Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bouker, K. B.
Right arrow Articles by Clarke, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bouker, K. B.
Right arrow Articles by Clarke, R.
[Cancer Research 64, 4030-4039, June 1, 2004]
© 2004 American Association for Cancer Research


Endocrinology

Interferon Regulatory Factor-1 Mediates the Proapoptotic but Not Cell Cycle Arrest Effects of the Steroidal Antiestrogen ICI 182,780 (Faslodex, Fulvestrant)

Kerrie B. Bouker1, Todd C. Skaar1,3, David R. Fernandez1, Kerry A. O’Brien1, Rebecca B. Riggins1, Donghua Cao4 and Robert Clarke1,2

1 Department of Oncology and Lombardi Comprehensive Cancer Center and 2 Department of Physiology and Biophysics, Georgetown University School of Medicine, Washington, District of Columbia, and 3 Division of Clinical Pharmacology and 4 Department of Pharmacology and Toxicology, Indiana University Cancer Center and Department of Medicine, Indianapolis, Indiana


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Antiestrogens induce both cytostasis (cell cycle arrest) and apoptosis, but the relationship between these end points and the signaling that regulates their induction are unclear. We have previously implicated the transcription factor and putative tumor suppressor IFN regulatory factor-1 (IRF-1) in acquired antiestrogen resistance (Gu et al., Cancer Res, 62: 3428–3437, 2002). We now show the functional significance of IRF-1 in affecting antiestrogen responsiveness in estrogen receptor-positive antiestrogen-sensitive models (MCF-7, T47D, and ZR-75-1), a model of acquired antiestrogen resistance (MCF7/LCC9; estrogen receptor positive), and a model of de novo antiestrogen resistance (MDA-MB-231; estrogen receptor negative). Basal IRF-1 mRNA expression is lower in MCF7/LCC9 cells when compared with MCF-7, T47D, and ZR-75-1 cells. IRF-1 transcriptional activity in MCF-7/LCC9 cells is 18-fold lower than that seen in the parental cells (MCF-7/LCC1) and is comparable with that in MDA-MB-231 cells. Although IRF-1 mRNA expression is induced by ICI 182,780 in sensitive cells, this regulation is lost in MCF-7/LCC9 and is absent in MDA-MB-231 cells. Loss of IRF-1 regulation appears specific to antiestrogen resistance—resistant cells induce IRF-1 mRNA in response to the cytotoxic drug doxorubicin. A dominant-negative IRF-1 eliminates the ICI 182,780-induced apoptotic response (reduced >4-fold) and reduces MCF-7 and T47D cell sensitivity to the antiproliferative effects of ICI 182,780. This effect is not mediated by changes in cell cycle distribution; rather, dominant-negative IRF-1 reduces ICI 182,780-induced apoptosis. These data identify a novel mechanism of antiestrogen resistance and implicate IRF-1 as a key component in signaling some ER-mediated effects on apoptosis/cell survival.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
For many women, antiestrogen therapy is the least toxic and most effective means to manage their hormone-dependent breast cancer. The most widely studied antiestrogen has been tamoxifen (TAM), which can increase both disease-free and overall survival in breast cancer patients, reduce the incidence of estrogen receptor-positive (ER+) disease in high-risk women, and reduce the rate of bone loss from osteoporosis (1 , 2) . Although first line antiestrogen therapy remains the standard of care for these patients (3, 4, 5) , approximately one-third of all ER+ breast tumors exhibit de novo antiestrogen resistance, and most initially responsive tumors eventually acquire resistance (6) .

The steroidal antiestrogen ICI 182,780 (Faslodex; Fulvestrant) has successfully completed clinical trials and exhibits considerable potential for more widespread clinical use (7) . Most currently available antiestrogens show little or no significant activity in TAM-resistant disease, which is often treated with a second-line aromatase inhibitor. However, ICI 182,780 is clearly active in patients who have received TAM treatment and eventually recurred (8) . Furthermore, two Phase III clinical trials in TAM-resistant patients have shown ICI 182,780 to be at least as effective as the potent aromatase inhibitor anastrazole (9 , 10) . Unlike most other antiestrogens, ICI 182,780 is a pure ER antagonist (11) that can induce degradation of ER protein (12) and inhibit receptor dimerization (13) . Furthermore, ICI 182,780 is devoid of the uterotropic activity associated with the ability of TAM to increase the risk of developing endometrial cancers (8 , 14) .

Antiestrogen and estrogen responsiveness are complex phenotypes, and both genomic and nongenomic activities are functionally implicated (6 , 15) . In sensitive cells, antiestrogens are clearly cytostatic, inducing a G0-G1 cell cycle arrest in vitro. Clinically, the ability of antiestrogens to induce significant reductions in tumor size and increases in overall survival (1 , 2) and to inhibit the development of ER+ tumors in the chemopreventive setting (16 , 17) strongly suggest that these drugs also may be cytotoxic. Evidence implicates an induction of apoptotic cell death as the major mechanism through which antiestrogens might induce a cytotoxic effect (6) . However, the relationship between growth arrest and apoptosis and how antiestrogens functionally affect cell signaling to regulate these two end points remains to be firmly established.

It is becoming apparent that antiestrogen resistance in ER+ tumors is unlikely to be driven by a single gene/signaling pathway. Thus, we have invoked a gene network hypothesis that confers diversity in estrogen/antiestrogen-initiated signaling (15 , 18 , 19) . Ultimately, we envision multiple concurrent signals through this network of integrated and potentially interdependent pathways, some antiapoptotic and some proapoptotic, with cellular response reflecting the dominant signals. In antiestrogen-unresponsive cells, we hypothesize that the endocrine regulation and/or function of key components of this network is changed and that proapoptotic signals are no longer induced and antiapoptotic signals have become dominant. To begin identifying key genes that may make up such a network, we have applied both serial analysis of gene expression and gene expression microarray analyses to a series of antiestrogen-sensitive and -resistant cells. Among the key genes identified is the putative tumor suppressor gene IFN regulatory factor-1 (IRF-1; Ref. 19 ).

