Cancer Research SABCS  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitsushita, J.
Right arrow Articles by Kamata, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitsushita, J.
Right arrow Articles by Kamata, T.
[Cancer Research 64, 3580-3585, May 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

The Superoxide-Generating Oxidase Nox1 Is Functionally Required for Ras Oncogene Transformation

Junji Mitsushita1, J. David Lambeth2 and Tohru Kamata1

1 Department of Molecular Biology and Biochemistry, Shinshu University School of Medicine, Matsumoto, Nagano, Japan, and 2 Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The activated Ras oncogene can transform various mammalian cells and has been implicated in development of a high population of malignant human tumors. Recent studies suggest that generation of reactive oxygen species such as superoxide and H2O2 is involved in cell transformation by the activated Ras. However, the nature of an oxidase participating in Ras-transformation is presently unknown. Here, we report that Ras oncogene up-regulates the expression of Nox1, a homologue of the catalytic subunit of the superoxide-generating NADPH oxidase, via the mitogen-activated protein kinase kinase-mitogen-activated protein kinase pathway, and that small interfering RNAs designed to target Nox1 mRNA effectively blocks the Ras transformed phenotypes including anchorage-independent growth, morphological changes, and production of tumors in athymic mice. Therefore, we propose that increased reactive oxygen species generation by Ras-induced Nox1 is required for oncogenic Ras transformation.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Low levels of reactive oxygen species (ROS) have been implicated as an intracellular signaling molecule in multiple cellular processes such as proliferation, apoptosis, and senescence (1 , 2) . As for growth factor responses, platelet-derived growth factor (3) and epidermal growth factor (4) generated ROS in vascular smooth muscle cells and fibroblast cells, respectively. Depletion of ROS by chemical antioxidants blocked induction of cell proliferation by these growth factors. Nerve growth factor-induced ROS production also appeared to be required for neuronal differentiation of PC12 cells (5) . The Nox family proteins Nox1–5, which are homologous to gp91phox, the catalytic subunit of phagocytic superoxide generating NADPH oxidase, have been identified recently in nonphagocytic cells, and each appears to exert a specific functional role in various tissues (6, 7, 8, 9) . Among them, Nox1 is unique in that it functions in mitogenic regulation: decreased expression of Nox1 inhibits cell growth of vascular smooth muscle cells (10) and dismutation of Nox1-generated superoxide to hydrogen peroxide mediated Nox1-induced cell growth and transformation (11) . However, it is not currently known whether Nox1 plays a mediating role in cell transformation by oncogenes, tumor suppressors, and other carcinogenic agents.

Activation of Ras triggers uncontrolled proliferation and morphological alteration, contributing to the malignant phenotype of transformed cells. Ras interacts with three major effector proteins (12) , Raf kinase, phosphatidylinositol 3'-kinase, and RalGDS proteins. Whereas these effector pathways exert essential roles in the signaling involved in Ras transformation, another downstream limiting factor has been suggested to account for the Ras transforming potential: elevations in intracellular superoxide mediate mitogenic signaling by RasVal12 (13) . This led us to investigate how Ras activates the ROS-generating machinery and whether Nox1 is responsible for the malignant transformation by Ras oncogene. In the experiments described below, we provide new evidence that Nox1 expression is activated by the Ras-mitogen-activated protein kinase kinase (MAPKK)- mitogen-activated protein kinase (MAPK) pathway, and small interfering (si) RNAs for Nox1 prevents the Ras oncogene-transformed phenotypes, suggesting the essential contribution of Nox1-generated ROS to the malignant transformation by Ras.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The siRNA Constructions.
DNA oligonucleotides encoding siRNA with loop sequence (TTCAAGAGA) were subcloned into the H1 promoter vector, pSilencer hygro (Ambion, Austin, TX) according to the manufacturer’s instructions. On the basis of rat Nox1 cDNA sequences, siRNAs were designed as follows: 5'-TTATGAGAAGTCTGACAAG-3' for siNox1-N, 5'-GATTCTTGGCTAAATCCCA-3' for siNox1-M, and 5'-GGACATTTGAACAACAGCA-3' for siNox1-C, respectively. All of the constructions were verified by sequencing. pSilencer hygro Negative Control plasmid (Ambion), encoding a hairpin siRNA of which the sequence is not found in the mouse, human, or rat genome databases, is used for a control vector.

Transfections.
Rat and Human Nox1 cDNAs were subcloned into pEGFP-C1 vectors (Clontech, Palo Alto, CA) containing Green Fluorescent Protein (GFP-rNox1 and GFP-hNox1). siNox1-N, siNox1-M, siNox1-C, and control vector (4 µg) were transfected into 1 x 106 K-Ras-NRK cells by using Lipofectamine2000 (Invitrogen, Carlsbad, CA). Transfected cells were subjected to selection in DMEM supplemented with 10% fetal bovine serum and 400 µg/ml hygromycin for 2 weeks. Surviving colonies were isolated. The presence of stably transfected vectors in the cells was confirmed by PCR with vector specific primers, M13F (GTTTTCCCAGTCACGAC) and 3.0Rev (GAGTTAGCTCACTCATTAGGC).

