Cancer Research Aziza Shad EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Claij, N.
Right arrow Articles by te Riele, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Claij, N.
Right arrow Articles by te Riele, H.
[Cancer Research 63, 2062-2066, May 1, 2003]
© 2003 American Association for Cancer Research

Carcinogenesis

DNA Mismatch Repair Deficiency Stimulates N-Ethyl-N-nitrosourea-induced Mutagenesis and Lymphomagenesis1

Nanna Claij, Anja van der Wal, Marleen Dekker, Léon Jansen and Hein te Riele2

Division of Molecular Biology, The Netherlands Cancer Institute, 1066 CX Amsterdam, the Netherlands


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The primary role of the mismatch repair (MMR) system is the avoidance of mutations caused by replication and recombination errors. Furthermore, the lethality of methylating agents has been attributed to the processing of O6-methylguanine lesions in DNA by MMR. Loss of the MSH2 protein completely abolishes repair function and results in reduced cell killing by methylating agents and accelerated accumulation of methylation-damage-induced mutations. This has raised the question as to whether MMR is also involved in the cellular response to other genotoxic insults. Here we describe that in mice deficient for Msh2, lymphomagenesis was strongly accelerated by an ethylating agent, N-ethyl-N-nitrosourea (ENU), given at a dose that did not induce lymphomas in wild-type mice. This suggests that MMR deficiency and ENU-induced mutagenesis synergistically collaborate in inducing tumorigenesis. To study the interaction between MMR and ENU-induced DNA damage, we compared the lethality and mutagenicity of ENU in MSH2-proficient and -deficient mouse embryonic stem cells. Although MSH2-deficiency only slightly reduced the lethality of ENU, it strongly enhanced the mutagenicity of ENU. Mutation analysis of ENU-induced Hprt mutants revealed that base substitutions occurred predominantly at A-T base-pairs. These results suggest that MMR modulates the processing of ethylation damage at AT base-pairs.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The DNA MMR3 system plays an important role in maintaining genomic stability because it corrects mismatches that have escaped the DNA polymerase "proofreading" mechanism during replication. It thereby reduces spontaneous mutagenesis 100-1000-fold (1) . In humans, a defective MMR system results in a high predisposition for cancer, as shown in the HNPCC syndrome, in which the majority of affected individuals have inherited a defective copy of the essential MMR genes hMSH2 or hMLH1 (2) . Accordingly, mice carrying targeted gene disruptions that completely abolish MMR function, show a strong acceleration of tumorigenesis (3, 4, 5, 6, 7) . For example, the majority of Msh2-deficient mice succumb to T-cell lymphomas, whereas mice that survive beyond 30 weeks develop intestinal, sebaceous gland, and endometrial tumors, corresponding to the tumor spectrum of HNPCC and the related Muir-Torre syndrome (6 , 8) .

MMR also plays a role in the response to genotoxic agents. Cell lines deficient for either the MSH2-MSH6 or the MLH1-PMS2 MMR protein complexes are resistant to cell killing (9, 10, 11, 12) but sensitive to mutation induction by methylating drugs (10 , 13) . The toxic and mutagenic lesion produced by these drugs is O6-methylguanine (O6-meG) (14) . Generally, DNA adducts inhibit progression of the replication fork (15) , however, O6-meG lesions have a greater tendency to cause miscoding, creating O6-meG-T mispairs (16) . Two hypotheses have been proposed to explain the MMR-dependent lethality of O6-meG lesions. The first assumes that reiterative, unsuccessful attempts to restore O6-meG-T lesions will finally be lethal (17) . The second hypothesis suggests a role for the MMR system as a general sensor that initiates cell death at high levels of DNA damage (18) . Recently, we showed that the lethality of methylating agents required a threshold level of MSH2 protein. Murine ES cells expressing 10% of wild-type MSH2 protein level (designated MSH2-low- or Msh2low/- ES cells) were evenly tolerant to methylating drugs as were completely MSH2-deficient (Msh2-/-) cells, whereas they had retained almost maximal MMR capacity (19) . Furthermore, MSH2-low cells were highly sensitive to methylating drug-induced mutagenesis (19) .

