/SF) receptor c-Met and variants of the CD44 family of surface adhesion molecules, including CD44v6, have been implicated in cancer progression and metastasis. CD44 isoforms bearing heparin sulfate chains can bind to HGF/SF and facilitate its presentation to c-Met. Here, we demonstrate that HGF/SF-Met binding up-regulates the expression of CD44v6 in murine melanoma cells, serving to compensate for loss by internalization. c-Met-mediated CD44v6 up-regulation was achieved through transcriptional activation of the immediate early gene egr-1. Enhanced egr-1 expression was apparent at the level of RNA 40 min after exposure to HGF/SF, and Egr-1 protein was detectable between 1 and 2 h post-treatment. CD44v6 RNA levels were correspondingly elevated 2 h after HGF/SF exposure. HGF/SF induced egr-1 activation via the Ras>Erk1/2 pathway but not through either phosphatidylinositol 3'-kinase or protein kinase C. Binding of NK2, a naturally occurring splice variant of HGF/SF, to c-Met failed to induce either Egr-1 or CD44v6, accounting at least in part for its antagonistic behavior. We also identified an Egr-1-binding site in the mouse CD44 gene promoter that accounts for its responsiveness to HGF/SF in melanoma cells. The compensatory up-regulation of both c-Met and CD44v6 in response to HGF/SF has important implications with respect to strategies used by cancer cells to sustain stimulation of growth- and metastasis-promoting pathways associated with tumor progression.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HGF/SF2 is a pleiotropic cytokine/growth factor capable of inducing an extraordinary variety of biological activities, including cellular proliferation, migration, and invasiveness (1, 2, 3, 4, 5) . This Mr 92,000 factor consists of a ß chain with an enzymatically inactive serine protease domain and an {alpha} chain with an NH2-terminal domain and four kringle domains. NK1 and NK2 are naturally occurring truncated variants of HGF/SF. NK1 consists of the N domain and first kringle domain of the HGF/SF {alpha} chain, whereas the structure of NK2 contains the second kringle domain as well (6, 7, 8, 9) . NK1 has been reported to be a partial agonist of HGF/SF (9, 10, 11, 12) , whereas NK2 behaves mostly as an antagonist (4 , 6 , 13, 14, 15) . All activities of HGF/SF and its variant forms are mediated through the receptor tyrosine kinase c-Met, resulting in the activation of one of the most complex signaling networks attributable to a receptor tyrosine kinase. c-Met activation promotes the recruitment of several protein kinases and intermediates, including PI3K, phospholipase C-{gamma}, Stat 3, c-Src, Grb-2, and Gab-1, leading to the activation of a wide variety of downstream pathways, including the Ras>MAP kinase, PI3K>Akt, c-Jun-NH2-terminal kinase/stress-activated protein kinase, p38, and focal adhesion kinase pathways (16, 17, 18, 19, 20, 21, 22, 23) .

In addition to binding c-Met, HGF/SF, NK1, and NK2 also have a high affinity for heparin (24, 25, 26) . HS, considered to be the low-affinity receptor for HGF/SF, is a GAG structurally related to heparin and widely expressed in the form of proteoglycan species on the cell surface and in the extracellular matrix. It has been extensively demonstrated that HS plays a role in the presentation of several growth factors to their receptors (27, 28, 29, 30, 31, 32, 33) . A number of studies has correlated the response to HGF/SF and its isoforms to the presence of GAGs on the cell surface (10 , 32 , 34, 35, 36) , e.g., when modified by association with HS, the glycoprotein CD44 participates in the presentation of HGF/SF to c-Met (32) .

CD44 molecules constitute a family of multifunctional, transmembrane glycoproteins occurring in multiple forms and implicated in diverse normal and pathological cellular functions, including lymphocyte activation and homing and tumor progression and metastasis (37, 38, 39, 40) . CD44 is a single chain protein consisting of an NH2-terminal extracellular domain, membrane proximal domain, transmembrane domain, and cytoplasmic tail. The major ligand of CD44 is hyaluronic acid, which is an ubiquitous part of the extracellular matrix. In addition, CD44 can associate with growth factors; this interaction is facilitated by CD44 oligomerization (reviewed in Ref. 40 ).

The most common isoform expressed in a wide variety of cell types is CD44s (for standard). However, there are several alternatively spliced forms, designated v1–v10, which include an insertion at the membrane proximal region of the extracellular domain. The distribution of these CD44 variants is usually restricted, and some variants are only expressed in certain tumor cells (41 , 42) . Of particular interest was the detection of CD44v4–v7 and CD44v6–v7 in human lymphomas, colorectal adenocarcinomas, endometrial cancer, papillary thyroid carcinoma, lung and breast cancer, and metastasizing rat adenocarcinomas (43, 44, 45, 46, 47, 48, 49) . Forced expression of CD44v isoforms can confer metastatic properties to nonmetastatic cells when injected into an isogenic host (43 , 50 , 51) . Moreover, the systemic application of antibodies directed against the v6 epitope and the expression of antisense CD44v6 can retard tumor growth and block metastasis in vivo (43 , 44 , 52) . Injection of hyaluronan oligomers into melanoma cells inhibits tumor formation (53) .

The expression of CD44 and regulation of the alternative splicing of the variants are stimulated in response to hormones, cytokines, and growth factors, particularly by the Ras>Erk pathway (54, 55, 56) , through the activation of transcription factors such as Egr-1 and AP-1 (57, 58, 59) . The immediate early gene egr-1 [also known as NGFI-A (60) , Krox-24 (61) , and Zif268 (62) ] encodes a nuclear, zinc finger protein capable of binding to specific GC-rich DNA sequences (63 , 64) . The egr-1 gene is rapidly and transiently induced by growth factors and differentiation signals (60 , 64) through different signal transduction pathways, including the PKC>Ras>MAP kinase and PI3K pathways (65, 66, 67) .

In this study, we show that 37-32 mouse melanoma cells express the metastasis-associated protein CD44v6, which can facilitate presentation of HGF/SF to its receptor c-Met. Furthermore, we demonstrate that HGF/SF, but not NK2, promotes the feedback up-regulation of CD44v6 through the transcriptional activation of egr-1.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
The antibodies used were obtained from the following commercial sources: (a) anti-c-Met (SP260), anti-AP-1/c-Jun, and anti–Egr-1 (C-19; Santa Cruz Biotechnology, Santa Cruz, CA); (b) anti-P-c-Met (Y1230/34/35) (Biosource); (c) anti-actin (Chemicon International, Inc., Temecula, CA); and (d) antimouse-CD44v6 (Bender Medsystems). Western blot detection was accomplished using horseradish peroxidase-coupled antimouse, antirabbit (Amersham Pharmacia Biotech), and antirat secondary antibodies (Sigma Chemical Co., St. Louis, MO). Secondary antirabbit and antirat FITC antibodies and Texas red conjugates for fluorescence microscopy and FACS were purchased from Vector Laboratories, Inc. (Burlingame, CA). The Mek1/2 inhibitor PD98059 and U0126 were obtained from Cell Signaling Technologies. The PI3K inhibitor LY294002 was from Upstate Biotechnology, Inc. (Lake Placid, NY). Staurosporine was purchased from Roche Laboratories. Recombinant human HGF/SF was from R&D Systems, Inc. (Minneapolis, MN). The pBlueCD44 full cDNA was obtained from Dr. John Monroe (University of Pennsylvania). Purified NK2 was a generous gift from Dr. Ralph Schwall (Genentech).