Cell Culture and Materials.
NRK, K-Ras-NRK cells (Kirstein murine sarcoma virus-transformed NRK cells), and NIH3T3 cells were purchased from American Type Culture Collection (Manassas, VA). Cells were maintained in DMEM with 10% fetal bovine serum. siNox1-stably transfected cell lines were maintained with 100 µg/ml hygromycin. One clone of siNox1-stably transfected K-Ras-NRK cells (K-Ras-NRK/siNox1-N-7) was transfected with pEGFP-C1 or GFP-hNox1 and subjected to selection with 600 µg/ml G418 and 100 µg/ml hygromycin for 2 weeks.

Real-Time PCR.
Total RNA was harvested from cells with TRIzol (Invitrogen). Equal amounts of DNasel-treated total RNA (5 µg) was reverse-transcribed by Power Script (Clontech) with random primers (Random 9 mers; TAKARA, Kyoto, Japan), and the resulting first-strand cDNA was analyzed with ABI Prism 7700 sequence detection system and TaqMan reagents (PE Applied Biosystems, Foster City, CA) using the standard curve method according to the manufacturer’s instructions. Equal amounts of templates were analyzed in duplicate. VIC-labeled Ribosomal 18S RNA (PE Applied Biosystems) was used for normalization. The TaqMan MGB probe and primer pairs were designed with ABI Primer Express software. The sequences of primer pairs for rat Nox1, those for mouse Nox1, and TaqMan MGB probe are as follows: forward (for rat), 5'-GGTCACTCCCTTTGCTTCCA-3'; reverse (for rat), 5'-GGCAAAGGCACCTGTCTCTCT-3'; forward (for mouse), 5'-TGTGCAGACCACAACCTCAAA-3'; reverse (for mouse) 5'-GCCTAATTCCTCCATCTCCTGTT-3'; and TaqMan MGB probe (for both rat and mouse), 5'-carboxyfluorescein-TCCAGTAGAAATAGATCTTT-carboxytetramethylrhodamine-MGB-3'.

Growth Curve.
Cells (1 x 104) were plated in 3.5-cm dishes and allowed to grow in DMEM with 10% fetal bovine serum. Cell numbers for each cell line were counted.

Soft Agar Assay.
A 0.53% agar base layer containing growth nutrients was solidified in 6-cm dishes (14) . Cell suspensions in DMEM containing 0.3% agar and 10% fetal bovine serum were layered over the base layer to a final cell density of 1.5 x 104 cells/dish. The appearance of colonies was monitored for up to 10 days.

Nitroblue Tetrazolium (NBT) Assay.
NBT assay was performed by the methods described (6) . Briefly, 2 x 105 cells were inoculated into 24-well plates in triplicate. 0.25% NBT in Hanks’ solution was added to the serum-starved cells with or without 40 units of superoxide dismutase for 8 min at 37°C. Reduced NBT was quantified by determining the absorbance at 510 nm (extinction coefficient of 11,000 M–1 cm–1).

Immunoblotting.
Cells were lysed in radioimmunoprecipitation assay buffer (PBS, 0.1% SDS, 1% Na-deoxycholate, 1% Triton X-100, leupeptin 10 µg/ml, pepstatin A 10 µg/ml, and phenylmethylsulfonyl fluoride 1 mM). Lysates were incubated with Lammeli sample buffer containing DTT as a reducing agent for 2 h at 37°C. The same amount of proteins (20 µg) was analyzed by SDS-gel electrophoresis, followed by immunoblotting.

Tumorigenicity Analysis.
Athymic mice were used to determine the tumor formation by each transfected cell line. Trypsinized cells (1 x 106) were suspended in 0.2 ml of PBS, and the cell suspensions were inoculated s.c. into the animal. All of the animals were observed for the formation of tumors for up to 1 month. Tumors at 14 days were measured with an external caliper, and volume was calculated.

In Vitro Phosphatidylinositol 3'-Kinase (PI3K) Assay.
Reactions were performed as described (15) . Briefly, Cell lysates were solubilized in lysis buffer {20 mM HEPES (pH 7.4), 150 mM KCl, 2 mM Na3VO4, 50 mM NaF, 5 mM EDTA, 20 mM 3-[(3-cholamidopropyl)dimethylammonio]-1 -propanesulfonic acid, 10 µg/ml pepstatin A, and 1 mM phenylmethylsulfonyl fluoride} and subjected to immunoprecipitation with antibodies to p110 subunit of PI3K (UBI, New York, NY). The immunoprecipitates were incubated with 100 µg phosphatidylinositol-3,4-bisphosphate and 5 µM [{gamma}-32P]ATP (3000 Ci/mmol) in the reaction buffer [20 mM HEPES (pH7.5), 10 mM MgCl2, and 0.5 mM EGTA] for 30 min at 37°C. The labeled phosphatidylinositol-3,4,5-triphosphate were extracted and separated by TLC, followed by autoradiography.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Activated Ras Stimulates Nox1 Expression through the MAPK Pathway.
To determine the functional role of Nox1 in Ras oncogene transformation, we first examined the expression level of Nox1 gene in Ras-transformed NRK cells stably expressing the K-RasVal12 oncogene (K-Ras-NRK). Real-time PCR analysis under optimized conditions showed that the level of Nox1 expression in K-Ras-NRK cells was markedly elevated, whereas little or no Nox1 expression was detected in untransformed NRK cells (Fig. 1A)Citation . Furthermore, transient transfection of NRK cells with H-RasVal12 also increased the expression of Nox1 as compared with that in cells transfected with control vectors (Fig. 1B)Citation , and similar results were obtained with NIH3T3 cells (Fig. 1E)Citation , indicating that up-regulation of Nox1 gene expression was due to the activation of Ras. The expression of Nox1 was growth associated, as serum or epidermal growth factor, which promotes cell proliferation, induced a significant increase in the Nox1 expression within 12 h after the mitogen treatment (Fig. 1, C and D)Citation . This is consistent with previous observations that both platelet-derived growth factor and angiotensin II trigger superoxide formation and induce Nox1 expression in vascular smooth muscle cells (10) .



