Cancer Research Annual Meeting 2010  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, L.
Right arrow Articles by Jablons, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, L.
Right arrow Articles by Jablons, D. M.
[Cancer Research 64, 3474-3478, May 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Inhibition of Wnt-1 Signaling Induces Apoptosis in ß-Catenin-Deficient Mesothelioma Cells

Liang You, Biao He, Kazutsugu Uematsu, Zhidong Xu, Julien Mazieres, Amie Lee, Frank McCormick and David M. Jablons

Thoracic Oncology Laboratory, Department of Surgery, Comprehensive Cancer Center, University of California, San Francisco, California


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
It is known that Wnt-1 signaling inhibits apoptosis by activating ß-catenin/tcf-mediated transcription. Here, we show that blocking Wnt-1 signaling in ß-catenin-deficient mesothelioma cell lines H28 and MS-1 induces apoptotic cell death. Both Wnt-1 small interfering RNA (siRNA) and Dishevelled siRNA induced significant apoptosis in these cell lines. A small molecule inhibitor of c-Jun NH2-terminal kinase inhibited the apoptotic cell killing induced by either Wnt-1 siRNA or Dishevelled siRNA in these cells. Our data suggest that ß-catenin-independent noncanonical pathway(s), i.e., Wnt/JNK pathway, may play a role in the apoptotic inhibition caused by Wnt-1 signaling.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Wnt ligand binds directly to its receptor Frizzled (Fz), and this binding activates canonical and noncanonical pathways (1 , 2) . The activation of the canonical pathway leads to signal transduction through Dishevelled (Dvl) and results in ß-catenin stabilization and accumulation in the cytoplasm. ß-Catenin translocates into the nucleus and binds to Tcf/Lef transcription factors to make a heterodimeric complex that activates the transcription of Wnt target genes, e.g., c-myc and cyclin D1 (3, 4, 5, 6) . ß-Catenin is a key mediator of the Wnt signal. Noncanonical pathways, referred as Wnt signaling pathways that signal independently of ß-catenin, may signal through calcium flux, c-Jun NH2-terminal kinase (JNK), and G proteins (7) .

Wnt-1 was originally described as a proto-oncogene in mouse mammary tumor induced by mouse mammary tumor virus (8) . Recently, it has been shown that Wnt-1/ß-catenin signaling promotes cell survival in various cell types (9, 10, 11) . For instance, Chen et al. (10) have recently shown that Wnt-1 signaling inhibits apoptosis through ß-catenin and that cells expressing Wnt-1 resist apoptosis induction by chemotherapy. In addition, c-Myc was identified as one of the transcriptional targets of ß-catenin/Tcf in colorectal cancer cells (5) , suggesting that Wnt signaling functions in oncogenesis, in part, is through the growth promoting activity of c-Myc (12) . At least two classes of Wnt antagonists have been reported and both classes of molecules prevent ligand-receptor interactions. The first class, including secreted Frizzled-related proteins family and Wnt inhibitory factor-1, binds directly to Wnt ligand. The second class, including Dickkopf family, binds to a low-density lipoprotein-receptor-related protein 6, a subunit of Wnt receptor complex (13) . Down-regulation of ß-catenin levels by secreted Frizzled-related proteins and Dickkopf-1 sensitize cells to proapoptotic stimuli (14) .

To date, ß-catenin-independent mechanism(s) have not been linked with the apoptotic inhibition caused by Wnt-1 signaling. We have recently shown evidence of Wnt pathway activation through Dvl overexpression in both human lung cancer and mesothelioma (15 , 16) . Moreover, we have found that Wnt-1 is expressed in many human cancer cell lines and tissues, and we have also demonstrated that blockade of Wnt-1 signaling [by Wnt-1 small interfering (si)RNA or a Wnt-1-targeted monoclonal antibody] induces apoptosis in some human cancer cells (17) . This apoptotic induction should be ß-catenin/Tcf-dependent based on the antiapoptosis mechanism proposed for Wnt-1 signaling (10 , 12) . On the basis of our recent findings, however, we hypothesized that Wnt noncanonical pathway(s) (e.g., Wnt/JNK pathway) may play a role in the apoptosis inhibition caused by Wnt-1 signaling.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cell Lines and Tissue Samples.
Human non-small cell lung cancer cell line NCI-H1703 and human mesothelioma cancer cell line H28 were from American Type Culture Collections (Manassas, VA). Human mesothelioma cancer cell line MS-1 was from NIH. These cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, penicillin (100 IU/ml), and streptomycin (100 µg/ml). All cells were cultured at 37°C in a humid incubator with 5% CO2.