Although initially identified as an IFN-responsive gene, IRF-1 has shown activity as a tumor suppressor in several studies (20, 21, 22) . For example, IRF-1 is deleted in some cancers (23 , 24) , and loss of IRF-1 significantly increases tumorigenicity in mouse models driven either by ras or loss of p53 (25) . IRF-1 can signal to apoptosis in a p53-dependent or -independent manner (26 , 27) ; with or without induction of p21 waf1/cip1 (26) or p27kip1 (28) ; and through caspase-1 (27) , caspase-7 (29) , caspase-8 (30) , and/or Fas ligand (31) . Loss of p53 activity is common in breast cancer (32) . Nonetheless, many breast cancers are initially responsive to cytotoxic drugs and hormones (1 , 33) , implying that drug-induced apoptosis likely occurs through both p53-dependent and -independent mechanisms. TAM-induced growth arrest can occur independently of p53 (34) , but the precise signaling responsible for these effects requires additional study. The primary mechanisms of cell growth arrest and apoptosis for ICI 182,780 and the importance of signaling through p53 are unknown.

In addition to our previous study implicating IRF-1 in affecting antiestrogen responsiveness in MCF-7 cells (19) , Harroch et al. (35) observed that interleukin 6 inhibited proliferation and induced IRF-1 mRNA and IRF-1 binding to its target DNA sequence in T47D cells. In an immunohistochemistry study of IRF-1 expression in breast cancer, the authors report less IRF-1 expression in neoplastic compared with normal human breast, consistent with reduced expression of a putative tumor suppressor gene. However, IRF-1 expression was not assessed in association with established prognostic markers or clinical outcome (36) .

In this study, we used the ER– MDA-MB-231 cells as a model of de novo antiestrogen resistance (6) . To model de novo antiestrogen sensitivity, we used the estrogen-dependent, ER+ MCF-7 (37) and T47D cells (38) and the ER+, antiestrogen-sensitive but estrogen-independent MCF-7 variant MCF7/LCC1 (39) . As a model of acquired ICI 182,780 resistance, we studied the MCF7/LCC9 cells, which were derived from MCF7/LCC1 cells and are ER+, estrogen independent, and ICI 182,780 and TAM cross-resistant (40 ). These studies strongly implicate signaling through IRF-1 and its protein partners as a critical mediator of antiestrogen signaling and as a key gene in a broader gene network (15 , 19 , 41) . Hence, we now show that IRF-1 mRNA expression is induced by ICI 182,780 and repressed by estrogens in antiestrogen-sensitive cells. Hormonal regulation of IRF-1 is absent in ER– cells and is specifically lost in ER+ cells with acquired antiestrogen resistance. Both MCF-7 and T47D breast cancer cells expressing a dominant-negative IRF-1 (dnIRF-1) exhibit a decrease in sensitivity to ICI 182,780. The data separate the proapoptotic activity of ICI 182,780 from its ability to induce cell cycle arrest and are consistent with IRF-1 playing a critical role in those proapoptotic activities of antiestrogens most likely to contribute to their ability to increase overall survival and to reduce the risk of developing ER+ breast cancer (1 , 16 , 42) .


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Reagents.
MCF-7, T47D, ZR-75-1 (ER+, estrogen dependent, antiestrogen sensitive), and MDA-MB-231 (ER–, estrogen independent, antiestrogen unresponsive) cells were routinely grown in improved minimal essential medium (IMEM; Biofluids, Rockville, MD) with phenol red and supplemented with 5% fetal bovine serum. MCF-7 cells were originally obtained from Dr. Marvin Rich (Michigan Cancer Foundation, Detroit, MI). T47D, ZR-75-1, and MDA-MB-231 cells were obtained from the Lombardi Comprehensive Cancer Center’s Tissue Culture Shared Resource. MCF-7/LCC1 (ER+, estrogen independent, antiestrogen sensitive, MCF-7 variant; Refs. 39 and 43 ) and MCF-7/LCC9 cells (ER+, estrogen independent, TAM and ICI 182,780 cross-resistant, MCF-7 variant derived directly from MCF7/LCC1 by selection against ICI 182,780; Refs. 19 and 40 ) were routinely grown in IMEM without phenol red and supplemented with 5% charcoal stripped calf serum-IMEM. All cells were maintained in a humidified incubator at 37°C in an atmosphere containing 95% air:5% CO2. The steroidal antiestrogen ICI 182,780 (Faslodex; Fulvestrant) was kindly provided by Dr. Alan Wakeling (Zeneca Pharmaceuticals, Macclesfield, Cheshire, United Kingdom). Recombinant human IFN-{gamma} was purchased from Boehringer Mannheim (Mannheim, Germany).

RNA Extraction.
Total RNA was extracted from proliferating subconfluent cells using the TRIazol reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer’s instructions. In brief, cells were rinsed with 1x PBS to remove serum and lysed by the addition of the TRIazol reagent. RNA was isolated by chloroform extraction and precipitated using isopropanol. Total RNA was quantified based on the absorbance at 260 nM using a spectrophotometer (DU640; Beckman, Fullerton, CA).

Riboprobe Generation and RNase Protection Analysis.
The IRF-1 riboprobe was generated by reverse transcriptase-PCR amplification of a portion of the IRF-1 mRNA from MCF-7 cells. Amplification by PCR applied one 95°C cycle for 3 min, 40 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min followed by 1 cycle of 72°C for 5 min, using the following primers: forward, TCCACCTCTCACCAAGAACC (bp 533–552), and reverse, TTCCCTTCCTCATCCTCATC (bp 873–892). To control for equivalent RNA loading, we measured expression of the constitutively expressed 36B4 mRNA that encodes the human acidic ribosomal protein P0 (44) . The 36B4 riboprobe was generated as described previously (39) .