Cell Culture, Transfection, and Stimulation.
The 37-32 mouse cell line was derived from a cutaneous melanoma arising in the HGF/SF transgenic mouse line MH37 (15) . Cells were maintained in DMEM (Life Technologies, Inc., Gaithersburg, MD), supplemented with 10% fetal bovine serum (Harlan Sprague Dawley, Indianapolis, IN), 100 IU/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine (Life Technologies, Inc.), 5 µg/ml insulin (Sigma), and 5 ng/ml epidermal growth factor (Upstate Biotechnology), and incubated in 5% CO2 at 37°C. Cells were treated with 40 ng/ml HGF/SF (R&D Systems) and harvested at the times indicated.

Western Blot and Immunoprecipitation.
After HGF/SF treatment, cells were lysed with M-PER (Pierce Chemical Co., Rockford, IL) in the presence of protease inhibitor cocktail (Roche). Fifty µg of protein from lysates were separated by SDS-PAGE using 4–20% gradient gels (Novex). Proteins were transferred to nitrocellulose membranes (Novex) and probed against primary antibodies. Proteins were visualized with secondary antibodies coupled to horseradish peroxidase and developed using Super Signal-West Pico Chemiluminescent Substrate (Pierce). Immunoprecipitation of c-Met was performed by treating the cells with M-PER (Pierce) and incubating the resulting lysates with either antiphospho-antibodies or anti-c-Met overnight at 4°C. After the addition of protein A/G agarose PLUS (Santa Cruz Biotechnology) and washing in M-PER buffer, samples were fractionated by SDS-PAGE using 4–20% gradient gels (Novex). After transfer, blots were blocked and incubated overnight with an anti-c-Met antibody. Bands were visualized by incubation with a secondary antirabbit antibody conjugated to horseradish peroxidase and Super Signal-West Pico Chemiluminescent Substrate. After stripping, membranes were blocked and incubated overnight with other antibodies as indicated in the figure legends.

Northern Blots.
Twenty µg of total RNA were resolved on a denaturing 1% agarose formaldehyde gel and transferred to a nitrocellulose membrane (Schleicher & Schuell; Refs. 23 and 68 ). Membranes were prehybridized and hybridized against CD44 using ultrahybridization solution (Sigma) following the manufacturer’s instructions and subjected to autoradiography.

cDNA Arrays.
Mouse pathway finder array (Superarray, Inc.) was used to hybridize cDNA from 37-32 cells, treated as indicated with either HGF/SF or NK2. The array was performed following the manufacturer’s protocol using 5 µg of total RNA as a template for cDNA synthesis.

Nuclear Extracts and EMSA Assay.
Gel mobility shift assays and nuclear extracts were as described by Andrews and Faller (69) . Briefly, cells were lysated in buffer A [10 mM HEPES-KOH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, and 0.5 mM DTT plus protease inhibitor cocktail] for 10 min at 4°C. After centrifugation, the pellet was resuspended in buffer B [20 mM HEPES-KOH (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and protease inhibitor cocktail]. Samples were incubated in ice for 30 min and then subjected to centrifugation to recover the nuclear proteins. EMSAs were performed as described by Recio and Aranda (70) . Five µg of nuclear extracts were added to a buffer containing ~30,000 cpm of P32-labeled oligonucleotide, 0.1 µg of Poly (dI-dC), 40 mM HEPES (pH 7.0), 140 mM NaCl, 4 mM DTT, 0.01% NP40, 100 mg/ml BSA, and 4% Ficoll. After incubation, the samples were loaded onto a 6% nondenaturing polyacrylamide gel. AP-1, Egr-1, and Egr-1 mutant oligonucleotides were purchased from Santa Cruz Biotechnology.

Immunofluorescence and FACS Analysis.
Cells were grown in slide chambers as described above. After treatment, cells were fixed in cold methanol for 10 min and air dried. Cells were then permeabilized in PBS containing 0.1% Triton X-100 and blocked in PBS containing 1% BSA for 1 h. Primary antibodies were then incubated at a 1:50 dilution in the blocking solution for 1 h, followed by three washes with PBS. The FITC- and Texas red-conjugated secondary antibodies were incubated for an additional hour in blocking solution either at a 1:50 or 1:100 dilution. After three washes with PBS, cells were mounted in fluorescent mounting medium (Zymed), and images were captured using a confocal microscope (Bio-Rad). Flow cytometry followed routine procedures. Samples were analyzed using a FACSCalibur (Becton Dickinson).

Antisense Experiments.
For antisense experiments, the Egr-1 sense oligo: Agt GTTCCCCGCGCCCCGca, or the antisense Egr-1 oligo: tgCGGGGCGCGGGGAACa cT (where the bases in small letters were phophorothioated), was added to cells in serum-free media and starved 12 h before treatment. Total RNA was then extracted, and a Northern blot was performed as described above.

ChIP Assay.
The ChIP assay was performed using the ChIP assay kit (Upstate Biotechnology) following the manufacturer’s directions. Anti-Egr-1 (C-19) was used to immunoprecipitate Egr-1-containing complexes. The Egr-1-binding site in the mouse CD44 promoter was amplified by a nested PCR assay using the following primers: CD445'SC: GACGGGAACCATGTATGTGCGTCG; CD443'ASC: GACACACCAGCCTGCTTTC GCTAC, CD445'SL (nested): AAGAGGAAAGAACACTCCCACAAGTTCCCC, CD443'ASL (nested): TAAAGACACACCAGCCTGCTTTCGCTACTG. The PCR conditions were as follows: (a) 5 min at 94°C; (b) 35 cycles of 30 s at 65°C; and (c) 1 min at 68°C, followed by 7 min at 72°C.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CD44v6 Is Expressed in Mouse Melanoma Cells and Helps Present HGF/SF to c-Met.
Melanoma cells isolated from HGF/SF transgenic mice (line 37-32) express high levels of c-Met and are very responsive to HGF/SF (15 , 23) . Recently, a role for CD44 in presenting HGF/SF to c-Met in colorectal cancer cells has been described (32 , 71) . We therefore explored a possible role for CD44 in HGF/SF-Met signaling in a melanoma cell line derived from an HGF/SF transgenic mouse. Preliminary data using confocal microscopy revealed that HGF/SF and NK2 promoted the colocalization and cointernalization of c-Met and the v6-containing isoform of CD44 (hereafter referred to as CD44v6) in 37-32 cells (data not shown). Western blot and FACS analyses then showed that these melanoma cells not only expressed the CD44v6 isoform but that the cell surface levels of this receptor were elevated 24 h after HGF/SF treatment (Fig. 1, A and B)Citation .



