Cancer Research Annual Meeting 2010  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shivapurkar, N.
Right arrow Articles by Gazdar, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shivapurkar, N.
Right arrow Articles by Gazdar, A. F.
[Cancer Research 64, 3757-3760, June 1, 2004]
© 2004 American Association for Cancer Research


Advances in Brief

Presence of Simian Virus 40 DNA Sequences in Human Lymphoid and Hematopoietic Malignancies and Their Relationship to Aberrant Promoter Methylation of Multiple Genes

Narayan Shivapurkar1,2, Takao Takahashi1, Jyotsna Reddy1, Yingye Zheng4, Victor Stastny1, Robert Collins3, Shinichi Toyooka1, Makato Suzuki1, Gunjan Parikh1, Sheryl Asplund2, Steven H. Kroft2, Charles Timmons2, Robert W. McKenna2, Ziding Feng4 and Adi F. Gazdar1,2

1 Hamon Center for Therapeutic Oncology Research, 2 Departments of Pathology, 3 Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas, and 4 Public Health Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The simian polyoma virus SV40 has been detected in specific human tumors including non-Hodgkin’s lymphomas, although a causative role for the virus has not been convincingly demonstrated. Aberrant methylation of CpG islands in promoter regions is a frequent method of silencing tumor suppressor genes (TSGs) in cancers and may be induced by oncogenic viruses. We investigated the relationship between the presence of SV40 or EBV DNA sequences and the methylation profiles for 10 TSGs in 90 cases of non-Hodgkin’s lymphomas/leukemias and 56 control tissues. SV40 sequences were present in 33/90 (37%) non-Hodgkin’s lymphomas/leukemias, and EBV was present in 11/42 (26%) of non-Hodgkin’s lymphomas. We found a highly significant correlation between the presence of SV40 and methylation of seven genes (P values, 0.006 to <0.0001). In lymphomas, there was no relationship between EBV and methylation. Oncogenic viruses and methylation were rarely present in control tissues. We investigated methylation of the same 10 TSGs in peripheral blood mononuclear cells (PBMC) from a healthy volunteer infected with EBV or EBV and SV40. Promoter methylation of CDH1 and CDH13 were noted in dual SV40- and EBV-infected PBMC, and these two genes were also highly significantly correlated to the presence of SV40 sequences in tumors. SV40 infection also resulted in appearance of the lymphoma/leukemia-specific marker, methylated SHP1. Methylation was completely absent in uninfected and EBV-infected PBMC. Our results demonstrate that the presence of SV40 in hematological malignancies is associated with promoter methylation of TSGs and that in all probability, the virus plays a role in tumor pathogenesis.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
SV40 is a potent oncogenic virus of rhesus monkey origin and seems to have spread to human beings via contamination of poliovirus stocks between 1955 and 1963 as well as by other means (1) . Inoculation of SV40 into hamsters results in the formation of mesotheliomas, brain tumors, bone tumors, lymphomas, and leukemias (reviewed in Ref. 2 ). Previous reports have found SV40 sequences in mesotheliomas, bone and brain tumors of human origin, lymphomas (reviewed in Rev. 2 ), and as demonstrated herein, we have recently extended these findings to leukemias. Although these observations indicate an association between the virus and specific human tumors, they do not demonstrate a causal role.

Aberrant promoter methylation of CpG-rich areas of promoter regions is the most frequent mechanism of TSG silencing in human tumors (3) . We have demonstrated previously that methylation of the TSG RASSF1A in malignant mesotheliomas is highly significantly associated with the presence of SV40 sequences (4 , 5) and that SV40 infection of normal human mesothelial cells resulted in progressive methylation of the gene (5) . For these reasons, we examined the methylation profile of 90 human lymphomas/leukemias, by testing aberrant methylation of 10 known or suspected TSGs and correlated the data with the presence of SV40 or EBV sequences.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Except for 19 specimens, personnel performing laboratory studies were blinded to the clinico-pathological diagnoses. Personnel performing viral assays (N. S. and V. S.) and methylation assays (T. T. and J. R.) were blinded to each other’s results. Additionally, the person (V. S.) performing real-time PCR analysis was blinded to results from conventional PCR analysis.