RNase protection assays were performed as described previously (19 , 45) . In brief, plasmids were linearized by digestion with EcoR1 and transcribed with either SP6 (IRF-1) or T7 polymerase (36B4) in the presence of [32P]UTP. To obtain signals of approximately comparable intensity, the 36B4 riboprobes were labeled with approximately one-fifth of the [32P]UTP concentration used to label the IRF-1 riboprobes. The IRF-1 and 36B4 riboprobes respectively generate 360- and 220-bp protected fragments. For each assay, 30 µg of total RNA was hybridized to 5 x 104 dpm of probe for 12–16 h at 50°C and digested with 40 µg/ml RNase A for 30 min at 25°C. Digestion was terminated by the addition of proteinase K (0.25 mg/ml) and 0.5% (w/v) SDS. Samples were extracted into phenol:chloroform:isoamyl alcohol (25:24:1) and precipitated in ethanol, and the pellets were boiled in loading buffer and fractionated in 6% Tris-borate EDTA-urea polyacrylamide gels. Radioactivity was detected by autoradiography and quantified using PhosphorImager analysis (445SI; Molecular Dynamics, Sunnyvale, CA).

Cell Lysis and Immunoblotting.
For the determination of IRF-1 protein expression, cells were seeded into 6-well dishes at 2 x 105 cells/well and cultured in normal growth media for 24 h. To examine the induction of IRF-1 in response to ICI 182,780 or estradiol, cells were seeded at 105 cells/well 1 day before treatment with either 1 nM 17ß-estradiol or 100 nM ICI 182,780 for 3 days. Cells were lysed in modified radioimmune precipitation assay buffer [150 mM NaCl, 50 mM Tris, 1% Igepal CA-630, and 0.5% deoxycholate (pH 7.5)] supplemented with Complete Mini protease inhibitor mixture tablets (Roche, Mannheim, Germany). Lysates were clarified by centrifugation, and equal volumes were added to 2x Laemmli sample buffer before boiling and loading onto precast 12% acrylamide gels (NuPAGE Electrophoresis System, Invitrogen, Carlsbad, CA). Proteins were transferred to nitrocellulose membranes and incubated with primary antibody (IRF-1 C-20 at 1:200; Santa Cruz Biotechnology, Santa Cruz, CA) in Tris Buffered Saline and Tween-20 [TBST; 10 mM Tris HCl, 150 mM NaCl, and 0.05% Tween-20 (pH 8.0)] containing 5% nonfat dry milk overnight at 4°C. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature followed by enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ) and exposure to film (X-OMAT Blue XB-1; Kodak, Rochester, NY). To confirm equal loading, membranes were reprobed as described above using a ß-actin monoclonal antibody (1:5000; Sigma, St. Louis, MO).

Generation of dnIRF-1.
Although small interfering RNA (siRNA) can be a powerful method to inhibit RNAs, we did not use this method to block IRF-1 because of the recent reports of a marked induction of an IFN response when these molecules are introduced into cells (46 , 47) . Thus, the best remaining approach was the use of a stably expressed dominant-negative strategy. A wild-type IRF-1 cDNA (kindly provided by Dr. Taniguchi, University of Tokyo, Japan) was subcloned into the XhoI site of the pGEM7Z expression vector (Promega, Madison, WI) and linearized with BglII. The dnIRF-1 comprises the full-length wild-type IRF-1 cDNA with a deletion of bp 647-1173 and contains both the 3' and 5' untranslated regions, the DNA-binding domain, and the nuclear localization sequences of IRF-1. We constructed dnIRF-1 by PCR amplification using bp 630–647 (TAGCAGGGCCCCTGG) as the forward primers and bp 1173–1187 (ATCAGAGAAGGTATCAGG) as the reverse primers. PCR conditions were 30 cycles of 95°C for 30 s, 45°C for 45 s, and 72°C for 5 min. Integrity of the dnIRF-1 sequence was confirmed by standard dideoxy-mediated chain-termination sequencing. dnIRF-1 was subcloned into both the XhoI site of the pcDNA3 mammalian expression vector (Invitrogen, Carlsbad, CA) and into the XhoI site of the pbiEGFP-tet vector [a plasmid expressing enhanced green fluorescent protein (EGFP)] under the control of a bidirectional tetracycline-responsive promoter (Clontech, Palo Alto, CA). The IRF-1 riboprobe (above) identifies dnIRF-1, generating a 115-bp protected dnIRF-1 fragment.

Transient Transfections and Luciferase Reporter Assay.
Cells were transfected using the FuGENE 6 method (Roche Diagnostics, Indianapolis, IN). For reporter assays, 8 x 104 cells/well were plated in 12-well plates and allowed to grow for 24 h before transfection. Cells were cotransfected with the pISRE-luc plasmid (contains five copies of the IFN-stimulated response element; ISRE) as provided in the PathDetect kit (Promega) and with either a standard control comprising a pcDNA3 plasmid without the ISRE or a pcDNA3 plasmid containing the cDNA from either IRF-1 or dnIRF-1. To control for transfection efficiency, a pRL-SV40 plasmid (Promega) containing the Renilla luciferase gene under the control of a constitutive SV40 promoter also was cotransfected into cells. One µg of plasmid DNA was added to serum-free media containing the FuGENE 6 reagent and allowed to incubate for 30 min at room temperature. Where appropriate, cells were maintained in growth media with or without 500 IU/ml IFN-{gamma} for 24–48 h. Subsequently, cells were lysed, and activation of the ISRE-luciferase construct was measured using the Dual Luciferase Assay kit (Promega) according to the manufacturer’s instructions. Luminescence was quantified using a Lumat LB 9501 luminometer (EG&G Berthold, Bundoora, Victoria, Australia).