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Activated Ras stimulates Nox1 expression through the mitogen-activated protein kinase (MAPK) pathway. A–F, analysis was performed by real-time PCR. A, Nox1 expression in K-Ras-NRK and parental NRK cells. The cells were treated or untreated with a MAPK kinase (MAPKK) inhibitor PD98059 (PD: 20 µM or 100 µM) for 12 h. B, NRK cells were transiently transfected with pcDNA3.1-H-RasVal12 (RasV12) or pcDNA3.1 as an empty vector (Vector) for 24 h and serum-starved for 24 h. Transfected RasV12 expression was determined by immunoblotting (IB) with rabbit anti-Ras antibodies. C and D, NRK cells were starved of serum for 72 h. Nox1 expression was examined after stimulation of NRK cells with epidermal growth factor (50 ng/ml) or serum (30%) in the presence or absence of PD (20 µM) for 6 h. E, NIH3T3 cells were transiently transfected with pcDNA3.1, pcDNA3.1-H-RasVal12, or pSR{alpha}-dominant-active MAPKK (LA-SDSE; Ref. 16 ) as in B. F, NRK or K-Ras-NRK cells were transiently transfected with pcDNA3.1-dominant-negative-Rac1Asn17 (DN-Rac1) or pcDNA3.1 as an empty vector for 24 h and serum-starved for 24 h. Through A–F, the data show the mean of duplicate experiments and similar results were obtained in independent experiments. G, NRK cells transiently transfected with RasV12 or K-Ras-NRK cells were serum-starved and treated with 20 µM of PD98059. Lysates from these cells were immunoblotted with antiphospho-MAPK antibodies. Total amounts of MAPK were quantified by immunoblotting with anti-MAPK antibodies. H, a MAPKK inhibitor, PD98059, does not affect phosphatidylinositol 3'-kinase (PI3K) activity. Lysates from PD98059-treated or wortmannin (WM)-treated K-Ras-NRK cells were solubilized in lysis buffer and subjected to immunoprecipitation with antibodies to p110 subunit of PI3K. The immunoprecipitates were incubated with phosphatidylinositol-3,4-bisphosphate and [{gamma}-32P]ATP in the reaction buffer for 30 min at 37°C as described in "Materials and Methods." The labeled phosphatidylinositol-3,4,5-triphosphate [PIP3 (3,4,5)] were analyzed by TLC, followed by autoradiography. Total amounts of PI3K were quantified by immunoblotting with anti-PI3K antibodies; bars, ±SD.

 
We next dissected the signaling pathway downstream of Ras that links Ras to the Nox1 gene expression. Augmented expression of Nox1 in K-Ras-NRK cells (Fig. 1A)Citation was inhibited significantly by a MAPKK inhibitor, PD98059, and a similar inhibitory effect by the inhibitor was observed with mitogenic stimulation of the Nox1 induction by serum or epidermal growth factor (Fig. 1, C and D)Citation . When the dominant active MAPKK mutant was overexpressed in NIH3T3 cells, up-regulation of Nox1 was induced (Fig. 1E)Citation . Because the previous work proposed that Rac1 might be functionally required for Ras-induced superoxide generation, we addressed a question as to whether inhibition of Rac1 is able to block the Ras-induced up-regulation of Nox1 expression. Overexpression of the dominant-negative Rac1Asn17 had no significant effect on the Ras-dependent up-regulation of Nox1 mRNA expression (Fig. 1F)Citation . This implies that at least Rac1 is not involved in Ras/MAPK-mediated transcriptional control of the Nox1 gene. Because the results implicated the critical role of activated MAPK in Ras-induced Nox1 expression, we examined whether oncogenic Ras has really activated MAPK in both transient and stable transfection. Lysates from transfectants were immunoblotted with antiphospho-MAPK antibodies. As shown in Fig. 1GCitation , the MAPK activity was found to be markedly activated, which is in agreement with other studies (17, 18, 19) . In another control experiment, a PI3K inhibitor wortmannin (500 nM) did not block the elevated expression of Nox1 in H-Ras-NIH3T3 cells (data not shown). PD98059 actually inhibited the MAPKK activity in these cell systems as determined by immunoblotting with antiphospho-MAPK antibodies (Fig. 1G)Citation . Furthermore, PD98059 had no inhibitory effect on the PI3K activity, indicating that the inhibitor did not interfere with the PI3K-mediated pathway (Fig. 1H)Citation . These results suggest that oncogenic Ras and growth factor signalings induce the gene expression of Nox1 through the Ras-MAPKK-MAPK but not the PI3K-mediated pathway. By using reporter assay, we determined that the proximal 300 bp of the Nox1 promoter contains sufficient responsive elements for transcriptional activation by MAPK.3