Tumors and Control Specimens.
Tumors and tissues were obtained from the University of Texas Southwestern Medical Center affiliated hospitals, after receiving Institutional Review Board permission. They included 90 tumors (42 non-Hodgkin’s lymphomas and 48 leukemias). The lymphomas included 36 B-cell and 6 T-cell lymphomas; 7 were of high grade (Burkitt’s lymphoma) and 35 were of intermediate grade (diffuse large B cell, mantle cell, large cell anaplastic, follicular, and marginal zone). The leukemias consisted of 38 acute and 10 chronic of lymphoid or myeloid origin. Of the hematological malignancies, 62 samples had flow cytometric analysis that included determination of the percentage of tumor cells. The 56 nonmalignant tissue samples consisted of bone marrows (n = 10), peripheral blood (n = 42), and lymph nodes (n = 4) from healthy volunteers (n = 15), patients with nonmalignant hematological diseases (n = 11), or patients with hematological malignancies in remission (n = 30). The peripheral blood samples included three that were enriched for stem cells (0.5–1% stem cells).

Infection of Peripheral Blood Lymphocytes with EBV and SV40 Viruses.
Peripheral blood mononuclear cells were isolated from a healthy volunteer and infected with EBV, SV40, or both viruses at a multiplicity of infection of 50–100 plaque forming units/cell (6) . EBV virus stock was harvested from a chronically infected marmoset cell line (obtained from Dr. Nancy Schneider, University of Texas Southwestern Medical Center, Dallas, TX). SV40 virus stocks were obtained from Dr. M. Carbone (Loyola University Medical Center, Chicago, IL) as lysates from infected green African monkey kidney cells.

DNA Preparation and PCR Analyses.
DNA was extracted (7) and analyzed for the presence of SV40 Tag sequences using primers that PCR amplified a specific 156-bp region of the large Tag of SV40 (8) . Southern blotting and sequencing were performed on the resultant amplicons (Fig. 1)Citation . For analysis of EBV and SV40 sequences, real-time PCR assays based on TaqMan technology (Perkin-Elmer Corp., Foster City, CA) were used (9) .



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Representative examples of MSP assay and Southern blot (SB) analysis for SV40 Tag sequences. Data from six SV40-positive (SV40+ve 1–6) and six SV40-negative (SV40–ve 7–12) lymphoma/leukemia cases are illustrated. DNAs were analyzed for the presence of SV40 Tag sequences using primers that amplified a 156-bp region of the large Tag of SV40 (8 , 19) . The amplicon sequence is specific only for SV40 and not for JC or BK. PCR products were electrophoresed on a 2% agarose gel and visualized by ethidium bromide staining. To confirm the specificity of the PCR products, Southern blotting and sequencing were performed on the resultant amplicons as described in "Materials and Methods." MSP assay was performed essentially as described by Herman et al. (11) . Methylation of death associated (DAP) kinase gene was analyzed using combined restriction analysis (13) . The unmethylated form of p16 was run as an internal control for bisulfite treatment. The data show more genes methylated in SV40-positive cases than in SV40-negative cases. SHP1 was methylated in all samples irrespective of methylation status.

 
Serial dilutions of DNAs from an EBV-transformed human B lymphoblastoid culture and from a SV40-transformed hamster cell line (obtained from Dr. M. Carbone) were used to create a standard curve.

The sequences of primers and probes used to amplify and specifically detect EBV sequences were as described previously (10) . ß-Actin was used as an internal control for both assays. The sequences of primers and probes used to amplify and specifically detect SV40 sequences were located within the same SV40 region targeted by conventional PCR and were as follows: TGAGAGTCAGCAGT-AGCCTCATCA (forward primer; nucleotides 4448–4479); GTGGAATGCCTTTAATGAGGAAA (reverse primer; nucleotides 4514–4536); and 6FAM-5'-CACTAGATGGCATTTCTTCTGAGCAAAACAGG-3''-BHQ1(probe; nucleotides 4481–4512).

Conventional PCR methods for detection of methylated promoter genes were as described previously (4 , 11 , 12) . Bisulfite-treated DNA was tested by methylation-specific PCR (MSP) assays for all genes except for DAP kinase, which was tested for using a combined restriction analysis method (13) .