Stable Transfection with dnIRF-1.
For stable transfections, cells were plated in T-75 cm2 plastic tissue culture flasks at a density of 0.5 x 106 cells/flask and grown for 24 h before transfection. A total of 8 µg of plasmid DNA were transfected into MCF-7 cells stably transfected with the tetR protein (MCF-7/VP16; generously provided by Dr. Susan Conrad, Michigan State University, East Lansing, MI) or T47D cells using the FuGENE6 method (above). Cells were transfected with either an empty pBI-EGFP-tet plasmid containing the EGFP selectable marker (Clontech) or one containing the dnIRF-1 cDNA and the pBABE plasmid (kindly provided by Dr. Matthew Ellis, Washington University, St. Louis, MO) encoding for puromycin resistance. Stably transfected cells were selected for growth in the presence of 1 µg/ml puromycin. Puromycin-resistant colonies expressing EGFP as measured by standard fluorescence activated cell sorting (FACS) were expanded and screened for expression of the dnIRF-1 by RNase protection. All of the transfectants used in these experiments were from pooled populations. Cells transfected with the empty control vector were designated MCF7/ctrl and T47D/ctrl and those transfected with the dnIRF-1 were designated MCF7/dnIRF-1 and T47D/dnIRF-1.

Cell Proliferation.
MCF-7/ctrl, T47D/ctrl, MCF7/dnIRF-1, and T47D/dnIRF-1 cells were sorted aseptically by FACS in the Lombardi Comprehensive Cancer Center Flow Cytometry Shared Resource for EGFP expression and plated into 12-well plastic tissue culture plates at a density of 1.5 x 103 MCF-7 or 2 x 103 T47D cells/well. Twenty-four h post plating, cells were treated with 100 nM or 1 µM ICI 182,780 or vehicle control for 72 h. Cells were then trypsinized, resuspended in PBS, and counted in a Beckman Coulter counter (Beckman Coulter Corp., Fullerton, CA) to assess cellular proliferation.

Cell Cycle Analyses.
Cells stably transfected with the dnIRF-1 or empty control plasmids were plated in T-75 cm2 plastic tissue culture flasks at a concentration of 0.5 x 106 and allowed to grow for 3 days. Cells were then analyzed for alterations in cell cycle via FACS. FACS analysis was conducted by the Lombardi Comprehensive Cancer Center Flow Cytometry Shared Resource, according to the method of Vindelov et al. (48) .

Apoptosis.
Staining for annexin V, an optimal assay for detecting apoptosis in MCF-7 cells (49 , 50) , was performed according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN). Control- or dnIRF-1-transfected MCF-7 cells (1 x 106) were seeded in T-75 cm2 plastic tissue culture dishes and allowed to grow for 24 h. Cells were then treated with ICI 182,780 or vehicle for 72 h, trypsinized, and pelleted by centrifugation. Cell pellets were rinsed twice in ice-cold PBS and stained with 5 µg/ml 7-aminoactinomycin D for 15 min at room temperature. After staining with 7-aminoactinomycin D, cells were washed and resuspended in annexin V binding buffer [10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid/NaOH, 140 mM NaCl, and 2.5 mM CaCl2 (pH 7.4)]. Cells (1 x 105) were then stained with 0.3 µg of phycoerythrin-conjugated annexin V in the dark, and flow cytometric analysis was performed using a FACStarPlus flow cytometer (Becton-Dickinson, Mountain View, CA) to determine the proportion of apoptotic cells in each sample. Apoptosis was measured only in cells expressing the dnIRF-1 transgene or empty vector (as assessed by concurrent EGFP expression).

Statistical Methods.
Student’s t test was used to compare two groups in which the data are normally distributed; a Wilcoxon t test was used to compare groups in which data are not normally distributed. For multiple comparisons, ANOVA was used with a post hoc t test for multiple comparisons. Where several experimental groups were compared with the same control, we used Dunnett’s test (51) .


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
IRF-1 Is Differentially Expressed in Antiestrogen-Sensitive and -Resistant Breast Cancer Cells.
We measured basal expression of IRF-1 mRNA by RNase protection analyses in two models of antiestrogen resistance: MCF-7/LCC9 cells (acquired resistance, ER+, ICI 182,780 and TAM cross-resistant) and MDA-MB-231 (de novo resistance, ER–, ICI 182,780 and TAM cross-resistant; Ref. 6 ). MCF-7/LCC9 cells exhibit a 4.2-fold (P < 0.05) and 2.6-fold (P <= 0.01) lower expression of IRF-1 mRNA than the antiestrogen-sensitive MCF-7 and MCF-7/LCC1 cells, respectively (Fig. 1, A and B)Citation . IRF-1 mRNA expression in MCF-7/LCC9 cells is not significantly different from that in ER– MDA-MB-231 cells.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Basal IRF-1 mRNA and protein expression and transcriptional activation in breast cancer cell lines. A, representative RNase protection assay. 36B4, loading control. B, IRF-1 mRNA expression measured by RNase protection and presented as mean ± SE of three determinations, in which intensity is expressed as a ratio of IRF-1:36B4 (ANOVA, P = 0.009; *, P < 0.05 MCF-7 versus MCF7/LCC9; P < 0.01 MCF-7/LCC1 versus MCF7/LCC9; P = 0.528 MDA-MB-231 versus MCF7/LCC9). C, representative immunoblot of IRF-1 protein. ß-actin, loading control. D, basal transcriptional activity of IRF-1 in breast cancer cell lines (ISRE-luc promoter-reporter assay). Data represent mean ± SE of four determinations and are presented as relative light units. ANOVA, P < 0.01; *, P <= 0.001 for MCF-7 versus each of MCF7/LCC1, MCF7/LCC9, and MDA-MB-231. *, P = NS for MCF7/LCC9 versus MDA-MB-231.

 
The half-life of the IRF-1 protein is less than 30 min, and changes in mRNA levels appear closely associated both with changes in IRF-1 protein expression and IRF-1 transcriptional activity as measured using an ISRE-based promoter-reporter assay (52) . To confirm this association, we performed immunoblotting for the cells lines shown in Fig. 1, A and BCitation . The data in Fig. 1CCitation show that, as expected, the mRNA and protein levels are comparable. The MCF-7/LCC1 and MCF-7/LCC9 cells compared here are derived from the same parental MCF-7 cell line and have similar transfection efficiencies as assessed by transfection with ß-galactosidase (not shown). Activity of the cotransfected Renilla construct (constitutively active) was used to correct for any minor differences in transfection efficiency. MCF-7/LCC9 cells exhibit 18-fold lower basal ISRE activity than their immediate parental cells MCF-7/LCC1 (P <= 0.01; Fig. 1DCitation ). These data reflect the differential IRF-1 mRNA expression that we have previously detected in gene expression microarrays (19) and now confirm by RNase protection analyses (Fig. 1, A and B)Citation and immunoblot (Fig. 1C)Citation . These data also confirm that IRF-1 mRNA expression, protein expression, and transcriptional activation are closely related in breast cancer cells. Furthermore, these data show that IRF-1 expression and activity are significantly lower in ER+ and ER– antiestrogen-resistant cells compared with antiestrogen-sensitive cells.