RNA Interference.
Cells were plated into a 6-well plate with fresh media without antibiotics 24 h before testing. The ion-exchange high-performance liquid chromatography-purified siRNAs (Wnt-1 siRNA, Dvl siRNA, and nonsilencing siRNA control, >97% pure) were purchased from Qiagen-Xeragon (Germantown, MD). The siRNA-targeted both human Wnt-1 are derived from a mRNA sequence (GGTTCCATCGAATCCTGCA) of human Wnt-1. The siRNA-targeted both human Dvl-1 and Dvl-3 are derived from an mRNA sequence (AACAAGATCACCTTCTCCGAG) of human Dvl-3, which is identical in that of human Dvl-1, and the one targeted human Dvl-2 is derived from a mRNA sequence (AACTTTGAGAACATGAGCAAC) of human Dvl-2 (18) . The siRNA-targeted human JNK1 are derived from a mRNA sequence CGTGGATTTATGGTCTGTG of human JNK1, and the siRNA-targeted human JNK2 was purchased from Upstate-Dharmacon (Charlottesville, VA). The control (nonsilencing) siRNA was purchased from Qiagen-Xeragon, and it does not target any known mammalian gene (the targeted sequence is AATTCTCCGAACGTGTCACGT). The lyophilized siRNAs were dissolved in annealing buffer and reheated to 95°C for 1 min followed by 1 h at 37°C incubation. siRNA transfection was performed according to the manufacturer’s protocol. After siRNA transfection, incubate plates for 3–5 days at 37°C before additional analysis.

Antibody Incubation with Cells.
The anti-Wnt-1 mouse monoclonal antibody (IgG1) was custom-made (17) at Rockland, Inc. (Gilbertsville, PA). Cells were plated in 6-well plates or 10-cm dishes 1 day before experiments. Then normal media were replaced by media containing antibodies various concentrations, and the cells were incubated at 37°C in a humid incubator with 5% CO2. At various time points, the cells were collected using standard protocols for additional analysis.

Western Blotting.
Standard protocol was used. Anti-Dvl3 and anti-survivin antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-caspase3 antibody was from Oncogene (Cambridge, MA). Anti-ß-actin antibody was obtained from Cell Signaling Technology, Inc. (Beverly, MA). Anti-ß-catenin antibody was purchased from Transduction Laboratories (Lexington, KY). Anti-Active-JNK antibody was from Promega (Madison, WI). Anti-JNK antibody was from purchased from Upstate-Dharmacon. Anti-cytochrome c antibody was from BD Biosciences (San Diego, CA). For detecting alteration of ß-catenin, cytosolic extracts were prepared and examined as described previously (16) .

Apoptosis Analysis.
Cells were harvested by trypsinization and stained using an Annexin V FITC Apoptosis Detection kit (Oncogene, Cambridge, MA), according to the manufacture’s protocol. Then stained cells were immediately analyzed by flow cytometry (FACScan; Becton Dickinson, Franklin Lake, NJ). Early apoptotic cells with exposed phosphatidylserine but intact cell membranes bound to Annexin V-FITC but excluded propidium iodide. Cells in necrotic or late apoptotic stages were labeled with both Annexin V-FITC and propidium iodide.

TOPFLASH Assay.
Cells were plated in 6-well plates. The TOPFLASH or FOPFLASH reporter plasmid was transfected transiently into cells as described previously (16) . Tcf-mediated gene transcription was determined by the ratio of pTOPFLASH:pFOPFLASH luciferase activity, and each was normalized to luciferase activities of the pRL-TK reporter (cotransfected internal control). All experiments were performed in triplicate.


    RESULTS AND DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
To test our hypothesis that ß-catenin is not essential for Wnt-1-induced apoptosis inhibition, the mesothelioma cell line H28, containing a homozygous deletion of the ß-catenin gene, was chosen for this study (19) . A non-small cell lung cancer cell line H1703 (16) and another mesothelioma cell line MS-1 (20) were also used for control experiments. All these cell lines were found to express Wnt-1 protein by Western blot analysis. The homozygous deletion of ß-catenin in H28 cell line was confirmed by Southern blot analysis, and lack of ß-catenin expression was validated using Northern and Western blot analysis. We checked their protein expression of cytosolic ß-catenin and Dvl-3, and we found no cytosolic ß-catenin protein in both H28 and MS-1 cells (Fig. 1A)Citation . In a TOP/FOP analysis, lower Tcf/lef transcription activity level was detected in both H28 and MS-1 cells when compared with H1703 cells. As expected, reexpression of ß-catenin in H28 cell line was able to restore the Tcf/lef transcription activity (Fig. 1B)Citation .