Although the role of MMR in mediating the cytotoxicity and mutagenicity of methylating drugs is well established (9, 10, 11, 12, 13) , little is known about the role of MMR in the response of cells to other genotoxic insults. In the present report, we demonstrate that lymphomagenesis was strongly accelerated in Msh2-/- mice by exposure to the ethylating agent ENU at a dose that did not affect wild-type mice. This suggests that MMR deficiency could enhance the oncogenic potential of ENU, e.g., by modulating the cellular response to ENU. However, the latter is controversial, because resistance to killing by methylating drugs is not always accompanied by reduced sensitivity to ENU (17 , 20) . Studies in Escherichia coli comparing the mutagenicity of O6-meG and O6-etG residues in several repair-deficient strains revealed that the MMR system was involved only in O6-meG-induced mutagenesis (15) . Which other repair processes are involved in the processing of ethyl-DNA adducts in mammalian systems remains elusive, with some reports suggesting a role for nucleotide excision repair (21 , 22) or O6-alkylguanine alkyltransferase (AGT) (21) and others contradicting this (23, 24, 25) .

In the present study, we examined the role of MMR in the toxicity and mutagenicity of ENU in ES cells. We demonstrate that Msh2-deficient- and MSH2-low ES cells were only slightly more resistant to the toxic effects of ENU but highly sensitive to ENU-induced mutagenesis. Furthermore, we show that A-T base pairs are the predominant targets of ENU-induced mutagenesis under fully or partially MMR-deficient conditions.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Treatment of Mice with ENU.
Msh2+/- mice (F1 of 129OLA and FVB) were intercrossed, and pregnant mice received a single dose of ENU (10 mg/kg) 1 or 2 days before delivery. ENU was dissolved in citrate buffer (pH 6.0; 4 mg/ml) directly before i.p. injection into the mice. When moribund, mice were sacrificed and necropsied. Tumors and tissues were fixed in 4% formaldehyde in PBS and subsequently embedded in paraffin blocks. H&E-stained sections were examined by a pathologist.

Cell Lines.
Msh2-/- ES cells were generated previously by introducing a hygromycin resistance marker into the unique SnaBI site located in exon 12 of the Msh2 gene (3) . The Msh2low/- cells were generated from Msh2-/- cells by replacing the hygromycin resistance marker by the 3' half of the cDNA of the mouse Msh2 gene from exon 12 to the end of the gene, thereby restoring the Msh2 gene (19) . Msh2low/- cells were shown to express only 10% of wild-type MSH2 protein level (19) . Although Msh2low/- cells have almost full repair capacity, they are tolerant to methylating drugs (19) .

Cytotoxicity Assays.
Msh2+/+, Msh2-/-, and Msh2low/- ES cells were seeded onto feeder layers of irradiated mouse embryonic fibroblasts at a density of 500 cells per 2 cm2. The next day, the cells were exposed for 1 h to 0–40 µM MNNG or 0–2.5 mM ENU (purchased from Serva, Heidelberg, Germany), and after 4 days, the number of surviving colonies was counted. A 20-mM stock of MNNG in DMSO was stored at -20°C. ENU was dissolved in DMSO (100 mg/ml) and further diluted in culture medium to a stock solution of 125 mM immediately before use. To deplete AGT activity, during the whole procedure from 1 h before exposure to MNNG or ENU, cells were cultured in the presence of 20 µM O6-benzylguanine (kindly provided by Dr. R. Moschel, Frederick Cancer Research and Development Center, Frederick, MD). Experiments were performed at least three times.

Mutagenicity of ENU.
Msh2+/+, Msh2-/-, and Msh2low/- ES cells were seeded onto gelatin-coated tissue culture plates at a density of 2 x 106 cells per 57 cm2. The next day, the cells were exposed for 1 h to 2.5 mM ENU in the presence or absence of 20 µM O6-benzylguanine. If necessary, cells were passaged once after 3 days. Six days after ENU exposure, surviving cells were counted and plated at a density of 1 x 106 cells per 160 cm2. The following day, 6-thioguanine was added to the medium at a concentration of 10 µg/ml. After 2 weeks, the number of 6-thioguanine-resistant colonies was counted.