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. CD44v6 is expressed in 37-32 mouse melanoma cells and helps present HGF/SF to c-Met. A, Western blot showing the expression of CD44v6 in 37-32 cells treated with HGF/SF (40 ng/ml) for 24 h. Fifty µg of total protein were loaded per lane. ß-Actin was used as a loading control. In B, expression and regulation of cell surface CD44v6 by HGF/SF (40 ng/ml) are demonstrated by FACS analysis. In C, the 37-32 cells were treated with 25 mU/ml heparitinase III for 3 h before HGF/SF treatment. c-Met was immunoprecipitated, and samples were separated by SDS-PAGE. Blots were probed against the indicated antibodies.

 
Because the variant CD44v6 is associated with HS, we determined if HS chains were required for HGF/SF responsiveness by treating the 37-32 cells with heparitinase III before HGF/SF stimulation. Fig. 1CCitation shows that pretreatment of 37-32 cells with heparitinase III totally blocked the ability of HGF/SF to phosphorylate c-Met tyrosines at the positions Y1230/34/35. This result, although not conclusive standing alone, supports a role for the HS-modified CD44v6 isoform in the presentation of HGF/SF to c-Met, in agreement with data reported previously by several authors (10 , 32 , 34, 35, 36) .

HGF/SF, but not NK2, Up-Regulates CD44v6 RNA Transcripts via the Erk1/2 Pathway.
Next, Northern blot hybridization was used to determine whether HGF/SF induced the expression of CD44v6 at the level of RNA and when this induction occurred. Fig. 2ACitation shows that CD44v6 transcript levels were elevated by exposure to HGF/SF, reaching a 2-fold peak at 2 h and decreasing thereafter. At 6 h, the levels of CD44v6 RNA were below basal expression. The Mek1/2-specific inhibitor, U0126, was able to inhibit HGF/SF-mediated up-regulation of CD44v6, demonstrating a role for the Erk1/2 pathway (Fig. 2B)Citation . In contrast to HGF/SF, the variant NK2 could not activate Erk1/2 in 37-32 melanoma cells (15) and did not enhance expression of CD44v6 (Fig. 2B)Citation . These data show that HGF/SF, but not NK2, up-regulates CD44v6 at least in part through the Ras>Erk1/2 pathway and are consistent with a transcriptional mechanism underlying enhanced CD44v6 expression.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. HGF/SF, but not NK2, up-regulates CD44v6 via the Erk1/2 pathway. In A, the time course is shown of CD44v6 up-regulation by HGF/SF in 37-32 melanoma cells. Twenty µg of total RNA were loaded per lane. In B, the same cells were treated for 2 h either with HGF/SF (40 ng/ml) or NK2 (120 ng/ml). The Mek1/2-specific inhibitor U0126 (10 µM) was used to block HGF/SF induction. Twenty µg of total RNA were loaded per lane. Glyceraldehyde-3-phosphate dehydrogenase was used as a loading control.

 
HGF/SF, but not NK2, Up-Regulates the Immediate Early Gene Transcription Factor Egr-1.
To look for transcription factors responsible for the up-regulation of CD44v6 by HGF/SF, we performed a cDNA array. Total RNA from cells treated either with HGF/SF or NK2 for different time periods was used to generate the cDNA populations for array analysis. The cDNA array revealed significant elevation in expression of the immediate early gene egr-1 after 40 min of treatment with HGF/SF but not NK2; egr-1 expression returned to basal levels by 4.5 h (Fig. 3A)Citation .



View larger version (76K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. HGF/SF, but not NK2, up-regulates the Egr-1 transcription factor. In A, a cDNA array (Superarray) shows up-regulation of Egr-1 transcription factor RNA. 37-32 cells were treated either with HGF/SF (40 ng/ml) or NK2 (120 ng/ml), and cDNA expression was assessed at two different time points. ß-Actin was used as a control. In B, the time course is shown for expression of Egr-1 protein after HGF/SF (40 ng/ml) treatment. Fifty µg of total protein per lane were loaded. ß-Actin was probed in the same blot as a control.

 
Examination of Egr-1 expression by Western blot analysis of total lysates showed that Egr-1 protein was elevated after 30 min, reaching a peak by 2 h and thereafter becoming undetectable (Fig. 3B)Citation . These data indicate that, like CD44v6, the Egr-1 transcription factor is up-regulated by HGF/SF but not NK2.

HGF/SF-induced Up-Regulation of Egr-1 Is Mediated through the Ras>Erk1/2 Pathway.
Egr-1 can be regulated through the PKC, Erk1/2, and PI3K signaling pathways (61, 62, 63) . Western blot analysis of nuclear protein extracts from 37-32 cells after 1.5 h treatment with HGF/SF in the presence or absence of specific inhibitors for PI3K or Mek1/2 (LY294002 or PD98059, respectively) showed that Egr-1 up-regulation was mediated through the Erk1/2 pathway and not the PI3K pathway (Fig. 4A)Citation . These results were corroborated by immunofluorescent staining of 37-32 cells with an Egr-1 antibody (Fig. 4B)Citation and by Western blot analysis of total protein extracts (data not shown). Immunofluorescence and Western blot data confirmed the inability of NK2 to up-regulate Egr-1 (Fig. 4, B and C)Citation .



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Egr-1 is up-regulated by HGF/SF through the Ras>Erk1/2 pathway. A, Western blot showing the regulation of Egr-1 by HGF/SF (40 ng/ml). Ten µg of nuclear extracts were loaded per lane. Mek1/2- and PI3K-specific inhibitors (PD98059 at 20 µM and LY294002 at 1.5 µM, respectively) were used as indicated in the figure. B, immunofluorescence showing the nuclear localization of the Egr-1 transcription factor (green) after either HGF/SF (40 ng/ml) or NK2 (120 ng/ml) treatment in the presence of Mek1/2 or PI3K inhibitors. Nuclei were stained with propidium iodine (red). C, Western blot showing Egr-1 expression after HGF/SF or NK2 stimulation. The Mek1/2 inhibitor PD98059, or the PKC inhibitor staurosporin (St; 100 nM), was used as indicated. Ten µg of nuclear protein were loaded per lane.

 
To determine whether PKC was involved in the up-regulation of Egr-1 by HGF/SF, melanoma cells were treated with the PKC-specific inhibitor staurosporin (100 nM) for 1 h before HGF/SF treatment. Western blot analysis of nuclear extracts from these cells showed that staurosporin could not block HGF/SF-mediated Egr-1 up-regulation (Fig. 4C)Citation . These results demonstrate that, like CD44v6, the regulation of Egr-1 by HGF/SF is mediated through the Ras>Erk1/2 pathway. Moreover, up-regulation of Egr-1 precedes that of CD44v6.