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Human mesothelioma cell lines H28 and MS-1 have no cytosolic ß-catenin and Tcf-mediated transcription activity. A, Western analysis of Dishevelled (Dvl)-3 and ß-catenin expression in malignant plural mesothelioma cell lines H28 and MS-1 and a non-small cell lung cancer cell line H1703. ß-Actin was used as loading control. Cytosolic proteins were prepared and used in these Western blots. B, TOPFLASH assay of Tcf-dependent transcriptional activity in mesothelioma cell lines H28 and MS-1 and non-small cell lung cancer cell line H1703. The results are means ± SD (error bars). Experiments were performed in triplicate.

 
To assess the role of Wnt-1 in the H28 cells lacking ß-catenin, Wnt-1 siRNA and anti-Wnt-1 monoclonal antibody were used to treat the cells. Interestingly, Wnt-1 siRNA was able to kill ß-catenin-deficient H28 cells (Fig. 2A)Citation , and this cell killing was largely because of apoptosis induction (Fig. 2B)Citation . The blockade of Wnt-1 signaling was confirmed by checking the expression of Wnt-1 signaling mediators (Fig. 2C)Citation . Wnt-1 is down-regulated by Wnt-1 siRNA, and a Wnt intracellular signaling molecule, Dvl-3, is down-regulated in the H28 cells treated with Wnt-1 siRNA. An inhibitor of apoptosis, survivin, was down-regulated and cytochrome c was up-regulated after the blockade of Wnt-1 signaling. MS-1 cell line lacking cytosolic ß-catenin showed similar apoptotic and downstream effect after treatment with Wnt-1 siRNA. Moreover, similar results were seen when we treated both H28 and MS-1 cells with an anti-Wnt-1 monoclonal antibody (Fig. 2D–FCitation ; Ref. 17 ). We have found that C57Wnt-1 cells expresses higher level of surviving when compared with the control C57mv7 cells (Fig. 2, G)Citation , suggesting that Wnt-1 signaling may induce survivin expression in C57MG cells. A non-small cell lung cancer cell line H1703, which is known to have ß-catenin/tcf-mediated transcription activity, was used as a control. Both Wnt-1 siRNA and the anti-Wnt-1 monoclonal antibody induced apoptotic cell killing in H1703 cells. Furthermore, we have demonstrated recently that Wnt-1 siRNA induces apoptosis in a breast cancer cell line MCF-7 that also contains wild-type ß-catenin (17) . These data suggest that a ß-catenin-independent mechanism(s) is responsible for the apoptosis induced by blocking Wnt-1 signaling. To our knowledge, this is the first proof that ß-catenin is not essential for Wnt-1-induced apoptotic inhibition. It was demonstrated that Wnt-1/ß-catenin/Tcf signaling inhibited apoptosis by preventing cytochrome c release and subsequent caspase activation; however, ß-catenin/Tcf transcription is required for this Wnt-1-mediated cell survival (10 , 12) .



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Inhibition of Wnt-1 signaling induces apoptosis in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of mesothelioma cell lines H28 and MS-1 and non-small cell lung cancer cell line H1703 after transfection of nonsilencing control siRNA or Wnt-1 siRNA (17) (~5–6 days after Oligofectamine transfection). Concentration of both control and Wnt-1 siRNA used is 100 nM. B, examples of Annexin V analysis of apoptosis induced by Wnt-1 siRNA in mesothelioma cell lines H28 and MS-1. The cells were transfected with 100 nM nonsilencing control siRNA or 100 nM Wnt-1 siRNA, respectively. Flow cytometry analysis was performed 4–5 days after transfection. FL1-H (x axis) represents Annexin V-FITC staining, and FL3-H (y axis) represents propidium iodide staining. C, Western analysis after Wnt-1 siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). Nonsilencing siRNA was used as control (ctrl). ß-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots, except that whole cell extract was used for probing Wnt-1 protein. D, 0.5% Crystal Violet staining of cell lines H28, MS-1, and H1703 after an anti-Wnt-1 monoclonal antibody treatment (17) (~4–5 days after treatment). Concentration of both control and anti-Wnt-1 monoclonal antibodies used is 10 µg/ml. E, apoptosis analysis by flow cytometry (Annexin V staining) after anti-Wnt-1 monoclonal antibody treatment (10 µg/ml for 3–4 days) in cell lines H28, MS-1, and H1703. The results (percentage of apoptotic cells) are the means ± SD (error bars). Experiments were performed in triplicate, and a total of 20,000 cells was analyzed in each individual experiment. F, Western analysis after the anti-Wnt-1 monoclonal antibody treatment (10 µg/ml for 3–4 days) in cell lines H28, MS-1, and H1703. ß-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots. G, Western analysis of survivin expression in C57Wnt1 and C57 MG cells. ß-Actin served as loading control.