RNA Extraction and cDNA Synthesis.
6-Thioguanine-resistant colonies were picked and expanded to ~1 x 106 cells. For RNA isolation, the cells were lysed in 1 ml of TRIzol (Life Technologies, Inc.), and RNA was extracted according to the protocol provided by the manufacturer. RNA was resuspended in 25 µl of MiliQ water. RNA (500 ng) and 2 pmol of Hprt-cDNA primer (GCAGCAACTGACATTTCTAAA) in a total volume of 13 µl were incubated at 70°C for 10 min and quickly chilled on ice to allow annealing of the primer to the Hprt mRNA strand. For cDNA synthesis, 2.5 µl of dNTP mix (10 mM), 26.4 units of RNAguard (Amersham Pharmacia), 5 µl of 5x first-strand buffer (Life Technologies, Inc.), 2.5 µl of 100 mM DTT, and 200 units Murine Leukemia Virus Reverse Transcriptase (Life Technologies, Inc.) were added. After 10 min at room temperature, the reaction mixture was incubated at 37°C for 1 h. MiliQ water (50 µl) was added and the reaction was heated at 70°C for 15 min to inactivate the reaction.

PCR Amplification of Hprt cDNA and Sequence Analysis.
PCR amplification was performed as described by Wijnhoven et al. (26) . Three µl of synthesized cDNA was used for the first round of amplification with the PCR primers HPRT.1-forward (GGCTTCCTCCTCAGACCGT) and HPRT.1-reverse (AAAAAGCTTTACTAGGCAGATGG). Reamplification was performed in a second round of PCR with the primers HPRT.2-forward (TTTTTGCCGCGAGCCGACC) and HPRT.2-reverse (CAGATTCAACTTGCGCTC). The reamplified product was diluted 10 times, and 1 µl was subsequently subjected to sequence analysis by using HPRT.2-forward or HPRT.2-reverse as a primer.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
MMR Deficiency and Exposure to ENU Collaborate in Lymphomagenesis.
ENU is known as a potent mutagen, rapidly inducing tumors in mice. As we have previously shown (8) , a single prenatally administered dose of ENU at a concentration of 40 mg/kg body weight, induced lymphomas in 25% of wild-type animals between 13 and 27 weeks of age (Fig. 1Citation ; Table 1Citation ). In contrast, a more dramatic effect of ENU was seen in mice lacking the MMR protein MSH2: whereas 60% of these mice spontaneously developed lymphomas between 8 and 30 weeks of age, ENU exposure induced lymphomas in 85% (Table 1)Citation of Msh2-/- mice within 15 weeks (Fig. 1Citation ; Ref. 8 ). In the present study, we show that the strong cooperation between MMR deficiency and ENU exposure became even more apparent at a lower dose of ENU (10 mg/kg body weight). This dose did not affect the survival in wild-type animals (Fig. 1)Citation , although the incidence of lung and liver tumors was increased (Table 1)Citation . In Msh2-/- mice, it accelerated lymphomagenesis (Table 1)Citation almost as effectively as the higher dose (Fig. 1)Citation . These observations suggest that MMR deficiency enhances the oncogenic potential of ENU.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Tumorigenesis is accelerated in Msh2-/- mice exposed to a low dose of ENU. Msh2+/+ (———/squares) and Msh2-/- mice (bold line/circles) were exposed prenatally to a single dose of ENU [10 mg/kg (open symbols) or 40 mg/kg (filled symbols)]. Animals were sacrificed when moribund. Data of untreated and 40-mg/kg-ENU-treated mice were taken from de Wind et al. (8) .

 

View this table:
[in this window]
[in a new window]

  		Table 1 ENU-induced tumorigenesis at 0, 10, and 40 mg/kg ENU in Msh2+/+ and Msh2-/- mice

 
Effect of MSH2 on the Toxicity of ENU.
The enhanced oncogenicity of ENU in Msh2-deficient mice may indicate that MMR not only plays a role in the processing of DNA damage inflicted by methylating agents, but also by ethylating agents. We previously showed MSH2-deficient ES cells to exhibit a 100-fold tolerance to methylating agents like MNNG, streptozocin, and temozolomide (19) in clonogenic survival assays. As shown in Fig. 2aCitation , the toxicity of MNNG in wild-type cells was observed only when the activity of AGT, which removes alkyl groups from the O6-position of guanine, was inhibited by O6-benzylguanine. This confirms that O6-methylguanine is the critical lesion responsible for the toxicity of MNNG (14) . Furthermore, we previously found that ES cells expressing the MSH2 protein at 10% of the wild-type level (MSH2-low or Msh2low/- cells) were evenly tolerant to methylating drugs as were fully MSH2-deficient cells, indicating that the lethal processing of O6-methylguanine lesions requires a certain threshold level of MSH2 protein (19) .