IRF-1 mRNA Expression Is Regulated through ER in Breast Cancer Cells.
Data on basal expression in the sensitive and resistant cells imply that estrogens and antiestrogens may affect IRF-1 mRNA expression. Fig. 2, A and BCitation , shows the ability of 100 nM ICI 182,780, a clinically relevant concentration (53) , to induce IRF-1 mRNA in the three best characterized and most widely used ER+ human breast cancer cell lines (6) : MCF-7 (P <= 0.001); T47D (P <= 0.001); and ZR-75-1 (P < 0.05). This effect appears to be ER mediated, because IRF-1 mRNA induction by ICI 182,780 is blocked in the presence of estradiol in MCF-7 cells (Fig. 2, C and D)Citation and ICI 182,780 is unable to induce IRF-1 in the ER– MDA-MB-231 cells (Fig. 2, A and B)Citation .



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Endocrine regulation of IRF-1 mRNA transcription in breast cancer cell lines. A, representative RNase protection data for IRF-1 mRNA expression. B, ICI 182,780 induces IRF-1 mRNA expression in ER+ but not ER– breast cancer cells. Cells were treated with 100 nM ICI 182,780 or ethanol vehicle. Data represent mean ± SE of three determinations, in which absorbance is expressed as a ratio of IRF-1:36B4 and represented as a percentage of vehicle control-treated cells. *, P <= 0.001 for ICI 182,780 versus control-treated cells within each cell line for MCF-7 and T47D and P < 0.05 for ZR75. P = 0.880 for MDA-MB-231; Student’s t test. C, representative RNase protection data for IRF-1 mRNA expression; D, estradiol reverses ICI 182,780-induced IRF-1 mRNA transcription in MCF-7 cells. *, P < 0.001; Student’s t test.

 
The dose-response relationships for the endocrine regulation of IRF-1 mRNA in MCF-7 and T47D cells were determined. Cells were plated and 24 h later treated with various doses of ICI 182,780 or 0.1% (v/v) ethanol vehicle for 72–96 h before RNA isolation. ICI 182,780 induces IRF-1 mRNA in a dose-dependent manner, with a maximal 2.5-fold induction at a dose of 100 nM in both MCF-7 (Fig. 3, A and BCitation ; P <= 0.001) and T47D (Fig. 3, C and DCitation ; P <= 0.01) cells. In contrast, IRF-1 mRNA expression is significantly down-regulated in response to treatment with 1 nM estradiol (Fig. 3, E and FCitation ; P <= 0.001).



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Dose-response and time-response relationships for the induction of IRF-1 mRNA by ICI 182,780 in MCF-7 (A and B) and T47D cells (C and D). A, representative RNase protection assay. 36B4, loading control. B, dose-response relationship for IRF-1 mRNA induction in MCF-7 cells. Cells were treated with ICI 182,780 or ethanol vehicle for 72 h. Data represent mean ± SE of three independent replicate experiments, in which absorbance is expressed as a ratio of IRF-1:36B4. *, P <= 0.01 for treatments versus control; Dunnett’s test. C, representative RNase protection assay. 36B4, loading control. D, dose-response relationship for IRF-1 mRNA induction in T47D cells. Cells were treated as in B. Data represent mean ± SE of three independent replicate experiments, in which absorbance is expressed as a ratio of IRF-1:36B4. *, P <= 0.01 for treatments versus control; Dunnett’s test. E, representative RNase protection assay. 36B4, loading control. F, estradiol regulation of IRF-1 mRNA expression in MCF-7 cells. Cells were stripped of estrogens, grown in the absence of estrogen (charcoal stripped calf serum-IMEM), and then treated with either 1 nM estradiol or ethanol vehicle for 24 h. Data represent mean ± SE of three independent replicate experiments, in which absorbance is expressed as a ratio of IRF-1:36B4 and represented as a percentage of vehicle control-treated cells. *, P < 0.001; Student’s t test.

 
ER-Mediated Regulation of IRF-1 Is Specifically Lost in Anti-estrogen-Resistant Cells.
Although the data in Fig. 2Citation and Fig. 3Citation show the regulation of IRF-1 mRNA expression, this would likely be of limited functional relevance if similar patterns of regulation occur in antiestrogen-resistant cells. However, the ability of both estrogen and ICI 182,780 to regulate IRF-1 mRNA expression is lost in the MCF-7/LCC9 cells (Fig. 4, AD)Citation , and ICI 182,780 is unable to regulate IRF-1 expression in the antiestrogen-resistant ER– cell line, MDA-MB-231 (Fig. 2, A and B)Citation . In contrast, the estrogen-independent but antiestrogen-sensitive MCF7/LCC1 cells retain the ability of estrogen to inhibit IRF-1 mRNA expression (Fig. 4, A and B)Citation . Consistent with the data in Fig. 1Citation , we found similar changes in the hormonal regulation of IRF-1 protein in immunoblots (not shown). MCF7/LCC1 cells do not require estrogens to grow in vitro or in vivo (estrogen independent) but retain some estrogen responsiveness (40 , 43) . Thus, the apparent loss of ER-mediated regulation of IRF-1 is associated with acquired antiestrogen resistance but not estrogen independence.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Hormonal regulation of IRF-1 expression is lost in antiestrogen-resistant cells. A, representative RNase protection assay. 36B4, loading control. B, estradiol regulation of IRF-1 mRNA expression. Cells were stripped of estrogens, grown in the absence of estrogen (charcoal stripped calf serum-IMEM), and then treated with either 1 nM estradiol or ethanol vehicle for 24 h. Data represent mean ± SE of three independent replicate experiments, in which absorbance is expressed as a ratio of IRF-1:36B4 and represented as a percentage of vehicle control-treated cells. *, P <= 0.001 for estradiol versus control for each of MCF7 and MCF7/LCC1 cells; P = 0.864 for estradiol versus control-treated MCF-7/LCC9 cells; Student’s t test. C, ICI 182,780 regulation of IRF-1 mRNA expression; representative RNase protection assay. 36B4, loading control. Cells were treated with 100 nM ICI 182,780 or ethanol vehicle for 72 h. D, ICI 182,780 regulation of IRF-1 mRNA expression. Data represent mean ± SE of three determinations, in which absorbance is expressed as a ratio of IRF-1:36B4 and represented as a percentage of vehicle control-treated cells. *, P <= 0.001 for ICI 182,780 versus control-treated MCF-7 cells; P = 0.971 for ICI 182,780 versus control-treated MCF7/LCC9 cells; Student’s t test.