Egr-1 Binds to the CD44 Mouse Promoter and Is Responsible for CD44v6 Up-Regulation by HGF/SF.
The HGF/SF-induced up-regulation of Egr-1 protein and CD44v6 RNA is consistent with a role for Egr-1 in the transcriptional activation of CD44 (Fig. 2A)Citation . Maltzman et al. (57) have demonstrated previously a functional binding site for Egr-1 in the human CD44 gene promoter in response to the B-cell antigen receptor. To prove that a comparable Egr-1-binding site functions in the CD44 mouse promoter, several experiments were designed. The 37-32 melanoma cells were transfected either with egr-1 sense or antisense oligonucleotides and then treated with 40 ng/ml HGF/SF for 2 h. Northern blot analysis showed that the 2-fold increase in CD44v6 RNA induced by HGF/SF was partially blocked by the presence of the egr-1 antisense, but not the egr-1 sense, oligonucleotide (Fig. 5A)Citation , indicating that Egr-1 is required for HGF/SF-mediated CD44v6 up-regulation. Next, we attempted to detect the direct binding of Egr-1 to the mouse CD44 promoter using a ChIP assay. The 37-32 mouse melanoma cells were treated with HGF/SF for 1 h, and then specific chromatin–protein complexes were immunoprecipitated using an anti-Egr-1 antibody. The region homologous to the Egr-1-binding site was then subjected to PCR amplification using as a template the DNA from the Egr-1-specific immunoprecipitated complexes. The appropriate band (451 bp) corresponding to the fragment containing the predicted Egr-1-binding site was detected only in the HGF/SF-treated cells (Fig. 5B)Citation . As a control, the amplification was performed on complexes obtained without exposure to Egr-1 antibody and from the untreated 37-32 melanoma cells (Fig. 5B)Citation .



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Egr-1 binds to the CD44 mouse promoter and regulates CD44v6 transcription. A, Northern blot of 37-32 melanoma cells transfected either with the Egr-1 sense or antisense oligonucleotide. CD44 RNA expression was quantified 2 h after treatment with HGF/SF (40 ng/ml). Glyceraldehyde-3-phosphate dehydrogenase was used as a loading control. B, ChIP assay showing the amplification of the 451-bp fragment containing the Egr-1-binding site within the CD44 promoter only after HGF/SF treatment. In C, nuclear extracts from 37-32 cells treated as indicated were analyzed by EMSA for in vitro binding of the Egr-1 transcription factor to a labeled consensus sequence (Santa Cruz Biotechnology). D, time course of AP-1 transcription factor activation after HGF/SF treatment in 37-32 cells. Activation was inhibited by the presence of an anti-AP-1 antibody or 100-fold excess of cold oligonucleotide. E, nucleotide sequence of the mouse promoter fragment, 685 nucleotides upstream of the transcription initiation site. Several putative transcription factor-binding sites are shown (55) . The homologous human Egr-1-binding site is located 235 bp upstream of the initiation site.

 
An EMSA was also performed using an Egr-1 consensus motif oligonucleotide. Nuclear extracts generated from HGF/SF-treated cells showed an increase in binding to the labeled Egr-1 consensus sequence oligonucleotide (Fig. 5C)Citation . As expected, this increase in binding was blocked in cells treated with the Mek1/2 inhibitor PD98059 but not in those treated with the PI3K inhibitor (Fig. 5C)Citation . There was no binding when the nuclear extracts from the HGF/SF-treated cells were assayed using a mutant Egr-1-binding site oligonucleotide. Others have described the participation of the AP-1 transcription factor in the transcriptional up-regulation of the CD44 receptor (58 , 59) . Fig. 5DCitation shows a time course of the activation of AP-1 after HGF/SF stimulation. Maximum activation occurred 1 h after triggering, and the binding was inhibited by the presence of an anti-AP-1 antibody.

Fig. 5ECitation displays the sequence of the mouse CD44 promoter from -685 to the transcriptional start site. Putative transcription factor-binding sites are indicated, including the transcriptional start site identified using the TESS program (59 , 72) . The Egr-1-binding site for the mouse promoter is located at a position 235 upstream of the transcriptional start site (Fig. 5E)Citation .


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HS proteoglycans have been shown to be crucial for ligand–receptor interactions (27, 28, 29, 30, 31, 32, 33) . Although their role in HGF/SF-Met interaction is less well defined, several in vitro studies have indicated that these proteoglycans may play an important regulatory role in HGF/SF-Met signaling (10 , 32 , 34, 35, 36) . Some isoforms of the CD44 family have been implicated in the presentation of HGF/SF to c-Met (32 , 73) . These HS proteoglycans may help to localize HGF/SF to specific cells or extracellular matrix components within the microenvironment and may be required for the establishment of a chemotactic gradient (38 , 42 , 74) . In this study, we show that 37-32 murine melanoma cells, which already possess a strong HGF/SF-Met autocrine loop, also express the variant 6 isoform of CD44. It has been proposed that the presence of the v6 and v7 regions promotes CD44 oligomerization, which in turn facilitates binding to ligands (reviewed in Ref. 40 ); these ligands include GAGs and growth factors, such as HGF/SF. We further demonstrated that expression of the CD44v6 variant is up-regulated by HGF/SF through a feedback loop requiring the presence of Egr-1.

A number of studies has demonstrated that enhanced activity of oncogenic Ras-associated MAP kinase pathways in different cellular systems regulates the expression and alternative splicing of the CD44 family proteins (54, 55, 56) . The expression of CD44v6 in melanoma cells and its relationship to HGF/SF-Met signaling are significant because the CD44v6 isoform has been implicated in metastasis and tumor progression (47 , 48 , 72) . In some cases, such as gastric carcinoma, colorectal adenocarcinoma, pancreatic cancer, and breast cancer, the expression of CD44v6 has been proposed as a marker for poor prognosis (47 , 49 , 75 , 76) . Aberrant c-Met expression has also been documented in a variety of human cancers (reviewed in Refs. 5 , 77 , and 78 ). Moreover, HGF/SF is known to up-regulate expression of c-Met in normal and malignant cells (79, 80, 81) . Thus, our data forge an intriguing regulatory link between activation by the multifunctional cytokine HGF/SF, and up-regulation of those receptors required to sustain its cellular activities. Interestingly, we found that NK2, which can behave as an HGF/SF antagonist in a number of cell types (4 , 6 , 13 , 14 , 82) , is unable to up-regulate CD44v6 expression in 37-32 mouse melanoma cells, although both ligands induce colocalization and internalization of c-Met and CD44v6 (data not shown). As a consequence, NK2 cannot replenish cell surface levels of CD44v6, offering at least a partial explanation for its antagonistic behavior.