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Contribution of O6-guanine alkylation to the toxicity of MNNG and ENU. Msh2+/+ (squares), Msh2-/- (circles), and Msh2low/- (diamonds) ES cell lines were exposed for 1 h to increasing amounts of MNNG (a) or ENU (b) in the presence (closed symbols) or absence (open symbols) of O6-benzylguanine. After 4 days, the number of surviving colonies was counted.

 
To determine whether the MMR system is similarly involved in the toxicity of the ethylating agent ENU, we performed a clonogenic survival assay. The difference in response to treatment with ENU between wild-type and Msh2-deficient cells was not as obvious as observed for methylating agents; however, we could reproducibly detect a 2–4-fold enhanced resistance of Msh2-/- and Msh2low/- ES cells (Fig. 2b)Citation . The increased toxicity of ENU in wild-type cells is most likely mediated by the MSH2-MSH6 complex, because Msh6-deficient cells showed a response to ENU that was similar to that of Msh2-deficient cells, whereas Msh3-deficient cells behaved like wild-type cells (data not shown). AGT inhibition only modestly influenced the toxicity of ENU; and, more importantly, enhanced toxicity was seen in both MMR-proficient and MMR-deficient cells (Fig. 2b)Citation . This suggests that O6-etG lesions do contribute to the toxicity of ENU, but that these lesions, unlike O6-methylguanine lesions, are not processed by MMR activity.

Enhanced Mutagenicity of ENU in Msh2-/- and Msh2low/- Cells.
We and others have previously shown that loss (or strongly reduced level) of MSH2 reduces the toxicity of methylating agents but, at the same time, strongly enhances their mutagenicity (9, 10, 11, 12, 13 , 19) . Because the influence of the MSH2 protein on the toxic effects of ENU was only marginal, we determined whether the MMR status of cells would still affect mutation induction by ENU. Msh2+/+, Msh2-/-, and Msh2low/- ES cell cultures were treated with ENU, and the frequency of ENU-induced Hprt mutants was determined by selecting for the appearance of 6-thioguanine-resistant colonies. In Msh2+/+ cells, hardly any spontaneous mutants were detected, whereas the spontaneous mutation frequency in Msh2-/- cells was at least 100-fold higher (Table 2)Citation . Treatment with 2.5 mM ENU induced very few Hprt mutants in wild-type cells. However, the same dose of ENU resulted in a large increase of Hprt mutants in Msh2-deficient cells. Msh2low/- cells have largely retained the capacity to restore replication and recombination errors, which enables them to keep the spontaneous mutation frequency low. However, mutations in the Hprt gene could readily be induced by ENU, although the number of extra ENU-induced mutants was lower than in Msh2-deficient cells. These results demonstrate that reduced or fully ablated MSH2 expression strongly enhances the mutagenicity of ENU. Strikingly, the inhibition of AGT activity did not sensitize cells to the mutagenic effects of ENU, which suggests that DNA lesions other than O6-ethylguanine are involved.


View this table:
[in this window]
[in a new window]

  		Table 2 ENU-induced mutagenesis at the Hprt gene

 
Mutation Spectrum of ENU in Msh2-low Cells.
We next determined the spectrum of ENU-induced mutations stimulated by MSH2-deficiency. According to Table 2Citation , 25–50% of the Hprt mutants found after ENU treatment of Msh2-/- cells is accounted for by spontaneous mutants. Therefore, in Msh2-/- cells, we cannot discriminate between spontaneous and ENU-induced mutations. To avoid ambiguous interpretation of the spectrum of ENU-induced mutations, we made use of MSH2-low cells. Table 2Citation shows that the spontaneous mutation frequency in MSH2-low cells and the ENU-induced mutation frequency in wild-type cells was low. Therefore, virtually all 6-thioguanine-resistant colonies that arose after ENU treatment of MSH2-low cells represented mutants induced by the combination of a defect in MMR and exposure to ENU. Hprt mutations were determined in six spontaneously arisen 6-thioguanine-resistant colonies (untreated) and 41 ENU-induced mutants, of which 18 were obtained in the absence and 23 in the presence of O6-benzylguanine. Of the spontaneous Hprt mutants, five showed the deletion of exon 8, and one had an insertion of a G at position 490. The same frame-shift mutation was observed once among the ENU-treated mutants. Of the Hprt mutants induced by ENU, 35% were the result of complete exon deletions and probably reflect mutations that caused aberrant splicing of Hprt mRNAs. The remaining 65% of the ENU-induced mutants showed single base-pair substitutions, all resulting in amino acid changes (Table 3)Citation . G-C to A-T transitions were present at only a low frequency, which was not increased by the inhibition of AGT activity, suggesting that ethylation at the O6-position of guanine is of minor importance in ENU-induced mutagenesis. The most frequently induced base-pair alterations by ENU affected A-T base pairs, with A-T to T-A and A-T to G-C being the predominant type of mutation. This result indicates that MMR-deficiency specifically stimulates ENU-induced alterations of A-T base pairs.