 
We then asked whether the specificity of endocrine regulation of IRF-1 that is lost in antiestrogen-resistant cells also extended to nonhormonal inducers of IRF-1. In mouse embryonic fibroblasts, IRF-1 is induced by treatment with the cytotoxic drug doxorubicin (26) , one of the most active single cytotoxic drugs used in the treatment of breast cancer (54 , 55) . MCF-7 cells induce IRF-1 mRNA in response to treatment with doxorubicin (Fig. 5, A and B)Citation . Importantly, MCF-7/LCC9 cells retain their ability to regulate IRF-1 expression in response to 1 µM doxorubicin (increase by over 7-fold; P <= 0.001), a response also shared by MDA-MB-231 cells (increase by over 4-fold; P < 0.05; Fig. 6, A and BCitation ). Thus, antiestrogen resistance is associated with a specific, ER-mediated change in the regulation of IRF-1 expression, rather than a global loss of IRF-1 mRNA regulation. This specificity allows cells to retain the ability to induce IRF-1 and undergo an IRF-1-regulated apoptotic cell death in response to other cytotoxic agents.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Doxorubicin induction of IRF-1 mRNA expression. A, representative RNase protection assay. 36B4, loading control. B, MCF-7 cells were treated with 1 µM doxorubicin. Data represent mean ± SE of three determinations, in which absorbance is expressed as a ratio of IRF-1:36B4. *, P <= 0.01; Dunnett’s test.

 


View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Doxorubicin induces IRF-1 mRNA expression in both ER+ and ER– breast cancer cell lines. RNase protection assay of ER+ MCF-7, T47D, MCF-7/LCC9, and ZR75 cells and ER– MDA-MB-231 cells treated with 1 µM doxorubicin (DX) for 24 h. A, representative data from RNase protection assay; B, graphical representation of RNase protection assays of ER+ and ER– breast cancer cell lines treated with doxorubicin. Data represent mean ± SE of three independent determinations, in which absorbance is expressed as a ratio of IRF-1:36B4 and represented as a percentage of vehicle control-treated cells. **, P <= 0.001 for doxorubicin versus control-treated cells within each cell line for MCF-7 and MCF-7/LCC9 cells; *, P <= 0.05 for MDA-MB-231 cells; Student’s t test.

 
ICI 182,780-Induced Inhibition of Cell Proliferation Is Reduced by dnIRF-1.
To study the functional relevance of changes in IRF-1 activity in affecting antiestrogen responsiveness, we created dnIRF-1. dnIRF-1 contains the IRF-1 DNA binding domain and nuclear localization signal but lacks the protein binding and transcriptional activation domains. Dominant-negative activity of dnIRF-1 was apparent in its ability to inhibit basal ISRE activity, activity induced by transient expression of wild-type IRF-1, and IFN-{gamma} stimulated ISRE activity in MCF-7 (Fig. 7Citation ; all comparisons P < 0.001; Student’s t test). Control cells transfected with an empty expression vector exhibit no regulation of ISRE activity; control cells transfected with empty luc vector (no ISRE) showed no activity (not shown). Importantly, we did not want dnIRF-1 to eliminate all IRF-1 transcriptional activity but rather to inhibit activity to an extent broadly equivalent to that induced by antiestrogens. Complete loss of IRF-1 could induce compensatory responses of uncertain biological relevance, and there is no evidence that IRF-1 expression is fully lost in breast tumors (36) . Because IRF-1 mRNA expression levels are closely related to ISRE activity in breast cells (Fig. 1)Citation , the data in Fig. 7Citation imply that dnIRF-1 inhibits a level of ISRE activity broadly comparable with that induced by antiestrogens in sensitive cells (Fig. 2Citation ; Fig. 3Citation ).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Inhibition of basal and IFN-{gamma} stimulated ISRE activity by dnIRF-1 in MCF-7 cells. Data represent mean ± SE (representative experiment of four independent replicates), in which data are represented by relative light units. Where appropriate, MCF-7 cells were treated with 500 IU of IFN-{gamma}. *, P <= 0.001 for all transfections versus control; Dunnett’s test.

 
dnIRF-1 was stably transfected into both MCF-7 and T47D cells, and the ability of dnIRF-1 to affect ICI 182,780-induced inhibition of cell proliferation was measured (Fig. 8, A and B)Citation . In cell proliferation assays, expression of dnIRF-1 significantly reduced responsiveness of the MCF-7/dnIRF-1 and T47D/dnIRF-1 transfectants to ICI 182,780. At 100 nM, the dose that maximally induces IRF-1 mRNA expression, MCF-7/dnIRF-1 and T47D/dnIRF-1 transfectants were significantly less sensitive to ICI 182,780 compared with their respective controls. Similar differences in the responsiveness of MCF-7/dnIRF-1 and T47D/dnIRF-1 cells were seen at 1 µM ICI 182,780 (P = 0.002, MCF-7 100 nM ICI 182,780; P = 0.013, MCF-7 1 µM ICI 182,780; P = 0.002, T47D 100 nM ICI 182,780; P = 0.043, T47D 1 µM ICI 182,780; Student’s t test; Fig. 8, A and BCitation ).