 
The cytoplasmic Dvl family proteins are membrane-proximal signal intermediates in the Wnt signal pathway. Dvl interacts with Fz receptor and mediates Wnt-1 signaling in both canonical and noncanonical pathways. Dvl proteins consist of DIX, PDZ, and DEP domains. The COOH-terminal DEP domain has been connected with JNK pathway (21) . More recently, the PDZ domain, which is involved in both canonical and noncanonical pathways, was found to bind directly to the COOH-terminal region of Fz (22) .

To determine whether this ß-catenin-independent apoptosis inhibition involves the Wnt signaling molecule Dvl, Dvl siRNA was used to treat H28 cell line (16) . Dvl siRNA induced dramatic apoptosis in the ß-catenin-deficient H28 cells (Fig. 3, A and B)Citation . Similar apoptotic effect was also seen in MS-1 cells that lack cytoplasmic ß-catenin (Fig. 3, A and B)Citation . After Dvl siRNA treatment, Dvl-3 was confirmed to be down-regulated in all three cell lines by Western blot analysis. An inhibitor of apoptosis, survivin, was down-regulated in both H28 and MS-1 cells treated with Dvl siRNA (Fig. 3C)Citation . Our earlier data indicates that Dvl-specific siRNA treatment in H1703 decreased Dvl and ß-catenin expression, resulting in reduction of Tcf-dependent transcriptional activity and growth inhibition (16) . The physiological significance of down-regulation of Dvl-3 induced by Wnt-1 siRNA is the inhibition of both canonical and noncanonical Wnt pathways, therefore the downstream effects.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Dishevelled (Dvl) siRNA induces apoptosis in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of cell lines H28, MS-1, and H1703 after transfection of nonsilencing control siRNA or Dvl siRNA (16) (~5–6 days after transfection). Concentration of both control and Dvl siRNA used is 100 nM. B, apoptosis analysis by flow cytometry (Annexin V staining) after Dvl siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). The results (percentage of apoptotic cells) are the means ± SD (error bars). Experiments were performed in triplicate, and a total of 20,000 cells was analyzed in each individual experiment. C, Western analysis after Dvl siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). Nonsilencing siRNA was used as control. ß-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots.