View this table:
[in this window]
[in a new window]

  		Table 3 Spectrum of Hprt gene mutations induced by ENU in Msh2-low cells

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Numerous experiments have established a critical role of the mammalian MMR system in the toxicity and mutagenicity of methylating agents by virtue of its capacity to recognize and process O6-methylguanine lesions. This has raised the question as to whether MMR is also involved in the response of cells to other genotoxic insults. To address this question, we have compared the toxicity, mutagenicity, and carcinogenicity of ENU under MMR-proficient and -deficient conditions. Our observations indicate that MMR activity, indeed, modulates the response of cells to ENU and that the critical lesion is not O6-etG but damaged A-T base pairs. First, in clonogenic survival assays, we found that MMR activity enhances the toxicity of ENU, although the effect is only modest when compared with the MMR-dependence of methylation-damage-induced cell death. Secondly, the inhibition of AGT activity by culturing the cells in the presence of O6-benzylguanine only slightly sensitized ES cells to the toxic effects of ENU; however, the toxicity was increased to a similar extent in both Msh2+/+ and Msh2-/- cell lines. This result suggests that O6-etG lesions do contribute to the toxicity of ENU, albeit to a moderate extent and independent of MMR activity. This is consistent with earlier observations indicating that, unlike O6-methylguanine, O6-etG lesions are only poorly replicated and, therefore, are rarely targets of post-replicative MMR (15) . Thirdly, analyzing the spectrum of mutations induced by the combination of exposure to ENU and reduced MSH2 protein level, we identified AT base pairs as the predominant targets of mutagenesis. This is consistent with earlier reports demonstrating that in mammalian cells O2-ethylthymineT (O2-etT) and O4-ethylthymine (O4-etT) lesions contribute considerably to mutagenesis (27) . Although the replicative bypass of ethylated bases is inefficient, ethylated bases have been shown to direct the misincorporation of bases when DNA polymerases succeed in translesion synthesis (28 , 29) . Bypass of O2-etT subsequently induces A-T to T-A transversions, whereas O4-etT causes A-T to G-C transitions (28 , 29) . Both types of mutations appeared in ENU-exposed MSH2-low cells. Indeed, the number and type of mutations were not significantly changed by the inhibition of AGT activity, indicating that O6-etG lesions did not play a prominent role in mutagenesis. This is again consistent with inefficient bypass replication of this lesion.

Our results indicate that several types of DNA damage contribute to the toxicity and mutagenicity of ENU. One of these, O6-etG, contributes to toxicity but not to mutagenicity, and its effect is not modulated by the MMR machinery. Two others, O2-etT and O4-etT, are likely precursors of mutations altering A-T base pairs. We speculate that the replicative bypass of O2-etT and O4-etT lesions is counteracted by MMR activity, thereby suppressing misincorporation of bases and subsequent mutagenesis. The inhibition of the replicative bypass by MMR may also contribute to cell death, explaining the reduced toxicity of ENU under conditions of reduced or fully abrogated MMR capacity. However, our observations do not provide direct proof for this hypothesis, and additional experiments are required to examine the binding capacity of MMR proteins to ethylated thymines. In this respect, it is worth mentioning that specific binding of the human MSH2-MSH6 complex to oligonucleotides containing an O4-meT-A base pairs has been observed (30) .