Statistical Analyses.
The frequencies of methylation between two groups were compared using Pearson {chi}2 tests. The methylation index (MI) of different groups was compared using the two-sample t test. Correlation value was analyzed by simple regression analysis test. For all tests, probability values of P < 0.05 were regarded as statistically significant.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We found SV40 Tag sequences in 33 of 90 (36%) hematological cancers. With one exception (a leukemic patient in remission), we did not detect SV40 sequences in any of the 56 control samples (peripheral blood, bone marrows, and lymph nodes). In all cases, Southern blotting confirmed the specific nature of the detected amplicon. SV40 sequences were present in 17 of 42 (40%) non-Hodgkin’s lymphomas and 16 of 48 (30%) leukemias. The mean ages of SV40-positive and SV40-negative cancer patients were 51 (3–87) and 44 (neonate–80) years, respectively, and the differences were not statistically significant. Representative examples of SV40- and methylation-positive and -negative cases are illustrated in Fig. 1Citation . Dilution experiments with leukemic samples indicated that at least 5% tumor cells were required for consistent, reproducible results.

Tumor cell percentage estimates (obtained by flow cytometric analysis) were available for 42 of the lymphoma/leukemia samples (18 of which were positive and 24 were negative for SV40 by conventional PCR-Southern blot analysis). Real-time PCR analysis of these 42 samples indicated complete concordance between the results of the two assays for SV40 Tag sequences (Fig. 2)Citation . The threshold cycle (CT) values for the positive samples displayed a wide range, varying from 34 to 49. The SV40 hamster cell line had a CT value of 26. The no template control and all 24 tumor samples negative by conventional PCR did not amplify at 50 cycles. Of particular interest, there was an excellent correlation (r = 0.904, P < 0.0001) between tumor cell percentage and CT value.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Relationship between percentage of tumor cells and threshold cycle (CT) for SV40 real-time PCR analysis. Real-time PCR assay for SV40 Tag was carried out as described in "Materials and Methods." Tumor cell number was determined by flow cytometry. The 24 SV40-negative tumors show CT values equal to that nontemplate control (also represents the lowest level of detection). These data confirm the specificity of the assay.

 
EBV sequences were detected in 11 (26%) of 42 lymphoma samples (including all seven Burkitt lymphoma cases), in two (4%) of 48 leukemia samples (both from patients with chronic lymphatic leukemia) and in two (3%) of 56 control samples (both from lymphoma patients in remission). Both SV40 and EBV were present in 17% (7/42) of the lymphomas, including five Burkitt lymphomas and two diffuse large B-cell lymphomas. The possible relationship between Burkitt lymphoma, EBV, and SV40 needs to be explored further.

To examine whether there was any association between methylation and presence of SV40, frequencies of methylation for each gene in SV40-positive and SV40-negative samples were compared. The frequencies of methylation of the 10 genes in hematological malignancies varied from 19% for p73 to 97% for SHP1. For seven genes (CDH1, CDH13, p16, DcR1, DcR2, CRBP, and DAP kinase), the methylation frequencies were significantly higher in SV40-positive than SV40-negative cases, with P values ranging from 0.006 to <0.0001 (Fig. 3)Citation . There were no important differences between the methylation patterns of leukemias and lymphomas except that the differences between SV40-positive and -negative cases were statistically not significant for p16 and CRBP genes in leukemias and not significant for CDH1 in lymphomas (Fig. 3)Citation . Similar comparisons for EBV-positive and -negative lymphoma cases revealed no significant differences for any of the 10 genes studied (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A comparison of frequency of aberrant methylation between: total lymphoma and leukemia (SV40 positive and SV40 negative; A), lymphomas alone (SV40 positive and SV40 negative; B), and leukemias alone (SV40 positive and SV40 negative; C). MSP assay was performed essentially as described by Herman et al. (11) and in Fig. 1Citation . The frequencies of methylation in SV40-positive and SV40-negative groups were compared using {chi}2 test; n, number of examined samples. D, comparison of MI between all lymphoma and leukemia cases (SV40 positive and SV40 negative); lymphomas alone (SV40 positive and SV40 negative); leukemias alone (SV40 positive and SV40 negative). The MSP assay was performed essentially as described by Herman et al. (11) and in Fig. 1Citation . MIs in SV40-positive and SV40-negative groups were compared using two-sample t test.

 
The mean MI (a reflection of the overall methylation frequencies for all genes tested) of SV40-positive cases was significantly higher than that of SV40-negative cases for all tumor cases and for lymphomas and leukemias individually (Fig. 3)Citation . Similar comparisons for EBV-positive (0.41 ± 0.05) and EBV-negative (0.33 ± 0.03) lymphoma cases revealed no significant differences for the mean MIs. SHP1, an inhibitor of the JAK/STAT pathway has been reported to be frequently methylated in lymphomas and leukemias. The SHP1 gene was methylated in 88 (97%) of the 90 hematological malignancies and in only one of the control samples (from a patient in remission). Of great interest, this sample was the only control sample positive for SV40.