 
In a recent study, we have shown that Dvl-3 overexpression is consistent with higher expression of Wnt-1 in lung cancers, implicating that Wnt-1 may up-regulate Dvl-3 in these tumors (16) . Dvl siRNA does not appear to affect expression levels of Dvl-1 and Dvl-2 because the expression levels for both Dvl-1 and Dvl-2 are minimally expressed in the samples tested (16) . Interestingly, JNK was found to be up-regulated in these cells after blocking Wnt-1 signaling (Fig. 4)Citation . We have also examined the links between Dvl and JNK. In one experiment, we transfected Dvl into two cell lines LARK1A and H513, and the induced Dvl overexpression induced Tcf-dependent transcription activity and then did Western blot analysis using an antiactive JNK antibody. Indeed, we noticed JNK inactivation in both cell lines after expressing exogenous Dvl when compared with the same cell lines transfected with empty vector. In another test, the level of active JNK was reduced in the C57MG and H28 cells after a 24-h treatment with Wnt-1 conditioned medium. Taken together, these findings suggest that Dvl may be required for the apoptotic inhibition induced by Wnt-1 signaling and JNK may be up-regulated by blocking Dvl.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. The small molecule c-Jun NH2-terminal kinase (JNK) inhibitor (SP600125) inhibits apoptosis induced by Wnt-1 siRNA, anti-Wnt-1 monoclonal antibody, or Dishevelled (Dvl) siRNA in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of mesothelioma cell line H28 and NSCLC cell line H460 (expressing ß-catenin) after transfection of nonsilencing control siRNA, Dvl siRNA, or Wnt-1 siRNA (~5–6 days after transfection) in the presence (bottom wells) and absence (top wells) of the JNK inhibitor SP600125 (10 nM). Concentration of all siRNA used is 100 nM. B–E, morphologies of H28 cells after the treatment with control monoclonal antibody alone, anti-Wnt-1 monoclonal antibody alone, control monoclonal antibody plus the JNK inhibitor SP600125, and anti-Wnt-1 monoclonal antibody plus SP600125, respectively. Antibody concentration used is 10 µg/ml, and SP600125 concentration used is 10 nM. F, apoptosis analysis by flow cytometry (Annexin V staining) in the presence and absence of the JNK inhibitor SP600125 (10 nM) after siRNA transfection (100 nM for 4–5 days) or monoclonal antibody treatment (10 µg/ml for 3–4 days) in cell lines H28 and MS-1. The results (percentage of apoptotic cells) are the means ± SD (error bars). Experiments were performed in triplicate, and a total of 20,000 cells was analyzed in each individual experiment. G, Western analysis in the presence and absence of the JNK inhibitor SP600125 (10 nM) after siRNA transfection (100 nM for 4–5 days) or monoclonal antibody treatment (10 µg/ml for 3–4 days) in cell lines H28 and MS-1. ß-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots. H, 0.5% Crystal Violet staining of mesothelioma cell line H28 cells after the treatment with control monoclonal antibody alone, anti-Wnt-1 monoclonal antibody alone, control monoclonal antibody plus JNK siRNA, and anti-Wnt-1 monoclonal antibody plus JNK siRNA, respectively. Antibody concentration used is 10 µg/ml, and JNK siRNA used is 100 nM. I, Western analysis of JNK protein expression in H28 cells after the treatment with control monoclonal antibody alone or anti-Wnt-1 monoclonal antibody. ß-Actin served as loading control.

 
To date, the role of JNK pathway in Wnt signaling is still unclear (7) . It has been shown that Dvl induces JNK activity through DEP domain in planar cell polarity pathway in vertebrate cells (21) . However, several recent studies indicated that Wnt-5a, a JNK activator involved in planar cell polarity pathway, serves as an antagonist of Wnt canonical pathway mediated by Wnt-1 class signals (23 , 24) ; therefore, Wnt-5a may function as a tumor suppressor. Given the complexity of Wnt canonical and noncanonical pathways, it is conceivable that Wnt-1 class and Wnt5a class may recruit different set of positive/negative regulators, including Dvl-binding proteins. Several Dvl-binding proteins may directly or indirectly induce effects that consistent with our current findings. Firstly, a Wnt signaling-negative regulator Axin can induce JNK activity and ß-catenin down-regulation (25 , 26) . Secondly, an antagonist of Wnt signaling, Naked, was shown to interact with Dvl and negatively regulate ß-catenin but positively regulate JNK-mediated planar cell polarity pathway (27 , 28) . Thirdly, a Dvl-associated kinase and positive regulator of Wnt signaling, Par-1, activates the canonical pathway but inhibits the JNK-mediated planar cell polarity pathway (29) . In this study, activation of JNK was not noticed in most of the cancer cells naturally expressing both Wnt-1 and Dvl-3. JNK activation was only seen in these cells after treatment with siRNA for either Wnt-1 or Dvl-3.