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Inhibition of ICI 182,780 effects on cell proliferation by dnIRF-1. A, MCF-7 cells with and without constitutive dnIRF-1 expression. B, T47D cells with and without constitutive dnIRF-1 expression. For each cell line, cells were treated with ethanol vehicle, 100 nM ICI 182,780 or 1 µM ICI 182,780 for 3 days. Data represent mean ± SE of three determinations. *, P = 0.002, MCF-7 100 nM ICI 182,780; P = 0.013, MCF-7 1 µM ICI 182,780; Student’s t test. P = 0.002, T47D 100 nM ICI 182,780; P = 0.043, T47D 1 µM ICI 182,780; Student’s t test.

 
dnIRF-1 Does Not Affect ICI 182,780-Induced Changes in Cell Cycle Distribution.
Although antiestrogens can affect both cell cycle distribution and the rate of apoptosis, cell proliferation assays measure the sum of these activities. Hence, we asked directly whether the effects of dnIRF-1 on proliferation reflected an inhibition of the ability of ICI 182,780 to arrest cells in G0-G1. The data in Fig. 9Citation show that dnIRF-1 does not affect the ICI 182,780-induced cell cycle arrest in G0-G1 in either MCF-7/dnIRF-1 (Fig. 9A)Citation or T47D/dnIRF-1 cells (Fig. 9B)Citation . Thus, the residual antiproliferative effects of ICI 182,780 (Fig. 8)Citation in dnIRF-1-expressing cells are those conferred by cell cycle arrest. These data strongly implicate changes in apoptosis as being the primary mechanism through which dnIRF-1 reduces the antiproliferative effects of ICI 182,780 in MCF-7 and T47D cells.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Expression of dnIRF-1 does not affect ICI 182,780-induced changes in cell cycle distribution. A, MCF-7 cells with and without constitutive dnIRF-1 expression; B, T47D cells with and without constitutive dnIRF-1 expression. For each cell line, cells were treated with either ethanol vehicle or 100 nM ICI 182,780 for 3 days. Data represent mean ± SE of three determinations. *, P = 0.40, MCF-7 0 nM ICI 182,780 (vehicle control); P = 0.237, MCF-7 100 nM ICI 182,780; Student’s t test. P = 0.962, T47D 0 nM ICI 182,780; P = 0.836, T47D 100 nM; Student’s t test.

 
ICI 182,780-Induced Apoptosis Is Reduced by dnIRF-1.
To determine whether the effects of dnIRF-1 on cellular sensitivity to ICI 182,780 are mediated by its ability to influence signaling to apoptosis, the ability of dnIRF-1 to affect ICI 182,780-induced apoptosis was assessed directly by measuring annexin V staining (49 , 50) . Apoptosis was measured only in those cells expressing the dnIRF-1 transgene or empty vector control (as assessed by EGFP expression), to ensure that any effects were likely to be a direct result of the inhibition of IRF-1. When treated with 100 nM ICI 182,780, 30% of MCF-7 control transfectants undergo apoptosis. Expression of dnIRF-1 significantly reduces this ICI 182,780-induced apoptotic response by >4-fold in MCF-7/dnIRF-1 cells to 7% (Fig. 10Citation ; P < 0.034). The basal rate of apoptosis, measured in control MCF-7 cells treated with ethanol, is about 5% (Fig. 10)Citation . Thus, the full apoptotic response to ICI 182,780 is blocked by dnIRF-1. Studies were also performed in T47D and T47D/dnIRF-1 cells, which unlike MCF-7 cells contain a mutant and nonfunctional p53. T47D/dnIRF-1 cells show a similar 4-fold reduction in the ability of ICI 182,780 to induce apoptosis (not shown). These data with dnIRF-1 in both MCF-7 (wild-type p53) and T47D (mutant p53) strongly suggesting that IRF-1 is a critical mediator of this signal and that its activities are independent of p53.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 10. ICI 182,780-induced apoptosis is reduced by dnIRF-1 expression. MCF-7 cells with and without constitutive dnIRF-1 expression. Data represent mean ± SE of three independent replicate experiments. dnIRF-1- and control-transfected cells were treated with either ethanol vehicle or 100 nM ICI 182,780 for 3 days. Annexin V analysis was measured by FACS. *, P <= 0.05 for ICI 182,780-treated control transfectants versus dnIRF-1 transfectants (Dunnett’s test).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Data from our previous studies demonstrate an association between IRF-1 expression and acquired cross-resistance to antiestrogens (19) . We now show that IRF-1 is a key signaling protein involved in mediating the sensitivity of breast cancer cells to ICI 182,780-induced apoptosis. Basal IRF-1 mRNA expression is down-regulated in antiestrogen-resistant cells (both the ER+ MCF7/LCC9 model of acquired resistance and the ER– MDA-MB-231 model of de novo resistance). Moreover, the ability of antiestrogens to regulate IRF-1 mRNA transcription is absent in the ER– and lost in the ER+ antiestrogen-resistant cells. The functional relevance of these observations is shown by the ability of dnIRF-1 to reduce significantly the antiproliferative effects of ICI 182,780 in both the antiestrogen-sensitive MCF-7 and T47D cells. Notably, dnIRF-1 does not eliminate basal IRF-1 activity in these cells. Loss of IRF-1 activity could induce confounding compensatory effects unlikely to occur in breast tumors, which appear to retain detectable IRF-1 protein expression (36) . Thus, the data reported herein likely reflect the contribution of only the antiestrogen induced IRF-1.