Introduction of Rat Nox1-Specific siRNAs (siNox1-N, M, and C) in K-Ras-NRK Cells Suppresses the Malignant Phenotype.
Recent studies indicate that the introduction of siRNAs into mammalian cells can specifically silence cellular mRNAs without induction of the nonspecific IFN responses (20 , 21) . Stable expression of siRNAs is able to direct persistent suppression of gene expression, allowing the analysis of loss-of-function phenotypes over long periods of time (22) . To investigate whether Nox1 mediates Ras oncogene transformation, we stably transfected rat Nox1-specific siRNAs (siNox1-N, M, and C) into K-Ras-NRK cells. Introduction of expression plasmids carrying siNox1 or a control vector into cells was verified by PCR with a set of vector-specific primers (Fig. 2A)Citation . Transfection of siNox1 significantly suppressed the anchorage-independent growth in soft agar as shown by the number of colonies formed (Fig. 2B)Citation . The growth rate of siNox1-transfected K-Ras-NRK cells in liquid culture decreased, as well (Fig. 2C)Citation . In contrast, control vectors had no growth-inhibitory effect. Of 18 clones isolated from siNox1 transfectants, 17 (94%) showed morphological alteration. Fig. 2DCitation shows a typical morphological alteration in siNox1-N-7 clone similar to the cell shape seen in NRK cells. Control vectors had no effect on morphology. K-Ras-NRK cells carrying control vectors maintained a round morphology similar to that seen in parental K-Ras-NRK cells. We ensured that the level of Nox1 proteins was reduced by overexpression of siNox1 mRNA. Because anti-Nox1 antibodies are not currently available, GFP-tagged rat Nox1 and siNox1 were coexpressed. We detected two protein bands (82 and 79 kDa) of GFP-rat Nox1 on immunoblot (Fig. 2E)Citation . The doublet structure was also reported by others (10) , and it may be due to the post-translational modification or the protein degradation. Coexpression of siNox1 decreased the production of GFP-rat Nox1 proteins (Fig. 2E)Citation dependent on a dose of the Nox1 siRNA vectors, indicating that siNox1s efficiently eliminated GFP-Nox1 RNAs from cells (Fig. 2E)Citation . In control experiments, expression of GFP-human Nox1 was not affected by siNox1, because human Nox1 sequences were not contained in siNox1 (Fig. 2F)Citation . In fact, real-time PCR demonstrated that the level of endogenous Nox1 transcripts was markedly reduced in siNox1-transfected K-Ras-NRK cell clones (Fig. 2G)Citation . We assessed the role of Nox1 in the activated Ras-induced generation of superoxide by using NBT reduction assay, which has been used to detect superoxide production by the NADPH oxidase (6) . K-Ras-NRK cells elevated reduction of NBT, which was inhibited by superoxide dismutase treatment, as compared with NRK cells. In contrast, the transfection of siNox1 into K-Ras-NRK cells abolished this stimulatory effect of K-Ras oncogene on the ROS production (Fig. 2H)Citation , indicating that Nox1 mediates elevated production of superoxide in Ras-transformed cells.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. The effects of rat Nox1-specific small interfering (si)RNAs (siNox1-N, M, and C) on Ras-transformed phenotypes. K-Ras-NRK cells were stably transfected with siNox1-N, siNox1-M, and siNox1-C, and clones were isolated. For siNox1-expressing cell lines, two or three groups were chosen (for siNox1-N-expressing clones, K-Ras-NRK/siNox1-N-7, -12, and -15; for siNox1-M-expressing clones, K-Ras-NRK/siNox1-M-17 and -19; and for siNox1-C-expressing clones, K-Ras-NRK/siRNA-C-2, -3, and -7), and for control vector-carrying cell lines, two clones were chosen (neg-1 and neg-3). A, the presence of stably transfected vectors in the cell lines was confirmed by PCR with a set of vector-specific primers (M13F and 3.0Rev). B, anchorage-independent cell growth of indicated cell lines on soft agar. Triplicates are shown; bars, ±SE. C, growth curves for indicated cell lines. Cells (104) were inoculated into dishes, and cell numbers were counted. The data are shown as triplicates; bars, ±SE. D, comparison of morphological changes among cell lines indicated. Note that K-Ras-NRK/siNox1-N-7 became elongated, whereas control vector (neg-1) had no effect on morphology. Scale bar shows 30 µm. E, green fluorescent protein (GFP)-rat Nox1 (GFP-rNox1) was cotransfected into Cos1 cells with siNox1s to evaluate the inhibitory effect of siNox1s on the expression of GFP-rNox1. The expression of GFP-rNox1 was determined by immunoblotting with anti-GFP antibodies. The intensity of the bands was evaluated by densitmetry (arbitrary units). F, the effect of siNox1s on the expression of GFP-human Nox1 (GFP-hNox1) in which there are no target sequences of siNox1-N and siNox1-C. Note that indicated siNox1s had no effect on GFP-hNox1 expression. G, real-time PCR revealed that Nox1 mRNA expression was severely reduced in the cells carrying siNox1 constructs indicated, compared with control vector-transfected cells (neg-1). H, superoxide generation in indicated cell lines was determined in the presence or absence of superoxide dismutase by nitroblue tetrazolium reduction assay. The data are shown as triplicates; bars, ±SE.