Uninfected PBMC survived for only a few days. SV40-infected cells grew as adherent single cells having macrophage-like morphology for 14–16 days and then underwent lysis. EBV virus-infected cells, with or without the addition of SV40, grew as relatively rapidly dividing floating cells with uropod formation and exhibited morphology typical of EBV-transformed B cells (14) . However, in the doubly infected cells, some attached macrophage-like cells also were present. After 6 weeks, both adherent and floating cells were harvested for molecular analyses. PCR-based assays indicated approximately equivalent amounts of EBV in single-infected (EBV) and dual-infected cultures. Real-time assays for SV40 indicated that the EBV virus-infected cells were negative for SV40 virus, whereas the dual-infected cells were positive, with a value (CT of 23) higher than that of the SV40-transformed hamster cell line (CT of 26).

MSP assays for methylation status of the 10 genes were performed on the EBV virus-infected and dual virus-infected cultures 6 weeks after infection. None of the genes was methylated in the uninfected or EBV-infected cultures. For the dual EBV- and SV40-infected cells, three of the 10 genes (CDH1, CDH13, and SHP1) were methylated 6 weeks after infection (Fig. 4)Citation .



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Promoter methylation profile in EBV and EBV+SV40-infected PBMC. PBMC were infected with EBV or EBV+SV40 as described in "Materials and Methods." MSP assays for 10 TSGs was performed as described in "Materials and Methods" (also see Fig. 1Citation ). The unmethylated form of p16 was run as an internal control for bisulfite treatment. The data show methylation of CDH1, CDH13, and SHP1 in EBV+SV40-infected group but none in only EBV alone-infected group.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Previous studies from our laboratory and others (reviewed in Refs. 2 and 15 ) detected SV40 T-ag sequences in a subset of lymphomas. However, two recent studies from Europe have not supported these observations (16 , 17) . A recent meta analysis of the published literature supported the association between SV40 and certain human cancers including lymphomas (18) . In the present study, we found viral sequences in 40% of lymphomas, compared with 43% in our previous study (19) . We extended these findings in the present study and found SV40 Tag sequences in 30% of leukemias of both acute and chronic types. SV40 sequences, with one exception, were absent in marrow, blood, and lymph node samples from healthy volunteers, patients with nonmalignant hematological diseases, and patients with hematological malignancies in remission. For the SV40-positive cases, there was a 97% concordance with tumor cell presence (as detected by flow cytometry) and 100% concordance with methylation of SHP1, an almost universal marker for lymphomas and leukemias (20) . In addition, there was complete concordance between the two PCR assays for T-ag and an excellent concordance between tumor cell percentage and CT value as detected by real-time PCR. These data are powerful evidence that the SV40 sequences are directly related to the presence of tumor cells.

Although we failed to detect SV40 in tissues from subjects without malignancy, it is possible that SV40 was present in nonmalignant tissues from patients with hematological cancers (and possibly in some of the control cases) but at levels that were not detected by our techniques. EBV sequences were, with rare exceptions, limited to lymphomas (26%) and were occasionally detected in subjects without malignancy.

Because previous reports suggest an association between aberrant methylation of TSGs and oncogenic viruses including SV40, we explored such a relationship in hematological cancers. Our previous studies indicated a relationship between the presence of SV40 and methylation of the RASSF1A gene in malignant mesotheliomas (4) and during transformation of mesothelial cells by the virus (5) . In our present studies, we found a highly significant relationship between the presence of SV40 viral sequences and promoter methylation in hematological malignancies for seven of the 10 TSGs analyzed. Because SV40 was absent and the MI was low in controls, these changes were characteristic of tumors. Because statistical analysis showed no relationship between EBV and methylation in lymphoma/leukemia the relationship was limited to SV40, although EBV has been associated with increased methylation rates in gastric cancers (21) . These findings indicate that EBV, may have different biological effects upon infection and transformation of different cell types. Although, the exact mechanism of aberrant methylation in SV40-positive cancers remains to be determined, the seven involved TSGs are located on five different chromosomal loci. Of interest, p16 and p15, which are located in tandem at chromosome 9p21, showed differential methylation, with p16, but not p15 being associated with SV40. Thus, SV40-associated hypermethylation is not a localized process restricted to one or a limited number of chromosomal loci but is a generalized process affecting CpG islands at multiple genomic sites. Promoter region methylation of multiple genes is a characteristic feature of all tumors (3) . As SV40 appears to be neither necessary nor sufficient to induce cancer (2) , methylation of some genes must also be present in tumors that are not virus associated. Thus, the virus-positive and -negative tumors had similar frequencies of methylation for three genes. These findings suggest that the methylation patterns of the two groups of tumors share certain similarities and differences, although our present study did not identify any genes whose methylation is characteristic of the virus-negative group.