Most studies of CD44 promoter regulation have focused on the methylation state of the promoter. However, Maltzman et al. (57) have reported that the Egr-1 and AP-1 transcription factors are essential for the regulation of the human CD44 promoter in B-lymphocytes. Data presented in this study are the first to demonstrate the up-regulation of the Egr-1 transcription factor in response to HGF/SF. Transcriptional regulation of Egr-1 by HGF/SF-Met signaling is driven through Ras>Erk1/2 but is independent of PI3K and PKC (65, 66, 67) . Because NK2 does not activate Erk1/2 in 37-32 cells (15) , it was not surprising to find that NK2 cannot up-regulate either Egr-1 or CD44v6.

We anticipate that other transcription factors will participate in regulating the activity of the mouse CD44 promoter (see Fig. 5DCitation ). It has been shown that transcriptional activation of c-met by HGF/SF is mediated through AP-1 complexes (81) . Additional data from our cDNA array (data not shown) and EMSA analysis implicate other early genes, such as c-Jun and c-fos, as HGF/SF-Met targets; c-Jun and c-fos are part of the AP-1 complex (83) . These data, and the fact that AP-1-binding sites have been identified in the human CD44 promoter (57 , 59) , suggest that in addition to Egr-1, AP-1 may be involved in the transcriptional regulation of CD44.

Two different groups have demonstrated the functionality of the Egr-1-binding site in the human CD44 promoter (57 , 58) ; however, the homologous site in the mouse promoter has not been reported. The antisense experiment and ChIP assay described here demonstrated not only the presence of the binding site in the homologous mouse promoter but its functionality as well. In the human CD44 promoter, the Egr-1-binding site is located at position -301 overlapping an SP1-binding site (57) . In the mouse promoter, the Egr-1-binding site is located at position -235, also overlapping an SP1-binding site. Although the mouse Egr-1-binding site sequence is not identical to the human, the three nucleotides essential for the binding of Egr-1 to the homologous human site are conserved (57) .

In conclusion, here we describe the novel up-regulation of the immediate early response gene, egr-1, by HGF/SF in melanoma cells. In contrast to HGF/SF, the antagonist NK2 was unable to up-regulate this transcription factor. We have further demonstrated that Egr-1 mediates enhanced CD44v6 expression in response to HGF/SF treatment. The feedback loop in which expression of both c-Met and CD44v6 is up-regulated in melanoma cells in response to receptor-depleting exposure to HGF/SF represents an important mechanism whereby cancer cells establish and maintain constitutive stimulation of growth- and metastasis-promoting pathways.


    ACKNOWLEDGMENTS
 
We thank Dr. Ralph Schwall for providing purified NK2 and Dr. John Monroe for the full-length CD44 cDNA.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Molecular Genetics Section, Laboratory of Molecular Biology, National Cancer Institute, NIH, Building 37, Room 5002, 37 Convent Drive, MSC 4264, Bethesda, MD 20892-4264. Phone: (301) 496-4270; Fax: (301) 480-7618; E-mail: gmerlino{at}helix.nih.gov Back

2 The abbreviations used are: HGF/SF, hepatocyte growth factor/scatter factor; PKC, protein kinase C; HS, heparan sulfate; GAG, glycosaminoglycan; EMSA, electrophoretic mobility shift assay; AP-1, activator protein; PI3K, phosphatidylinositol 3'-kinase; FACS, fluorescence-activated cell sorter; ChIP, chromatin immunoprecipitation; Erk, extracellular signal-regulated kinase; MAP, mitogen-activated protein; Mek, mitogen-activated protein/extracellular signal-regulated kinase kinase. Back