 
The Effects of siNox1 Are Rescued by a Construct That Cannot Be Knocked Out by siNox1 Constructs.
In another set of control experiments, we tested whether the effects of siNox1 are rescued by a construct that cannot be knocked out by siNox1 constructs. For this purpose, K-Ras-NRK/siNox1-N-7 cells, in which the endogenous rat Nox1 had been silenced, were stably transfected with GFP-human Nox1. GFP-human Nox1 does not contain the rat Nox1 sequences chosen for siNox1 constructs, so that its expression is not suppressed by siNox1-N as mentioned above. Both a rounded morphology and increased growth rate, similar to those of K-Ras-NRK cells, were restored in siNox1-N-7 cells after transfection of GFP-human Nox1 (Fig. 3, A–D)Citation . Similar rescue of transformation phenotypes was observed with other clones (data not shown). The results suggest that Nox1 contributes to oncogenic transformation by Ras, which is characterized by enhanced growth rate as well as by morphological alteration resulting from changes in organization of cytoskeletons and adhesive proteins. Because the DNA sequences chosen for rat Nox siRNA are absent in other Nox family members, it is unlikely that other Nox genes contributed to the transformation phenotypes.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. The effects of small interfering (si)Nox1 are rescued by a construct that cannot be knocked out by siNox1 constructs. K-Ras-NRK/siNox1-N-7 cells, in which the expression of endogenous rat Nox1 was inhibited, were stably transfected with pEGFP-C1 (green fluorescent protein; GFP) or GFP-human Nox1 (GFP-hNox1), and several clones were isolated and analyzed. As the representative examples, the data with K-Ras-NRK/siNox1-N-7 cells transfected with GFP (clone GFP-59) and K-Ras-NRK/siNox1-N-7 cells transfected with GFP-hNox1 (clone GFP-hNox1–3) were shown. Similar results were obtained with other clones. A, GFP- or GFP-hNox1 expression was detected by immunoblotting. B, anchorage-independent cell growth of indicated cell lines on soft agar. Triplicates are shown; bars, ± SE. C, growth curves for indicated cell lines. The procedure is the same as described in Fig. 2. DCitation , comparison of morphological changes among cell lines indicated. Note that K-Ras-NRK/siNox1-N-7 cells maintained elongated morphology on GFP transfection (GFP), whereas they became round similar to K-Ras-NRK cells upon GFP-hNox1 transfection (GFP-hNox1). Scale bar shows 30 µm.

 
A Nox1 Inhibitor Diphenylene Iodonium Affects Morphologies of Ras-Transformed Cells.
The involvement of ROS in Ras-transformation phenotype can be concluded from the following observations. K-Ras-NRK cells transiently assumed a flat cell morphology close to that of NRK cells when K-Ras-NRK cells were treated with the general flavoprotein inhibitor diphenylene iodonium (Fig. 4)Citation or antioxidant N-acetyl cysteine (10 mM; data not shown) overnight. This morphological reversion was also detectable in PD98059-treated K-Ras-NRK cells (Fig. 4)Citation , which is consistent with the idea that up-regulation of Nox1 by the Ras-MAPKK-MAPK pathway is crucial for Ras transformation.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. A Nox1 inhibitor, diphenylene iodonium (DPI) affects morphologies of Ras-transformed cells. DPI (20 µM), or PD98059 (30 µM) was added to NRK or K-Ras-NRK cells. The next day, the morphological changes were examined and photographs were taken. Scale bar shows 30 µm.