Infection of PBMC with EBV resulted in lymphoblastoid transformation (14) , whereas infection with SV40 resulted in the appearance of attached cells with macrophage morphology. These cells underwent lysis, which was complete by 6 weeks after infection. These findings suggest that SV40 infection resulted in productive infection rather than transformation (2) . Dual infection with EBV and SV40 resulted in the appearance of a mixed population of nonadherent lymphoblastoid cells and adherent macrophage-like cells containing the sequences of both viruses. Of particular importance, promoter methylation of CDH1 and CDH13 was noted in dual SV40- and EBV-infected PBMC, and these two genes were highly significantly correlated to the presence of SV40 sequences in tumors. SV40 infection also resulted in methylation of the lymphoma/leukemia-specific marker SHP1. Methylation was completely absent in uninfected and EBV-infected PBMC, confirming the specific association between SV40 infection and methylation. Additionally, detection of methylation of SHP1in SV40-positive EBV PBMC (although not in PBMC infected with EBV alone) supports the hypothesis that SV40 might be a causative agent in hematological malignancies. By an incompletely understood mechanism, DNA methyltransferases cooperate to catalyze overlapping but individualized genomic DNA methylation profiles of different cancer types (3 , 22) . A recent report indicates that transformation of a model system by SV40 and RAS resulted in expression of DNMT3b, which correlated with methylation and silencing of several TSGs (23) . Expression of SV40 T-ag increases histone acetylation and global histone acetyltransferase actions (24) . Thus SV40 modulates both methylation and histone deacetylation, epigenetic processes that result in gene silencing. Our finding of a highly significant correlation between the presence of SV40 and aberrant methylation of multiple TSGs suggests that in all probability, the virus plays a role in tumor pathogenesis. These findings have considerable public health implications.


    FOOTNOTES
 
Grant support: Early Detection Research Network, National Cancer Institute Grant 5U01CA8497102.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Adi F. Gazdar, Building NB7-206, Hamon Center for Therapeutic Oncology Research University of Texas Southwestern Medical Center, 6000 Harry Hines Boulevard, Dallas, TX 75390-8593. Phone: (214) 648-4921; Fax: (214) 648-4940; E-mail: Adi.Gazdar{at}UTSouthwestern.edu