Received 9/ 4/02. Accepted 1/31/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gherardi E., Stoker M. Hepatocyte growth factor-scatter factor: mitogen, motogen, and met. Cancer Cells, 3: 227-232, 1991.[Medline]
  2. Rubin J. S., Bottaro D. P., Aaronson S. A. Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product. Biochim. Biophys. Acta, 1155: 357-371, 1993.[Medline]
  3. Matsumoto K., Nakamura T. Emerging multipotent aspects of hepatocyte growth factor. J. Biochem. (Tokyo), 119: 591-600, 1996.[Abstract/Free Full Text]
  4. Jeffers M., Rong S., Vande Woude G. F. Enhanced tumorigenicity and invasion-metastasis by hepatocyte growth factor/scatter factor-met signalling in human cells concomitant with induction of the urokinase proteolysis network. Mol. Cell. Biol., 16: 1115-1125, 1996.[Abstract]
  5. Comoglio P. M., Boccaccio C. Scatter factors and invasive growth. Semin. Cancer Biol., 11: 153-165, 2001.[Medline]
  6. Chan A. M., Rubin J. S., Bottaro D. P., Hirschfield D. W., Chedid M., Aaronson S. A. Identification of a competitive HGF antagonist encoded by an alternative transcript. Science, 254: 1382-1385, 1991.[Abstract/Free Full Text]
  7. Miyazawa K., Kitamura A., Naka D., Kitamura N. An alternatively processed mRNA generated from human hepatocyte growth factor gene. Eur. J. Biochem., 197: 15-22, 1991.[Medline]
  8. Lokker N. A., Godowski P. J. Generation and characterization of a competitive antagonist of human hepatocyte growth factor, HGF/NK1. J. Biol. Chem., 268: 17145-17150, 1993.[Abstract/Free Full Text]
  9. Cioce V., Csaky K. G., Chan A. M., Bottaro D. P., Taylor W. G., Jensen R., Aaronson S. A., Rubin J. S. Hepatocyte growth factor (HGF)/NK1 is a naturally occurring HGF/scatter factor variant with partial agonist/antagonist activity. J. Biol. Chem., 271: 13110-13115, 1996.[Abstract/Free Full Text]
  10. Schwall R. H., Chang L. Y., Godowski P. J., Kahn D. W., Hillan K. J., Bauer K. D., Zioncheck T. F. Heparin induces dimerization and confers proliferative activity onto the hepatocyte growth factor antagonists NK1 and NK2. J. Cell Biol., 133: 709-718, 1996.[Abstract/Free Full Text]
  11. Sakata H., Stahl S. J., Taylor W. G., Rosenberg J. M., Sakaguchi K., Wingfield P. T., Rubin J. S. Heparin binding and oligomerization of hepatocyte growth factor/scatter factor isoforms. Heparan sulfate glycosaminoglycan requirement for Met binding and signaling. J. Biol. Chem., 272: 9457-9463, 1997.[Abstract/Free Full Text]
  12. Jakubczak J. L., LaRochelle W. J., Merlino G. NK1, a natural splice variant of hepatocyte growth factor/scatter factor, is a partial agonist in vivo. Mol. Cell. Biol., 18: 1275-1283, 1998.[Abstract/Free Full Text]
  13. Montesano R., Soriano J. V., Malinda K. M., Ponce M. L., Bafico A., Kleinman H. K., Bottaro D. P., Aaronson S. A. Differential effects of hepatocyte growth factor isoforms on epithelial and endothelial tubulogenesis. Cell Growth Differ., 9: 355-365, 1998.[Abstract]
  14. Guerin C., Luddy C., Abounader R., Lal B., Laterra J. Glioma inhibition by HGF/NK2, an antagonist of scatter factor/hepatocyte growth factor. Biochem. Biophys. Res. Commun., 273: 287-293, 2000.[Medline]
  15. Otsuka T., Takayama H., Sharp R., Celli G., LaRochelle W. J., Bottaro D. P., Ellmore N., Vieira W., Owens J. W., Anver M., Merlino G. c-Met autocrine activation induces development of malignant melanoma and acquisition of the metastatic phenotype. Cancer Res., 58: 5157-5167, 1998.[Abstract/Free Full Text]
  16. Ponzetto C., Bardelli A., Zhen Z., Maina F., dalla Zonca P., Giordano S., Graziani A., Panayotou G., Comoglio P. M. A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter factor receptor family. Cell, 77: 261-271, 1994.[Medline]
  17. Weidner K. M., Di Cesare S., Sachs M., Brinkmann V., Behrens J., Birchmeier W. Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis. Nature, 384: 173-176, 1996.[Medline]
  18. Weidner K. M., Sachs M., Riethmacher D., Birchmeier W. Mutation of juxtamembrane tyrosine residue 1001 suppresses loss-of-function mutations of the met receptor in epithelial cells. Proc. Natl. Acad. Sci. USA, 92: 2597-2601, 1995.[Abstract/Free Full Text]
  19. Ponzetto C., Zhen Z., Audero E., Maina F., Bardelli A., Basile M. L., Giordano S., Narsimhan R., Comoglio P. Specific uncoupling of GRB2 from the Met receptor. Differential effects on transformation and motility. J. Biol. Chem., 271: 14119-14123, 1996.[Abstract/Free Full Text]
  20. Rodrigues G. A., Park M., Schlessinger J. Activation of the JNK pathway is essential for transformation by the Met oncogene. EMBO J., 16: 2634-2645, 1997.[Medline]
  21. Chen H. C., Chan P. C., Tang M. J., Cheng C. H., Chang T. J. Tyrosine phosphorylation of focal adhesion kinase stimulated by hepatocyte growth factor leads to mitogen-activated protein kinase activation. J. Biol. Chem., 273: 25777-25782, 1998.[Abstract/Free Full Text]
  22. Beviglia L., Kramer R. H. HGF induces FAK activation and integrin-mediated adhesion in MTLn3 breast carcinoma cells. Int. J. Cancer, 83: 640-649, 1999.[Medline]
  23. Recio J. A., Merlino G. Hepatocyte growth factor/scatter factor activates proliferation in melanoma cells through p38 MAPK, ATF-2 and cyclin D1. Oncogene, 21: 1000-1008, 2002.[Medline]
  24. Lyon M., Deakin J. A., Mizuno K., Nakamura T., Gallagher J. T. Interaction of hepatocyte growth factor with heparan sulfate. Elucidation of the major heparan sulfate structural determinants. J. Biol. Chem., 269: 11216-11223, 1994.[Abstract/Free Full Text]
  25. Aoyama H., Naka D., Yoshiyama Y., Ishii T., Kondo J., Mitsuka M., Hayase T. Isolation and conformational analysis of fragment peptide corresponding to the heparin-binding site of hepatocyte growth factor. Biochemistry, 36: 10286-10291, 1997.[Medline]
  26. Lyon M., Deakin J. A., Gallagher J. T. The mode of action of heparan and dermatan sulfates in the regulation of hepatocyte growth factor/scatter factor. J. Biol. Chem., 277: 1040-1046, 2002.[Abstract/Free Full Text]
  27. Rapraeger A. C., Krufka A., Olwin B. B. Requirement of heparan sulfate for bFGF-mediated fibroblast growth and myoblast differentiation. Science, 252: 1705-1708, 1991.[Abstract/Free Full Text]
  28. Yayon A., Klagsbrun M., Esko J. D., Leder P., Ornitz D. M. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell, 64: 841-848, 1991.[Medline]
  29. Olwin B. B., Rapraeger A. Repression of myogenic differentiation by aFGF, bFGF, and K-FGF is dependent on cellular heparan sulfate. J. Cell Biol., 118: 631-639, 1992.[Abstract/Free Full Text]
  30. Ornitz D. M., Yayon A., Flanagan J. G., Svahn C. M., Levi E., Leder P. Heparin is required for cell-free binding of basic fibroblast growth factor to a soluble receptor and for mitogenesis in whole cells. Mol. Cell. Biol., 12: 240-247, 1992.[Abstract/Free Full Text]
  31. Nugent M. A., Edelman E. R. Kinetics of basic fibroblast growth factor binding to its receptor and heparan sulfate proteoglycan: a mechanism for cooperactivity. Biochemistry, 31: 8876-8883, 1992.[Medline]