The enhanced mutagenicity of ENU in the absence of (full) MMR capacity in vitro provides an explanation for the enhanced oncogenicity of ENU in Msh2-deficient mice. Additional experiments are required to establish whether MMR deficiency also synergistically enhances the carcinogenicity of other DNA-damaging agents. Furthermore, we showed that sensitivity to ENU-induced mutagenesis was strongly enhanced in MMR-proficient cells expressing low levels of MSH2 protein. This raises the possibility that reduced levels of MSH2 expression may already enhance the oncogenicity of DNA-damaging compounds. We are currently testing this hypothesis by determining the sensitivity of Msh2low/- mice to ENU-induced tumorigenesis.


   ACKNOWLEDGMENTS
 
We thank the members of the animal facility of the Netherlands Cancer Institute for biotechnical assistance and Martin van der Valk for histological examination. We thank Meindert Lamers, Titia Sixma, Marjolein Sonneveld, and Piet Borst for comments on the manuscript.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Dutch Cancer Society (Grant NKI 98-1838) and the Commission of the European Community (Grant ENV4-CT97-0469). Back

2 To whom requests for reprints should be addressed, at Division of Molecular Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, the Netherlands. Phone: 31-20-5122084; Fax: 31-20-5122086; E-mail: h.t.riele{at}nki.nl Back

3 The abbreviations used are: MMR, mismatch repair; HNPCC, hereditary nonpolyposis colorectal cancer; ENU, N-ethyl-N-nitrosourea; MNNG, N-methyl-N'-nitro-N-nitrosoguanidine; AGT, O6-alkylguanine alkyltransferase; HPRT, hypoxanthine-guanine phosphoribosyl transferase; ES, embryonic stem; O6-etG, O6-ethylguanine; O4-etT, O4-ethylthymine; O2-etT, O2-ethylthymine; O6-meG, O6-methylguanine. Back