Received 10/24/03. Revised 3/16/04. Accepted 4/ 8/04.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Butel JS, Lednicky JA Cell and molecular biology of simian virus 40: implications for human infections and disease. J Natl Cancer Inst (Bethesda), 91: 119-34, 1999.
  2. Gazdar AF, Butel JS, Carbone M SV40 and human tumours: myth, association or causality?. Nat Rev Cancer, 2: 957-64, 2002.[CrossRef][Medline]
  3. Esteller M, Herman JG Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J Pathol, 196: 1-7, 2002.[CrossRef][Medline]
  4. Toyooka S, Pass HI, Shivapurkar N, et al Aberrant methylation and simian virus 40 tag sequences in malignant mesothelioma. Cancer Res, 61: 5727-30, 2001.[Abstract/Free Full Text]
  5. Toyooka S, Carbone M, Toyooka KO, et al Progressive aberrant methylation of the RASSF1A gene in simian virus 40 infected human mesothelial cells. Oncogene, 21: 4340-4, 2002.[CrossRef][Medline]
  6. Rosenberg BH, Deutsch JF, Ungers GE Growth and purification of SV40 virus for biochemical studies. J Virol Methods, 3: 167-76, 1981.[CrossRef][Medline]
  7. Shivapurkar N, Wiethege T, Wistuba II, et al Presence of simian virus 40 sequences in malignant mesotheliomas and mesothelial cell proliferations. J Cell Biochem, 76: 181-8, 1999.[CrossRef][Medline]
  8. Huang H, Reis R, Yonekawa Y, Lopes JM, Kleihues P, Ohgaki H Identification in human brain tumors of DNA sequences specific for SV40 large T antigen. Brain Pathol, 9: 33-42, 1999.[Medline]
  9. Toyooka KO, Toyooka S, Virmani AK, et al Loss of expression and aberrant methylation of the CDH13 (H-cadherin) gene in breast and lung carcinomas. Cancer Res, 61: 4556-60, 2001.[Abstract/Free Full Text]
  10. Jebbink J, Bai X, Rogers BB, Dawson DB, Scheuermann RH, Domiati-Saad R Development of real-time PCR assays for the quantitative detection of Epstein-Barr virus and cytomegalovirus, comparison of TaqMan probes, and molecular beacons. J Mol Diagn, 5: 15-20, 2003.[Abstract/Free Full Text]
  11. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA, 93: 9821-6, 1996.[Abstract/Free Full Text]
  12. van Noesel MM, van Bezouw S, Salomons GS, et al Tumor-specific down-regulation of the tumor necrosis factor-related apoptosis-inducing ligand decoy receptors DcR1 and DcR2 is associated with dense promoter hypermethylation. Cancer Res, 62: 2157-61, 2002.[Abstract/Free Full Text]
  13. Toyooka S, Toyooka KO, Miyajima K, et al Epigenetic down-regulation of death-associated protein kinase in lung cancers. Clin Cancer Res, 9: 3034-41, 2003.[Abstract/Free Full Text]
  14. Young LS, Murray PG Epstein-Barr virus and oncogenesis: from latent genes to tumours. Oncogene, 22: 5108-21, 2003.[CrossRef][Medline]
  15. Nakatsuka S, Liu A, Dong Z, et al Simian virus 40 sequences in malignant lymphomas in Japan. Cancer Res, 63: 7606-8, 2003.[Abstract/Free Full Text]
  16. MacKenzie J, Wilson KS, Perry J, Gallagher A, Jarrett RF Association between simian virus 40 DNA and lymphoma in the United Kingdom. J Natl Cancer Inst (Bethesda), 95: 1001-3, 2003.[Abstract/Free Full Text]
  17. Capello D, Rossi D, Gaudino G, Carbone A, Gaidano G Simian virus 40 infection in lymphoproliferative disorders. Lancet, 361: 88-9, 2003.[CrossRef][Medline]
  18. Vilchez RA, Kozinetz CA, Arrington AS, Madden CR, Butel JS Simian virus 40 in human cancers. Am J Med, 114: 675-84, 2003.[CrossRef][Medline]
  19. Shivapurkar N, Harada K, Reddy J, et al Presence of simian virus 40 DNA sequences in human lymphomas. Lancet, 359: 851-2, 2002.[CrossRef][Medline]
  20. Oka T, Ouchida M, Koyama M, et al Gene silencing of the tyrosine phosphatase SHP1 gene by aberrant methylation in leukemias/lymphomas. Cancer Res, 62: 6390-4, 2002.[Abstract/Free Full Text]
  21. Kang GH, Lee S, Kim WH, et al Y. Epstein-Barr virus-positive gastric carcinoma demonstrates frequent aberrant methylation of multiple genes and constitutes CpG island methylator phenotype-positive gastric carcinoma. Am J Pathol, 160: 787-94, 2002.[Abstract/Free Full Text]
  22. Slack A, Cervoni N, Pinard M, Szyf M DNA methyltransferase is a downstream effector of cellular transformation triggered by simian virus 40 large T antigen. J Biol Chem, 274: 10105-12, 1999.[Abstract/Free Full Text]
  23. Soejima K, Fang W, Rollins BJ DNA methyltransferase 3b contributes to oncogenic transformation induced by SV40T antigen and activated Ras. Oncogene, 22: 4723-33, 2003.[CrossRef][Medline]
  24. Valls E, de la Cruz X, Martinez-Balbas MA The SV40 T antigen modulates CBP histone acetyltransferase activity. Nucleic Acids Res, 31: 3114-22, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
P. J. ter Brugge, V. B. T. Ta, M. J. W. de Bruijn, G. Keijzers, A. Maas, D. C. van Gent, and R. W. Hendriks
A mouse model for chronic lymphocytic leukemia based on expression of the SV40 large T antigen
Blood, July 2, 2009; 114(1): 119 - 127.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Johne, D. Enderlein, H. Nieper, and H. Muller
Novel Polyomavirus Detected in the Feces of a Chimpanzee by Nested Broad-Spectrum PCR
J. Virol., March 15, 2005; 79(6): 3883 - 3887.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shivapurkar, N.
Right arrow Articles by Gazdar, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shivapurkar, N.
Right arrow Articles by Gazdar, A. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online