To further examine the possible involvement of JNK in Wnt-1-induced apoptosis inhibition, a selective JNK-1, JNK-2, JNK-3 inhibitor, SP600125 (30) , was used to treat the H28 cells combined with Wnt-1 siRNA, anti-Wnt-1 monoclonal antibody, or Dvl siRNA. Recently, the JNK inhibitor has been shown to inhibit chemotherapy-induced apoptosis, at least in part, through the inhibition of caspase-3 activity (31) . In this study, this small molecule inhibitor of JNK inhibits significantly the apoptotic cell killing induced by Wnt-1 siRNA, anti-Wnt-1 monoclonal antibody, or Dvl siRNA (Fig. 4)Citation . In the ß-catenin-deficient H28 and MS-1 cells, the JNK inhibitor showed limited toxicity in cultured cells and reduced dramatically the apoptotic cell death induced by either Wnt-1 siRNA or Dvl siRNA (Fig. 4, A–F)Citation . In a non-small cell lung cancer cell line H460 with intact ß-catenin, the JNK inhibitor failed to inhibit apoptotic cell death induced by Wnt-1 siRNA (Fig. 4A)Citation . These data suggest that the apoptosis induction in the H28 and MS-1 cells lacking ß-catenin may require activated JNK pathway, and the results also suggest that both canonical and noncanonical pathways may be involved in the apoptosis induced by blockade of Wnt-1 signaling in H460 cells. The inhibition of activated JNK-1 was confirmed by checking the activated form of JNK-1 (Fig. 4G)Citation . By Western blot analysis, it was found that the cleaved form of caspase-3 was reduced and survivin was up-regulated when treatment with the JNK inhibitor was combined with Wnt-1 siRNA, anti-Wnt-1 antibody, or Dvl siRNA in both H28 and MS-1 cells (Fig. 4G)Citation . These data suggest that caspase-3 and survivin may be involved in the induction of apoptosis occurs as a result of blocking Wnt-1 signaling. Furthermore, JNK siRNA was used to test if it can show similar effect as SP600125. Our results indicate that JNK siRNA was also able to inhibit the apoptosis induced by an anti-Wnt-1 antibody in H28 cells (Fig. 4H)Citation . In addition, we have found that Wnt-2 siRNA also induces apoptosis in H28 cells (data not shown), suggesting that this effect may be specific for more than one Wnt-1 class proteins (e.g., Wnt-1, Wnt-2). Lastly, we have shown that the inhibition of Wnt-1 signaling by an anti-Wnt-1 antibody does not affect protein level of JNK in H28 cells (Fig. 4I)Citation .

Activation of JNK is essential for apoptosis induced by multiple stress inducers, including tumor growth factor {alpha} (32 , 33) . To date, little is known about the connection of Dvl and apoptosis in a JNK-dependent manner. This study suggests that Dvl inactivates the JNK-dependent apoptotic pathway in some cancer cell lines. Blockade of Wnt-1 signaling induces programmed cell death, at least in part, through Dvl/JNK-dependent pathway.


    FOOTNOTES
 
Grant support: The Larry Hall Memorial Trust and the Kazan, McClain, Edises, Abrams, Fernandez, Lyons & Farrise Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: David M. Jablons, Department of Surgery, Cancer Center, 1600 Divisadero Street, C322C, Box 1674, San Francisco, CA 94115. Phone: (415) 353-7502; Fax: (415) 502-3179; E-mail: jablonsd{at}surgery.ucsf.edu