 
The siNox1s Suppress Ras-Induced Tumor Formation.
To test if the Ras-transformed cells can become less tumorigenic cells through overexpression of Nox1 siRNAs, control or siNox1 vector-transfected K-Ras-NRK cells were implanted into athymic mice. As shown in Fig. 5Citation , the control vector-transfected cells produced aggressive tumors within 2 weeks. By contrast, expression of siNox1 resulted in a marked decrease in tumor growth. Histologically, tumors formed by Nox1-overexpressing K-Ras-NRK cells exhibited an increased vascularity (data not shown), which is in agreement with the ability of Nox1 to trigger angiogenic switch, increasing vascular endothelial growth factor production (23) . The majority of cells in small tumors formed by siNox1 vector-transfected cells appeared to undergo necrosis (data not shown). Thus, Nox1 siRNAs inhibited development of tumors derived from Ras-transformed cells.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Tumor-formation by small interfering Nox1 or control vector transfected cell lines. Each of the cell lines established as described in Fig. 2Citation was injected into nude mice and the tumor volume ({blacksquare}) was measured; bars, ±SE. Fractional numbers show the ratio of the mice bearing tumors to the total mice used: tumors:total.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although previous studies suggested the contribution of ROS production to Ras transformation (13) , it was obscure which oxidase has a clear mediating role in Ras oncogenic transformation. Here, we have shown that oncogenic Ras constitutively up-regulates expression of Nox1 through the MAPKK-MAPK pathway and that the ROS generating activity of Nox1 is required for cell transformation and tumorigenicity by Ras oncogene (see the schematic model in Fig. 6Citation ). Perhaps, increased intracellular ROS perturbs the important metabolic signalings, resulting in malignant transformation. Our study reveals a new molecular mechanism for the Ras transformation, in which a redox signaling molecule Nox1 functions as a critical mediator downstream of Ras. Irani et al. (13) reported previously that superoxide-controlling mitogenic activity in Ras-transformed cells is mediated through a MAPK-independent pathway, based on their observation that MAPK was not activated in H-Ras-Val12 transformed NIH3T3 cells, whereas superoxide generation was elevated in the cells. Unlike the published results, however, we detected the constitutive activation of MAPK in Ras-transformed cells, which was also observed by many other studies (for example, 17, 18, 19 ). The discrepancy is not clear at present, and it may depend on the experimental procedures or biological system used.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. A model for the Nox1 function in cell transformation. Growth factor (GF) stimulation of its receptor tyrosine kinase (RTK) induces the Nox1 expression via the Ras/Raf/mitogen-activated protein kinase (MAPK) kinase/MAPK pathway and Nox1 generates reactive oxygen species (ROS) as a signaling molecule in normal growth control. Oncogenic Ras (RasV12) constitutively activates the Nox1 expression, and increased ROS generation perturbs the growth control, contributing cell transformation.

 
Our results indicate that silencing Nox1 expression by siRNA vectors resulted in both decreased growth rate and morphological reversion in K-Ras-NRK cells, suggesting that ROS generated by Nox1 targets at least two signaling pathways involved in cell growth control and reorganization of cytoskeletons. Regarding mitogenic control, tyrosine phosphorylation of MAPK and epidermal growth factor receptor was blocked by inhibition of the platelet-derived growth factor-induced increase in H2O2 (3) and depletion of epidermal growth factor-induced H2O2 (23) , respectively. The inactivation of protein-tyrosine phosphatase by ROS seems to aid the maintenance of maximal tyrosine phosphorylation and growth factor-stimulated cell proliferation (4 , 24) . Therefore, Nox1 might participate in regulation of cellular DNA synthesis in protein tyrosine phosphorylation/dephosphorylation-dependent fashion. As for cytoskeleton reorganization, redox-dependent down-regulation of Rho by Rac has been shown recently to influence actin cytoskeleton rearrangement including lamellipodia formation and membrane ruffling (25) . Because these small G proteins are integrated into the Ras signaling pathway, this regulatory system could mediate the Nox1 effects on cell morphology and migration.

Our discovery gives rise to a possibility that Nox1 may play a mediating role in neoplastic growth of human cancer, in which activation mutations of K-Ras at codon 12 have been detected in 90% of pancreatic cancers and 50% of colon cancers (26) . In preliminary studies, we found that the Nox1 expression was up-regulated in some pancreatic cancer cells and that suppression of Nox1 blocked their transformation phenotypes.4 Considering that ROS have been associated with tumor promotion and ROS production in malignant cells may involve induction of ROS-generating enzymes (27) , Nox1 could be a potential molecular target for therapeutic intervention of cancer development.


    ACKNOWLEDGMENTS
 
We thank Drs. E. Nishida, J. Downward, and M. Symons for the generous gift of MAPKK, RasVal12, and Rac1Asn17 plasmid DNAs. We also thank Drs. J. Nakayama and S. Ishizone for technical help.


    FOOTNOTES
 
Grant support: Grant-in Aid for Cancer Research from the Ministry of Education, Science and Culture of Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Tohru Kamata, Department of Molecular Biology and Biochemistry, Shinshu University School of Medicine, Asahi 3-1-1, Matsumoto, Nagano 390-8621, Japan. Phone: 81-263-37-2601; Fax: 81-263-37-2604; E-mail: kamatat{at}sch.md.shinshu-u.ac.jp