Received 8/14/02. Accepted 3/ 5/03.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Modrich P., Lahue R. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem., 65: 101-133, 1996.[Medline]
  2. Peltomaki P., Vasen H. F. Mutations predisposing to hereditary nonpolyposis colorectal cancer: database and results of a collaborative study. The International Collaborative Group on Hereditary Nonpolyposis Colorectal Cancer. Gastroenterology, 113: 1146-1158, 1997.[Medline]
  3. de Wind N., Dekker M., Berns A., Radman M., te Riele H. Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination, and predisposition to cancer. Cell, 82: 321-330, 1995.[Medline]
  4. Prolla T. A., Baker S. M., Harris A. C., Tsao J. L., Yao X., Bronner C. E., Zheng B., Gordon M., Reneker J., Arnheim N., Shibata D., Bradley A., Liskay R. M. Tumour susceptibility and spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch repair. Nat. Genet., 18: 276-279, 1998.[Medline]
  5. Reitmair A. H., Schmits R., Ewel A., Bapat B., Redston M., Mitri A., Waterhouse P., Mittrucker H. W., Wakeham A., Liu B., Thomason A., Griesser H., Gallinger S., Ballhausen W. G., Fishel R., Mak T. W. MSH2 deficient mice are viable and susceptible to lymphoid tumours. Nat. Genet., 11: 64-70, 1995.[Medline]
  6. Reitmair A. H., Redston M., Cai J. C., Chuang T. C., Bjerknes M., Cheng H., Hay K., Gallinger S., Bapat B., Mak T. W. Spontaneous intestinal carcinomas and skin neoplasms in Msh2-deficient mice. Cancer Res., 56: 3842-3849, 1996.[Abstract/Free Full Text]
  7. Baker S. M., Bronner C. E., Zhang L., Plug A. W., Robatzek M., Warren G., Elliott E. A., Yu J., Ashley T., Arnheim N., Flavell R. A., Liskay R. M. Male mice defective in the DNA mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis. Cell, 82: 309-319, 1995.[Medline]
  8. de Wind N., Dekker M., van Rossum A., van der Valk M., te Riele H. Mouse models for hereditary nonpolyposis colorectal cancer. Cancer Res., 58: 248-255, 1998.[Abstract/Free Full Text]
  9. Koi M., Umar A., Chauhan D. P., Cherian S. P., Carethers J. M., Kunkel T. A., Boland C. R. Human chromosome 3 corrects mismatch repair deficiency and microsatellite instability and reduces N-methyl-N'-nitro-N-nitrosoguanidine tolerance in colon tumor cells with homozygous hMLH1 mutation. Cancer Res., 54: 4308-4312, 1994.[Abstract/Free Full Text]
  10. Umar A., Koi M., Risinger J. I., Glaab W. E., Tindall K. R., Kolodner R. D., Boland C. R., Barrett J. C., Kunkel T. A. Correction of hypermutability. N-methyl-N'-nitro-N-nitrosoguanidine resistance, and defective DNA mismatch repair by introducing chromosome 2 into human tumor cells with mutations in MSH2 and MSH6. Cancer Res., 57: 3949-3955, 1997.[Abstract/Free Full Text]
  11. Risinger J. I., Umar A., Barrett J. C., Kunkel T. A. A hPMS2 mutant cell line is defective in strand-specific mismatch repair. J. Biol. Chem., 270: 18183-18186, 1995.[Abstract/Free Full Text]
  12. de Wind N., Dekker M., Claij N., Jansen L., van Klink Y., Radman M., Riggins G., van der Valk M., van’t Wout. K., te Riele H. HNPCC-like cancer predisposition in mice through simultaneous loss of Msh3 and Msh6 mismatch-repair protein functions. Nat. Genet., 23: 359-362, 1999.[Medline]
  13. Zhu W., Yamasaki H., Mironov N. Frequency of HPRT gene mutations induced by N-methyl-N'-nitro-N-nitrosoguanidine corresponds to replication error phenotypes of cell lines. Mutat. Res., 398: 93-99, 1998.[Medline]
  14. Loveless A. Possible relevance of O6-alkylation of deoxyguanosine to mutagenicity and carcinogenicity of nitrosamines and nitrosamides. Nature (Lond.), 223: 206-207, 1969.[Medline]
  15. Pauly G. T., Hughes S. H., Moschel R. C. Comparison of mutagenesis by O6-methyl- and O6-ethylguanine and O4-methylthymine in Escherichia coli using double-stranded and gapped plasmids. Carcinogenesis (Lond.), 19: 457-461, 1998.[Abstract/Free Full Text]
  16. Swann P. F. Why do O6-alkylguanine and O4-alkylthymine miscode? The relationship between the structure of DNA containing O6-alkylguanine and O4-alkylthymine and the mutagenic properties of these bases. Mutat. Res., 233: 81-94, 1990.[Medline]
  17. Karran P., Bignami M. Self-destruction and tolerance in resistance of mammalian cells to alkylation damage. Nucleic Acids Res., 20: 2933-2940, 1992.[Free Full Text]
  18. Fishel R. Signaling mismatch repair in cancer. Nat. Med., 5: 1239-1241, 1999.[Medline]
  19. Claij N., te Riele H. Methylation tolerance in mismatch repair proficient cells with low MSH2 protein level. Oncogene, 21: 2873-2879, 2002.[Medline]
  20. Goth-Goldstein R., Hughes M. Characterization of a CHO variant in respect to alkylating agent-induced biological effects and DNA repair. Mutat. Res., 184: 139-146, 1987.[Medline]
  21. Bronstein S. M., Cochrane J. E., Craft T. R., Swenberg J. A., Skopek T. R. Toxicity, mutagenicity, and mutational spectra of N-ethyl-N-nitrosourea in human cell lines with different DNA repair phenotypes. Cancer Res., 51: 5188-5197, 1991.[Abstract/Free Full Text]
  22. Wu Z. N., Chan C. L., Eastman A., Bresnick E. Expression of human O6-methylguanine-DNA methyltransferase in a DNA excision repair-deficient Chinese hamster ovary cell line and its response to certain alkylating agents. Cancer Res., 52: 32-35, 1992.[Abstract/Free Full Text]
  23. Bobola M. S., Blank A., Berger M. S., Silber J. R. Contribution of O6-methylguanine-DNA methyltransferase to monofunctional alkylating-agent resistance in human brain tumor-derived cell lines. Mol. Carcinog., 13: 70-80, 1995.[Medline]
  24. Kaina B., Fritz G., Mitra S., Coquerelle T. Transfection and expression of human O6-methylguanine-DNA methyltransferase (MGMT) cDNA in Chinese hamster cells: the role of MGMT in protection against the genotoxic effects of alkylating agents. Carcinogenesis (Lond.), 12: 1857-1867, 1991.[Abstract/Free Full Text]
  25. Op het Veld C. W., Hees-Stuivenberg S., van Zeeland A. A., Jansen J. G. Effect of nucleotide excision repair on hprt gene mutations in rodent cells exposed to DNA ethylating agents. Mutagenesis, 12: 417-424, 1997.[Abstract/Free Full Text]
  26. Wijnhoven S. W., Kool H. J., van Oostrom C. T., Beems R. B., Mullenders L. H., van Zeeland A. A., van der Horst G. T., Vrieling H., van Steeg H. The relationship between benzo[a]pyrene-induced mutagenesis and carcinogenesis in repair-deficient Cockayne syndrome group B mice. Cancer Res., 60: 5681-5687, 2000.[Abstract/Free Full Text]
  27. Jansen J. G., Mohn G. R., Vrieling H., van Teijlingen C. M., Lohman P. H., van Zeeland A. A. Molecular analysis of hprt gene mutations in skin fibroblasts of rats exposed in vivo to N-methyl-N-nitrosourea or N-ethyl-N-nitrosourea. Cancer Res., 54: 2478-2485, 1994.[Abstract/Free Full Text]
  28. Klein J. C., Bleeker M. J., Lutgerink J. T., van Dijk W. J., Brugghe H. F., van den Elst H., van der Marel G. A., van Boom J. H., Westra J. G., Berns A. J., Kriek E. Use of shuttle vectors to study the molecular processing of defined carcinogen-induced DNA damage: mutagenicity of single O4-ethylthymine adducts in HeLa cells. Nucleic Acids Res., 18: 4131-4137, 1990.[Abstract/Free Full Text]
  29. Bhanot O. S., Grevatt P. C., Donahue J. M., Gabrielides C. N., Solomon J. J. In vitro DNA replication implicates O2-ethyldeoxythymidine in transversion mutagenesis by ethylating agents. Nucleic Acids Res., 20: 587-594, 1992.[Abstract/Free Full Text]
  30. Duckett D. R., Drummond J. T., Murchie A. I., Reardon J. T., Sancar A., Lilley D. M., Modrich P. Human MutS{alpha} recognizes damaged DNA base pairs containing O6-methylguanine. O4-methylthymine, or the cisplatin-d(GpG) adduct. Proc. Natl. Acad. Sci. USA, 93: 6443-6447, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Lab AnimHome page
A P L Smith, S Polley, S Wells, M Stewart, L Vizor, J Humphreys, M V Warren, N Dear, and M T Cheeseman
Analysis of breeding and pathology helps refine management practices of a large-scale N'-ethyl-N'-nitrosourea mouse mutagenesis programme
Lab Anim, January 1, 2009; 43(1): 1 - 10.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
H. Feitsma, A. Akay, and E. Cuppen
Alkylation damage causes MMR-dependent chromosomal instability in vertebrate embryos
Nucleic Acids Res., July 1, 2008; 36(12): 4047 - 4056.
[Abstract] [Full Text] [PDF]