  32. Van der Voort R., Taher T. E., Wielenga V. J., Spaargaren M., Prevo R., Smit L., David G., Hartmann G., Gherardi E., Pals S. T. Heparan sulfate-modified CD44 promotes hepatocyte growth factor/scatter factor-induced signal transduction through the receptor tyrosine kinase c-Met. J. Biol. Chem., 274: 6499-6506, 1999.[Abstract/Free Full Text]
  33. Jones M., Tussey L., Athanasou N., Jackson D. G. Heparan sulfate proteoglycan isoforms of the CD44 hyaluronan receptor induced in human inflammatory macrophages can function as paracrine regulators of fibroblast growth factor action. J. Biol. Chem., 275: 7964-7974, 2000.[Abstract/Free Full Text]
  34. Chirgadze D. Y., Hepple J., Byrd R. A., Sowdhamini R., Blundell T. L., Gherardi E. Insights into the structure of hepatocyte growth factor/scatter factor (HGF/SF) and implications for receptor activation. FEBS Lett., 430: 126-129, 1998.[Medline]
  35. Sergeant N., Lyon M., Rudland P. S., Fernig D. G., Delehedde M. Stimulation of DNA synthesis and cell proliferation of human mammary myoepithelial-like cells by hepatocyte growth factor/scatter factor depends on heparan sulfate proteoglycans and sustained phosphorylation of mitogen-activated protein kinases p42/44. J. Biol. Chem., 275: 17094-17099, 2000.[Abstract/Free Full Text]
  36. Rubin J. S., Day R. M., Breckenridge D., Atabey N., Taylor W. G., Stahl S. J., Wingfield P. T., Kaufman J. D., Schwall R., Bottaro D. P. Dissociation of heparan sulfate and receptor binding domains of hepatocyte growth factor reveals that heparan sulfate-c-met interaction facilitates signaling. J. Biol. Chem., 276: 32977-32983, 2001.[Abstract/Free Full Text]
  37. Lesley J., Hyman R., Kincade P. W. CD44 and its interaction with extracellular matrix. Adv. Immunol., 54: 271-335, 1993.[Medline]
  38. Ponta H., Wainwright D., Herrlich P. The CD44 protein family. Int. J. Biochem. Cell Biol., 30: 299-305, 1998.[Medline]
  39. Sneath R. J., Mangham D. C. The normal structure and function of CD44 and its role in neoplasia. Mol. Pathol., 51: 191-200, 1998.[Abstract]
  40. Herrlich P., Morrison H., Sleeman J., Orian-Rousseau V., Konig H., Weg-Remers S., Ponta H. CD44 acts both as a growth- and invasiveness-promoting molecule and as a tumor-suppressing cofactor. Ann. N. Y. Acad. Sci., 910: 106-118, discussion 118–120 2000.[Medline]
  41. Tarin D., Matsumura Y. Deranged activity of the CD44 gene and other loci as biomarkers for progression to metastatic malignancy. J. Cell. Biochem., Suppl.: 173-185, 1993.
  42. Ilangumaran S., Borisch B., Hoessli D. C. Signal transduction via CD44: role of plasma membrane microdomains. Leuk. Lymphoma., 35: 455-469, 1999.[Medline]
  43. Gunthert U., Hofmann M., Rudy W., Reber S., Zoller M., Haussmann I., Matzku S., Wenzel A., Ponta H., Herrlich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65: 13-24, 1991.[Medline]
  44. Naor D., Sionov R. V., Zahalka M., Rochman M., Holzmann B., Ish-Shalom D. Organ-specific requirements for cell adhesion molecules during lymphoma cell dissemination. Curr. Top. Microbiol. Immunol., 231: 143-166, 1998.[Medline]
  45. Ochiai S., Nakanishi Y., Mizuno K., Hashimoto S., Inutsuka S., Kawasaki M., Yatsunami J., Hara N. Expression of CD44 standard and CD44 variant 6 in human lung cancer. Nihon Kyobu Shikkan Gakkai Zasshi, 35: 1179-1185, 1997.[Medline]
  46. Kurozumi K., Nishida T., Nakao K., Nakahara M., Tsujimoto M. Expression of CD44 variant 6 and lymphatic invasion: importance to lymph node metastasis in gastric cancer. World J. Surg., 22: 853-857; discussion 857858, 1998.[Medline]
  47. Foekens J. A., Dall P., Klijn J. G., Skroch-Angel P., Claassen C. J., Look M. P., Ponta H., Van Putten W. L., Herrlich P., Henzen-Logmans S. C. Prognostic value of CD44 variant expression in primary breast cancer. Int. J. Cancer, 84: 209-215, 1999.[Medline]
  48. Ayhan A., Tok E. C., Bildirici I. Overexpression of CD44 variant 6 in human endometrial cancer and its prognostic significance. Gynecol. Oncol., 80: 355-358, 2001.[Medline]
  49. Ishida T. Immunohistochemical expression of the CD44 variant 6 in colorectal adenocarcinoma. Surg. Today, 30: 28-32, 2000.[Medline]
  50. Birch M., Mitchell S., Hart I. R. Isolation and characterization of human melanoma cell variants expressing high and low levels of CD44. Cancer Res., 51: 6660-6667, 1991.[Abstract/Free Full Text]
  51. Rudy W., Hofmann M., Schwartz-Albiez R., Zoller M., Heider K. H., Ponta H., Herrlich P. The two major CD44 proteins expressed on a metastatic rat tumor cell line are derived from different splice variants: each one individually suffices to confer metastatic behavior. Cancer Res., 53: 1262-1268, 1993.[Abstract/Free Full Text]
  52. Reeder J. A., Gotley D. C., Walsh M. D., Fawcett J., Antalis T. M. Expression of antisense CD44 variant 6 inhibits colorectal tumor metastasis and tumor growth in a wound environment. Cancer Res., 58: 3719-3726, 1998.[Abstract/Free Full Text]
  53. Zeng C., Toole B. P., Kinney S. D., Kuo J. W., Stamenkovic I. Inhibition of tumor growth in vivo by hyaluronan oligomers. Int. J. Cancer, 77: 396-401, 1998.[Medline]
  54. Monaghan M., Mulligan K. A., Gillespie H., Trimble A., Winter P., Johnston P. G., McCormick D. Epidermal growth factor up-regulates CD44-dependent astrocytoma invasion in vitro. J. Pathol., 192: 519-525, 2000.[Medline]
  55. Richards J. D., Dave S. H., Chou C. H., Mamchak A. A., DeFranco A. L. Inhibition of the MEK/ERK signaling pathway blocks a subset of B cell responses to antigen. J. Immunol., 166: 3855-3864, 2001.[Abstract/Free Full Text]
  56. Weg-Remers S., Ponta H., Herrlich P., Konig H. Regulation of alternative pre-mRNA splicing by the ERK MAP-kinase pathway. EMBO J., 20: 4194-4203, 2001.[Medline]
  57. Maltzman J. S., Carmen J. A., Monroe J. G. Transcriptional regulation of the Icam-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor EGR1. J. Exp. Med., 183: 1747-1759, 1996.[Abstract/Free Full Text]
  58. Fitzgerald K. A., O’Neill L. A. Characterization of CD44 induction by IL-1: a critical role for Egr-1. J. Immunol., 162: 4920-4927, 1999.[Abstract/Free Full Text]
  59. Hebbard L., Steffen A., Zawadzki V., Fieber C., Howells N., Moll J., Ponta H., Hofmann M., Sleeman J. CD44 expression and regulation during mammary gland development and function. J. Cell Sci., 113: 2619-2630, 2000.[Abstract]
  60. Milbrandt J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science, 238: 797-799, 1987.[Abstract/Free Full Text]
  61. Lemaire P., Revelant O., Bravo R., Charnay P. Two mouse genes encoding potential transcription factors with identical DNA-binding domains are activated by growth factors in cultured cells. Proc. Natl. Acad. Sci. USA, 85: 4691-4695, 1988.[Abstract/Free Full Text]
  62. Christy B. A., Lau L. F., Nathans D. A gene activated in mouse 3T3 cells by serum growth factors encodes a protein with "zinc finger" sequences. Proc. Natl. Acad. Sci. USA, 85: 7857-7861, 1988.[Abstract/Free Full Text]