3 Y. Shibai, Y. Adachi, J. Mitsushita, and T. Kamata, unpublished observations. Back

4 T. Mochizuki and J. Mitsushita, unpublished observations. Back

Received 12/15/03. Revised 3/ 3/04. Accepted 3/10/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rhee SG, Chang TS, Bae YS, Lee SR, Kang SW Cellular regulation by hydrogen peroxide. J Am Soc Nephrol, 14: S211-5, 2003.[Abstract/Free Full Text]
  2. Esposito LA, Melov S, Panov A, Cottrell BA, Wallace DC Mitochondrial disease in mouse results in increased oxidative stress. Proc Natl Acad Sci USA, 96: 4820-5, 1999.[Abstract/Free Full Text]
  3. Sundaresan M, Yu ZX, Ferrans VJ, Irani K, Finkel T Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science (Wash DC), 270: 296-9, 1995.[Abstract/Free Full Text]
  4. Bae YS, Kang SW, Seo MS, et al Epidermal growth factor (EGF)-induced generation of hydrogen peroxide. Role in EGF receptor-mediated tyrosine phosphorylation. J Biol Chem, 272: 217-21, 1997.[Abstract/Free Full Text]
  5. Suzukawa K, Miura K, Mitsushita J, et al Nerve growth factor-induced neuronal differentiation requires generation of Rac1-regulated reactive oxygen species. J Biol Chem, 275: 13175-8, 2000.[Abstract/Free Full Text]
  6. Suh YA, Arnold RS, Lassegue B, et al Cell transformation by the superoxide-generating oxidase Mox1. Nature (Lond), 401: 79-82, 1999.[CrossRef][Medline]
  7. Geiszt M, Kopp JB, Várnai P, Leto TL Identification of renox, an NAD(P)H oxidase in kidney. Proc Natl Acad Sci USA, 97: 8010-4, 2000.[Abstract/Free Full Text]
  8. Kikuchi H, Hikage M, Miyashita H, Fukumoto M NADPH oxidase subunit, gp91(phox) homologue, preferentially expressed in human colon epithelial cells. Gene (Amst), 254: 237-43, 2000.[CrossRef][Medline]
  9. Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene (Amst), 269: 131-40, 2001.[CrossRef][Medline]
  10. Lassègue B, Sorescu D, Szöcs K, et al Novel gp91(phox) homologues in vascular smooth muscle cells: nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ Res, 88: 888-94, 2001.[Abstract/Free Full Text]
  11. Arnold RS, Shi J, Murad E, et al Hydrogen peroxide mediates the cell growth and transformation caused by the mitogenic oxidase Nox1. Proc Natl Acad Sci USA, 98: 5550-5, 2001.[Abstract/Free Full Text]
  12. Rodriguez-Viciana P, Warne PH, Khwaja A, et al Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell, 89: 457-67, 1997.[CrossRef][Medline]
  13. Irani K, Xia Y, Zweier JL, et al Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts. Science (Wash DC), 275: 1649-52, 1997.[Abstract/Free Full Text]
  14. Der CJ, Stanbridge EJ Lack of correlation between the decreased expression of cell surface LETS protein and tumorigenicity in human cell hybrids. Cell, 15: 1241-51, 1978.[CrossRef][Medline]
  15. Kamata T, Sullivan NF, Wooten MW Reduced protein kinase C activity in a ras-resistant cell line derived from Ki-MSV transformed cells. Oncogene, 1: 37-46, 1987.[Medline]
  16. Fukuda M, Gotoh I, Adachi M, Gotoh Y, Nishida E A novel regulatory mechanism in the mitogen-activated protein (MAP) kinase cascade. Role of nuclear export signal of MAP kinase kinase. J Biol Chem, 272: 32642-8, 1997.[Abstract/Free Full Text]
  17. Reuveni H, Geiger T, Geiger B, Levitzki A Reversal of the Ras-induced transformed phenotype by HR12, a novel ras farnesylation inhibitor, is mediated by the Mek/Erk pathway. J Cell Biol, 151: 1179-92, 2000.[Abstract/Free Full Text]
  18. Chen JC, Zhuang S, Nguyen TH, Boss GR, Pilz RB Oncogenic Ras leads to Rho activation by activating the mitogen-activated protein kinase pathway and decreasing Rho-GTPase-activating protein activity. J Biol Chem, 278: 2807-18, 2003.[Abstract/Free Full Text]
  19. Hanson JL, Anest V, Reuther-Madrid J, Baldwin AS Oncoprotein suppression of tumor necrosis factor-induced NF {kappa}B activation is independent of Raf-controlled pathways. J Biol Chem, 278: 34910-7, 2003.[Abstract/Free Full Text]
  20. Kim SK Functional genomics: the worm scores a knockout. Curr Biol, 11: R85-7, 2001.[CrossRef][Medline]
  21. Elbashir SM, Harborth J, Lendeckel W, et al Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond), 411: 494-8, 2001.[CrossRef][Medline]
  22. van de Wetering M, Oving I, Muncan V, et al Specific inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector. EMBO Rep, 4: 609-15, 2003.[CrossRef][Medline]
  23. Arbiser JL, Petros J, Klafter R, et al Reactive oxygen generated by Nox1 triggers the angiogenic switch. Proc Natl Acad Sci USA, 99: 715-20, 2002.[Abstract/Free Full Text]
  24. Lee AC, Fenster BE, Ito H, et al Ras proteins induce senescence by altering the intracellular levels of reactive oxygen species. J Biol Chem, 274: 7936-40, 1999.[Abstract/Free Full Text]
  25. Nimnual AS, Taylor LJ, Bar-Sagi D Redox-dependent downregulation of Rho by Rac. Nat Cell Biol, 5: 236-41, 2003.[CrossRef][Medline]