Received 1/13/04. Revised 2/21/04. Accepted 3/17/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Dann CE, Hsieh JC, Rattner A, Sharma D, Nathans J, Leahy DJ Insights into Wnt binding and signalling from the structures of two Frizzled cysteine-rich domains. Nature (Lond.), 412: 86-90, 2001.[CrossRef][Medline]
  2. Hsieh JC, Rattner A, Smallwood PM, Nathans J Biochemical characterization of Wnt-frizzled interactions using a soluble, biologically active vertebrate Wnt protein. Proc Natl Acad Sci USA, 96: 3546-51, 1999.[Abstract/Free Full Text]
  3. Wodarz A, Nusse R Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol, 14: 59-88, 1998.[CrossRef][Medline]
  4. Uthoff SM, Eichenberger MR, McAuliffe TL, Hamilton CJ, Galandiuk S Wingless-type frizzled protein receptor signaling and its putative role in human colon cancer. Mol Carcinog, 31: 56-62, 2001.[CrossRef][Medline]
  5. He TC, Sparks AB, Rago C, et al Identification of c-MYC as a target of the APC pathway. Science (Wash. DC), 281: 1509-12, 1998.[Abstract/Free Full Text]
  6. Tetsu O, McCormick F ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature (Lond.), 398: 422-6, 1999.[CrossRef][Medline]
  7. Veeman MT, Axelrod JD, Moon RT A second canon. Functions and mechanisms of ß-catenin-independent Wnt signaling. Dev Cell, 5: 367-77, 2003.[CrossRef][Medline]
  8. Nusse R, Varmus HE Wnt genes. Cell, 69: 1073-87, 1992.[CrossRef][Medline]
  9. Satoh S, Daigo Y, Furukawa Y, et al AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat Genet, 24: 245-50, 2000.[CrossRef][Medline]
  10. Chen S, Guttridge DC, You Z, et al Wnt-1 signaling inhibits apoptosis by activating ß-catenin/T-cell factor-mediated transcription. J Cell Biol, 152: 87-96, 2001.[Abstract/Free Full Text]
  11. Ioannidis V, Beermann F, Clevers H, Held W The ß-catenin–TCF-1 pathway ensures CD4(+)CD8(+) thymocyte survival. Nat Immunol, 2: 691-7, 2001.[CrossRef][Medline]
  12. You Z, Saims D, Chen S, et al Wnt signaling promotes oncogenic transformation by inhibiting c-Myc-induced apoptosis. J Cell Biol, 157: 429-40, 2002.[Abstract/Free Full Text]
  13. Nusse R Developmental biology. Making head or tail of Dickkopf. Nature (Lond.), 411: 255-6, 2001.[CrossRef][Medline]
  14. Shou J, Ali-Osman F, Multani AS, Pathak S, Fedi P, Srivenugopal KS Human Dkk-1, a gene encoding a Wnt antagonist, responds to DNA damage and its overexpression sensitizes brain tumor cells to apoptosis following alkylation damage of DNA. Oncogene, 21: 878-89, 2002.[CrossRef][Medline]
  15. Uematsu K, Kanazawa S, You L, et al Wnt pathway activation in mesothelioma: evidence of Dishevelled overexpression and transcriptional activity of ß-catenin. Cancer Res, 63: 4547-51, 2003.[Abstract/Free Full Text]
  16. Uematsu K, He B, You L, Xu Z, McCormick F, Jablons DM Activation of the Wnt pathway in non-small cell lung cancer: evidence of dishevelled overexpression. Oncogene, 22: 7218-21, 2003.[CrossRef][Medline]
  17. He B, You L, Uematsu K, et al A monoclonal antibody against Wnt-1 induces apoptosis in human cancer cells. Neoplasia, 6: 7-14, 2004.[Medline]
  18. Li L, Mao J, Sun L, Liu W, Wu D Second cysteine-rich domain of Dickkopf-2 activates canonical Wnt signaling pathway via LRP-6 independently of dishevelled. J Biol Chem, 277: 5977-81, 2002.[Abstract/Free Full Text]
  19. Shigemitsu K, Sekido Y, Usami N, et al Genetic alteration of the ß-catenin gene (CTNNB1) in human lung cancer and malignant mesothelioma and identification of a new 3p21.3 homozygous deletion. Oncogene, 20: 4249-57, 2001.[CrossRef][Medline]
  20. Hsu SM, Hsu PL, Zhao X, Kao-Shan CS, Whang-Peng J Establishment of human mesothelioma cell lines (MS-1, -2) and production of a monoclonal antibody (anti-MS) with diagnostic and therapeutic potential. Cancer Res, 48: 5228-36, 1988.[Abstract/Free Full Text]
  21. Boutros M, Paricio N, Strutt DI, Mlodzik M Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell, 94: 109-18, 1998.[CrossRef][Medline]
  22. Wong HC, Bourdelas A, Krauss A, et al Direct binding of the PDZ domain of Dishevelled to a conserved internal sequence in the C-terminal region of Frizzled. Mol Cell, 12: 1251-60, 2003.[CrossRef][Medline]
  23. Topol L, Jiang X, Choi H, Garrett-Beal L, Carolan PJ, Yang Y Wnt-5a inhibits the canonical Wnt pathway by promoting GSK-3-independent ß-catenin degradation. J Cell Biol, 162: 899-908, 2003.[Abstract/Free Full Text]
  24. Westfall TA, Brimeyer R, Twedt J, et al Wnt-5/pipetail functions in vertebrate axis formation as a negative regulator of Wnt/ß-catenin activity. J Cell Biol, 162: 889-98, 2003.[Abstract/Free Full Text]
  25. Zhang Y, Neo SY, Wang X, Han J, Lin SC Axin forms a complex with MEKK1 and activates c-Jun NH(2)-terminal kinase/stress-activated protein kinase through domains distinct from Wnt signaling. J Biol Chem, 274: 35247-54, 1999.[Abstract/Free Full Text]
  26. Neo SY, Zhang Y, Yaw LP, Li P, Lin SC Axin-induced apoptosis depends on the extent of its JNK activation and its ability to down-regulate ß-catenin levels. Biochem Biophys Res Commun, 272: 144-50, 2000.[CrossRef][Medline]
  27. Zeng W, Wharton KA, Jr, Mack JA, et al Naked cuticle encodes an inducible antagonist of Wnt signalling. Nature (Lond.), 403: 789-95, 2000.[CrossRef][Medline]
  28. Yan D, Wallingford JB, Sun TQ, et al Cell autonomous regulation of multiple Dishevelled-dependent pathways by mammalian Nkd. Proc Natl Acad Sci USA, 98: 3802-7, 2001.[Abstract/Free Full Text]
  29. Sun TQ, Lu B, Feng JJ, et al PAR-1 is a Dishevelled-associated kinase and a positive regulator of Wnt signalling. Nat Cell Biol, 3: 628-36, 2001.[CrossRef][Medline]
  30. Bennett BL, Sasaki DT, Murray BW, et al SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA, 98: 13681-6, 2001.[Abstract/Free Full Text]
  31. Krilleke D, Ucur E, Pulte D, Schulze-Osthoff K, Debatin KM, Herr I Inhibition of JNK signaling diminishes early but not late cellular stress-induced apoptosis. Int J Cancer, 107: 520-7, 2003.[CrossRef][Medline]
  32. Davis RJ Signal transduction by the JNK group of MAP kinases. Cell, 103: 239-52, 2000.[CrossRef][Medline]
  33. Deng Y, Ren X, Yang L, Lin Y, Wu X A JNK-dependent pathway is required for TNF-{alpha}-induced apoptosis. Cell, 115: 61-70, 2003.[CrossRef][Medline]