  63. Sukhatme V. P., Kartha S., Toback F. G., Taub R., Hoover R. G., Tsai-Morris C. H. A novel early growth response gene rapidly induced by fibroblast, epithelial cell and lymphocyte mitogens. Oncogene Res., 1: 343-355, 1987.[Medline]
  64. Sukhatme V. P., Cao X. M., Chang L. C., Tsai-Morris C. H., Stamenkovich D., Ferreira P. C., Cohen D. R., Edwards S. A., Shows T. B., Curran T., et al A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell, 53: 37-43, 1988.[Medline]
  65. Lo L. W., Cheng J. J., Chiu J. J., Wung B. S., Liu Y. C., Wang D. L. Endothelial exposure to hypoxia induces Egr-1 expression involving PKCalpha-mediated Ras/Raf-1/ERK1/2 pathway. J. Cell. Physiol., 188: 304-312, 2001.[Medline]
  66. Harada S., Esch G. L., Holgado-Madruga M., Wong A. J. Grb-2-associated binder-1 is involved in insulin-induced egr-1 gene expression through its phosphatidylinositol 3'-kinase binding site. DNA Cell Biol., 20: 223-229, 2001.[Medline]
  67. Yan S. F., Lu J., Zou Y. S., Kisiel W., Mackman N., Leitges M., Steinberg S., Pinsky D., Stern D. Protein kinase C-beta and oxygen deprivation. A novel Egr-1-dependent pathway for fibrin deposition in hypoxemic vasculature. J. Biol. Chem., 275: 11921-11928, 2000.[Abstract/Free Full Text]
  68. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
  69. Andrews N. C., Faller D. V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res., 19: 2499 1991.[Free Full Text]
  70. Recio J. A., Aranda A. Activation of the HIV-1 long terminal repeat by nerve growth factor. J. Biol. Chem., 272: 26807-26810, 1997.[Abstract/Free Full Text]
  71. Wielenga V. J., van der Voort R., Taher T. E., Smit L., Beuling E. A., van Krimpen C., Spaargaren M., Pals S. T. Expression of c-Met and heparan-sulfate proteoglycan forms of CD44 in colorectal cancer. Am. J. Pathol., 157: 1563-1573, 2000.[Abstract/Free Full Text]
  72. Schug J., Overton G. C. . TESS: Transcription Element Search Software. Technical Report CBIL—TR-1997–1001-v0.0 of the Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania 1997.
  73. Taher T. E., van der Voort R., Smit L., Keehnen R. M., Schilder-Tol E. J., Spaargaren M., Pals S. T. Cross-talk between CD44 and c-Met in B cells. Curr. Top. Microbiol. Immunol., 246: 31-37, 1999.[Medline]
  74. Sasaki K., Niitsu N. Elevated serum levels of soluble CD44 variant 6 are correlated with shorter survival in aggressive non-Hodgkin’s lymphoma. Eur. J. Haematol., 65: 195-202, 2000.[Medline]
  75. Rall C. J., Rustgi A. K. CD44 isoform expression in primary and metastatic pancreatic adenocarcinoma. Cancer Res., 55: 1831-1835, 1995.[Abstract/Free Full Text]
  76. Li H., Guo L., Li J. W., Liu N., Qi R., Liu J. Expression of hyaluronan receptors CD44 and RHAMM in stomach cancers: relevance with tumor progression. Int. J. Oncol., 17: 927-932, 2000.[Medline]
  77. Vande Woude G. F., Jeffers M., Cortner J., Alvord G., Tsarfaty I., Resau J. Met-HGF/SF: tumorigenesis, invasion and metastasis. Ciba Found. Symp., 212: 119-130, 1997.[Medline]
  78. Van der Voort R., Taher T. E., Derksen P. W., Spaargaren M., van der Neut R., Pals S. T. The hepatocyte growth factor/Met pathway in development, tumorigenesis, and B-cell differentiation. Adv. Cancer Res., 79: 39-90, 2000.[Medline]
  79. de Juan C., Sanchez A., Nakamura T., Fabregat I., Benito M. Hepatocyte growth factor up-regulates met expression in rat fetal hepatocytes in primary culture. Biochem. Biophys. Res. Commun., 204: 1364-1370, 1994.[Medline]
  80. Chen Q., Seol D. W., Carr B., Zarnegar R. Co-expression and regulation of Met and Ron proto-oncogenes in human hepatocellular carcinoma tissues and cell lines. Hepatology, 26: 59-66, 1997.[Medline]
  81. Seol D. W., Chen Q., Zarnegar R. Transcriptional activation of the hepatocyte growth factor receptor (c-met) gene by its ligand (hepatocyte growth factor) is mediated through AP-1. Oncogene, 19: 1132-1137, 2000.[Medline]
  82. Otsuka T., Jakubczak J., Vieira W., Bottaro D. P., Breckenridge D., Larochelle W. J., Merlino G. Disassociation of met-mediated biological responses in vivo: the natural hepatocyte growth factor/scatter factor splice variant NK2 antagonizes growth but facilitates metastasis. Mol. Cell. Biol., 20: 2055-2065, 2000.[Abstract/Free Full Text]
  83. Turner R., Tjian R. Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers. Science, 243: 1689-1694, 1989.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Pacheco-Rodriguez, W. K. Steagall, D. M. Crooks, L. A. Stevens, H. Hashimoto, S. Li, J.-a. Wang, T. N. Darling, and J. Moss
TSC2 Loss in Lymphangioleiomyomatosis Cells Correlated with Expression of CD44v6, a Molecular Determinant of Metastasis
Cancer Res., November 1, 2007; 67(21): 10573 - 10581.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Beuret, E. Flori, C. Denoyelle, K. Bille, R. Busca, M. Picardo, C. Bertolotto, and R. Ballotti
Up-regulation of MET Expression by {alpha}-Melanocyte-stimulating Hormone and MITF Allows Hepatocyte Growth Factor to Protect Melanocytes and Melanoma Cells from Apoptosis
J. Biol. Chem., May 11, 2007; 282(19): 14140 - 14147.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Lai, R. A. Zeff, and I. Goldschneider
A recombinant single-chain IL-7/HGFbeta hybrid cytokine induces juxtacrine interactions of the IL-7 and HGF (c-Met) receptors and stimulates the proliferation of CFU-S12, CLPs, and pre-pro-B cells
Blood, March 1, 2006; 107(5): 1776 - 1784.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Worden, X. P. Yang, T. L. Lee, L. Bagain, N. T. Yeh, J. G. Cohen, C. Van Waes, and Z. Chen
Hepatocyte Growth Factor/Scatter Factor Differentially Regulates Expression of Proangiogenic Factors through Egr-1 in Head and Neck Squamous Cell Carcinoma
Cancer Res., August 15, 2005; 65(16): 7071 - 7080.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. F. Balkovetz, E. R. Gerrard Jr., S. Li, D. Johnson, J. Lee, J. W. Tobias, K. K. Rogers, R. W. Snyder, and J. H. Lipschutz
Gene expression alterations during HGF-induced dedifferentiation of a renal tubular epithelial cell line (MDCK) using a novel canine DNA microarray
Am J Physiol Renal Physiol, April 1, 2004; 286(4): F702 - F710.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Shinomiya and G. F. Vande Woude
Suppression of Met Expression: A Possible Cancer Treatment: Commentary re: S. J. Kim et al., Reduced c-Met Expression by an Adenovirus Expressing a c-Met Ribozyme Inhibits Tumorigenic Growth and Lymph Node Metastases of PC3-LN4 Prostate Tumor Cells in an Orthotopic Nude Mouse Model. Clin. Cancer Res., 14: 5161-5170, 2003.
Clin. Cancer Res., November 1, 2003; 9(14): 5085 - 5090.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Recio, J. A.
Right arrow Articles by Merlino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Recio, J. A.
Right arrow Articles by Merlino, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online