Home page
 MutagenesisHome page
H. Feitsma, E. de Bruijn, J. van de Belt, I. J. Nijman, and E. Cuppen
Mismatch repair deficiency does not enhance ENU mutagenesis in the zebrafish germ line
Mutagenesis, July 1, 2008; 23(4): 325 - 329.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
R. van Boxtel, P. W. Toonen, H. S. van Roekel, M. Verheul, B. M. G. Smits, J. Korving, A. de Bruin, and E. Cuppen
Lack of DNA mismatch repair protein MSH6 in the rat results in hereditary non-polyposis colorectal cancer-like tumorigenesis
Carcinogenesis, June 1, 2008; 29(6): 1290 - 1297.
[Abstract] [Full Text] [PDF]

Home page
 Arch Intern MedHome page
P. Watson, R. Ashwathnarayan, H. T. Lynch, and H. K. Roy
Tobacco Use and Increased Colorectal Cancer Risk in Patients With Hereditary Nonpolyposis Colorectal Cancer (Lynch Syndrome)
Arch Intern Med, December 13, 2004; 164(22): 2429 - 2431.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
J. Wu, B.-B. Zhu, J. Yu, H. Zhu, L. Qiu, M. S. Kindy, L. Gu, A. Seidel, and G.-M. Li
In vitro and in vivo modulations of benzo[c]phenanthrene-DNA adducts by DNA mismatch repair system
Nucleic Acids Res., November 15, 2003; 31(22): 6428 - 6434.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Claij, N.
Right arrow Articles by te Riele, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Claij, N.
Right arrow Articles by te Riele, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online