This article has been cited by other articles:


Home page
DevelopmentHome page
L. Osorio, M.-A. Teillet, and M. Catala
Role of noggin as an upstream signal in the lack of neuronal derivatives found in the avian caudal-most neural crest
Development, May 15, 2009; 136(10): 1717 - 1726.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
L. Queimado, D. Obeso, M. D. Hatfield, Y. Yang, D. M. Thompson, and A. M.C. Reis
Dysregulation of Wnt Pathway Components in Human Salivary Gland Tumors
Arch Otolaryngol Head Neck Surg, January 1, 2008; 134(1): 94 - 101.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. Sato, H. Suzuki, M. Toyota, M. Nojima, R. Maruyama, S. Sasaki, H. Takagi, Y. Sogabe, Y. Sasaki, M. Idogawa, et al.
Frequent epigenetic inactivation of DICKKOPF family genes in human gastrointestinal tumors
Carcinogenesis, December 1, 2007; 28(12): 2459 - 2466.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Fujii, L. You, Z. Xu, K. Uematsu, J. Shan, B. He, I. Mikami, L. R. Edmondson, G. Neale, J. Zheng, et al.
An Antagonist of Dishevelled Protein-Protein Interaction Suppresses {beta}-Catenin-Dependent Tumor Cell Growth
Cancer Res., January 15, 2007; 67(2): 573 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M.-T. Teh, D. Blaydon, L. R. Ghali, S. Edmunds, E. Pantazi, M. R. Barnes, I. M. Leigh, D. P. Kelsell, and M. P. Philpott
Role for WNT16B in human epidermal keratinocyte proliferation and differentiation
J. Cell Sci., January 15, 2007; 120(2): 330 - 339.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Almeida, L. Han, T. Bellido, S. C. Manolagas, and S. Kousteni
Wnt Proteins Prevent Apoptosis of Both Uncommitted Osteoblast Progenitors and Differentiated Osteoblasts by {beta}-Catenin-dependent and -independent Signaling Cascades Involving Src/ERK and Phosphatidylinositol 3-Kinase/AKT
J. Biol. Chem., December 16, 2005; 280(50): 41342 - 41351.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C.-l. Huang, D. Liu, J. Nakano, S. Ishikawa, K. Kontani, H. Yokomise, and M. Ueno
Wnt5a Expression Is Associated With the Tumor Proliferation and the Stromal Vascular Endothelial Growth Factor--An Expression in Non-Small-Cell Lung Cancer
J. Clin. Oncol., December 1, 2005; 23(34): 8765 - 8773.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. He, A. Y. Lee, S. Dadfarmay, L. You, Z. Xu, N. Reguart, J. Mazieres, I. Mikami, F. McCormick, and D. M. Jablons
Secreted Frizzled-Related Protein 4 Is Silenced by Hypermethylation and Induces Apoptosis in {beta}-Catenin-Deficient Human Mesothelioma Cells
Cancer Res., February 1, 2005; 65(3): 743 - 748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, L.
Right arrow Articles by Jablons, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, L.
Right arrow Articles by Jablons, D. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online