  26. Gibbs JB, Oliff A, Kohl NE Farnesyltransferase inhibitors: Ras research yields a potential cancer therapeutic. Cell, 77: 175-8, 1994.[CrossRef][Medline]
  27. Szatrowski TP, Nathan CF Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res, 51: 794-8, 1991.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Sci SignalHome page
A. M. Weaver
Regulation of Cancer Invasion by Reactive Oxygen Species and Tks Family Scaffold Proteins
Sci. Signal., September 15, 2009; 2(88): pe56 - pe56.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
B. Diaz, G. Shani, I. Pass, D. Anderson, M. Quintavalle, and S. A. Courtneidge
Tks5-Dependent, Nox-Mediated Generation of Reactive Oxygen Species Is Necessary for Invadopodia Formation
Sci. Signal., September 15, 2009; 2(88): ra53 - ra53.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Yamaura, J. Mitsushita, S. Furuta, Y. Kiniwa, A. Ashida, Y. Goto, W. H. Shang, M. Kubodera, M. Kato, M. Takata, et al.
NADPH Oxidase 4 Contributes to Transformation Phenotype of Melanoma Cells by Regulating G2-M Cell Cycle Progression
Cancer Res., March 15, 2009; 69(6): 2647 - 2654.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. V. Recktenwald, R. Kellner, R. Lichtenfels, and B. Seliger
Altered Detoxification Status and Increased Resistance to Oxidative Stress by K-Ras Transformation
Cancer Res., December 15, 2008; 68(24): 10086 - 10093.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. S. Arnold, J. He, A. Remo, D. Ritsick, Q. Yin-Goen, J. D. Lambeth, M. W. Datta, A. N. Young, and J. A. Petros
Nox1 Expression Determines Cellular Reactive Oxygen and Modulates c-fos-Induced Growth Factor, Interleukin-8, and Cav-1
Am. J. Pathol., December 1, 2007; 171(6): 2021 - 2032.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. J. Miller Jr, M. Filali, G. J. Huss, B. Stanic, A. Chamseddine, T. J. Barna, and F. S. Lamb
Cytokine Activation of Nuclear Factor {kappa}B in Vascular Smooth Muscle Cells Requires Signaling Endosomes Containing Nox1 and ClC-3
Circ. Res., September 28, 2007; 101(7): 663 - 671.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Shinohara, W.-H. Shang, M. Kubodera, S. Harada, J. Mitsushita, M. Kato, H. Miyazaki, H. Sumimoto, and T. Kamata
Nox1 Redox Signaling Mediates Oncogenic Ras-induced Disruption of Stress Fibers and Focal Adhesions by Down-regulating Rho
J. Biol. Chem., June 15, 2007; 282(24): 17640 - 17648.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. R. McClelland, S. L. Carskadon, L. Zhao, E. S. White, D. G. Beer, M. B. Orringer, A. Pickens, A. C. Chang, and D. A. Arenberg
Diversity of the Angiogenic Phenotype in Non-Small Cell Lung Cancer
Am. J. Respir. Cell Mol. Biol., March 1, 2007; 36(3): 343 - 350.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
K. Bedard and K.-H. Krause
The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology
Physiol Rev, January 1, 2007; 87(1): 245 - 313.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. G. Havens, A. Ho, N. Yoshioka, and S. F. Dowdy
Regulation of Late G1/S Phase Transition and APCCdh1 by Reactive Oxygen Species
Mol. Cell. Biol., June 15, 2006; 26(12): 4701 - 4711.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y. Kuwano, T. Kawahara, H. Yamamoto, S. Teshima-Kondo, K. Tominaga, K. Masuda, K. Kishi, K. Morita, and K. Rokutan
Interferon-{gamma} activates transcription of NADPH oxidase 1 gene and upregulates production of superoxide anion by human large intestinal epithelial cells
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C433 - C443.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kawahara, D. Ritsick, G. Cheng, and J. D. Lambeth
Point Mutations in the Proline-rich Region of p22phox Are Dominant Inhibitors of Nox1- and Nox2-dependent Reactive Oxygen Generation
J. Biol. Chem., September 9, 2005; 280(36): 31859 - 31869.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Ameziane-El-Hassani, S. Morand, J.-L. Boucher, Y.-M. Frapart, D. Apostolou, D. Agnandji, S. Gnidehou, R. Ohayon, M.-S. Noel-Hudson, J. Francon, et al.
Dual Oxidase-2 Has an Intrinsic Ca2+-dependent H2O2-generating Activity
J. Biol. Chem., August 26, 2005; 280(34): 30046 - 30054.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Boureux, O. Furstoss, V. Simon, and S. Roche
Abl tyrosine kinase regulates a Rac/JNK and a Rac/Nox pathway for DNA synthesis and Myc expression induced by growth factors
J. Cell Sci., August 15, 2005; 118(16): 3717 - 3726.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Heo and S. L. Campbell
Superoxide Anion Radical Modulates the Activity of Ras and Ras-related GTPases by a Radical-based Mechanism Similar to That of Nitric Oxide
J. Biol. Chem., April 1, 2005; 280(13): 12438 - 12445.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitsushita, J.
Right arrow Articles by Kamata, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitsushita, J.
Right arrow Articles by Kamata, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online