Specificity of these effects, in the context of the signaling of IRF-1 in response to ER-mediated events, also is apparent. Estradiol blocks antiestrogen-induced IRF-1 in MCF-7 cells, and no endocrine regulation is seen in ER– cells. Neither the loss of endocrine regulation in MCF7/LCC9 cells nor the absence of its endocrine regulation in MDA-MB-231 cells compromises the ability of doxorubicin to induce IRF-1 in these cells and to inhibit their proliferation (not shown). This latter effect is consistent with patterns of clinical responses to these drugs, because breast cancer patients who are resistant to antiestrogens can respond to cytotoxic chemotherapy.

The ability of dnIRF-1 to block ICI 182,780-induced inhibition of cell proliferation in MCF-7/dnIRF-1 and T47D/dnIRF-1 cells could reflect changes in the effects of ICI 182,780 on cell cycle and/or apoptosis. However, dnIRF-1 does not affect ICI 182,780-induced cell cycle arrest when expressed in either MCF-7 or T47D cells. In marked contrast, dnIRF-1 effectively eliminates ICI 182,780-induced apoptosis in both MCF-7/dnIRF-1 and T47D/dnIRF-1 cells. Thus, we can separate cell cycle arrest from apoptosis and attribute a significant component of antiestrogen-induced apoptotic signaling to IRF-1. Because dnIRF-1 abrogates ICI 182,780-induced apoptosis (Fig. 10)Citation while enhancing cell growth by approximately 50% (Fig. 8)Citation , apoptosis and cell cycle arrest likely contribute equally to the apparent antiproliferative effects of ICI 182,780.

Functionally separating antiestrogen-induced apoptosis from anti-estrogen-induced growth arrest has several important implications. Novel therapeutic approaches designed to increase the proapoptotic effects of antiestrogens may be an effective means to improve their ability to increase overall survival in patients because this should increase the proportion of cells undergoing apoptotic cell death. Modalities that increase only the ability of antiestrogens to induce a cell cycle arrest will likely be a less effective strategy. For example, many arrested cells will survive and thereby have more opportunities to adapt, acquire resistance, and generate subsequent disease recurrence. Measuring basal IRF-1 expression and/or the ability of an antiestrogen to induce IRF-1 in the neoadjuvant setting may improve the prediction of endocrine responsiveness. Currently, we incorrectly predict antiestrogen sensitivity in 66% of ER+/progesterone receptor-negative, 55% of ER–/progesterone receptor-positive, and 25% of ER+/progesterone receptor-positive tumors (6) .

The ability of IRF-1 to induce growth arrest is associated with the induction of various genes including p53-dependent and -independent events (26 , 27) and interactions that may include p21waf1/cip1 (26) . Interactions requiring both p21waf1/cip1 and p53 may not be central components in antiestrogen signaling through IRF-1. Nonetheless, preliminary data suggest an increase in p21waf1/cip1 mRNA expression after ICI 182,780 treatment in MCF-7 and T47D cells (2.91 ± 0.89-fold), consistent with both a previous report on p21waf1/cip1 regulation by ICI 182,780 (56) and activation of IRF-1. MCF-7 cells express wild-type p53, whereas T47D cells express a mutant and nonfunctional p53 (57) , but both cell lines are responsive to antiestrogen-induced apoptosis in a manner that remains sensitive to the effects of dnIRF-1. However, a role for p53/p21waf1/cip1 signaling in the cell cycle effects of antiestrogens cannot be excluded.

The ability of ICI 182,780 to induce apoptosis through IRF-1 activity is likely mediated through changes in caspase activation. IRF-1 can induce several caspases (27 , 29 , 30) , and inhibition of caspase activity blocks antiestrogen-induced apoptosis (58) . A specific requirement for caspase-3 seems unlikely because this caspase is not expressed in MCF-7 cells (59) . IRF-1 signaling through caspase-1 (27) , caspase-7 (29) , and caspase-8 (30) is strongly implicated. For example, IRF-1 induces caspase-1 (60) , which can regulate apoptosis in normal mammary epithelial cells (61) . Overexpression of caspase-1 is lethal in MCF-7 cells (62) . Caspase-7 is expressed in MCF-7 cells and may substitute for the loss of caspase-3 in these cells (63) . IFN-{gamma}, which induces IRF-1 activity in MCF-7 cells (Fig. 7)Citation , is reported to sensitize both MCF-7 and MDA-MB-231 cells to apoptosis through inducing caspase-8 (64) . TAM can induce caspase-8 (58) , and consistent with our observations in T47D cells, caspase-8-induced apoptosis occurs independent of p53 (64) . Studies to determine which caspases are functionally involved in IRF-1 signaling in breast cancer are currently in progress.

Although data in this study show reduced IRF-1 expression and loss of its endocrine regulation in antiestrogen-resistant cells, the level of IRF-1 activity in cells is also affected by protein-protein interactions with the nucleolar phosphoprotein nucleophosmin (NPM; Ref. 65 ). Not previously reported in breast cancer cells, we now have preliminary data to suggest that this functional interaction also occurs in T47D cells (not shown). NPM is an estrogen-induced protein in MCF-7 cells that is down-regulated by antiestrogens (66) , and its expression is increased in MCF-7/LCC9 when compared with MCF-7/LCC1 cells (19) . Thus, in addition to down-regulating IRF-1 mRNA expression, antiestrogen-resistant cells have up-regulated expression of an endogenous inhibitor (NPM). Interestingly, we have previously shown that NPM autoantibody levels are lower in TAM-treated patients, suggesting that NPM/IRF-1 interactions also may be clinically relevant (67) .

It seems likely that an acquired antiestrogen resistance phenotype is conferred not by the alteration of a single gene or signal transduction pathway but rather through the perturbation of a signaling network of integrated signaling pathways (15) . The data presented here are consistent with cell signaling through IRF-1 being a key component or node in such a signaling network. Activity as a signaling node is implied by (a) the potential for diversity/redundancy of signaling to a key end point (apoptosis) downstream of IRF-1 (cooperation with p53, p21waf1/cip1, and regulation of several caspases); (b) the redundancy apparent in regulating IRF-1 activity (down-regulation of basal transcription, loss of ER-mediated transcription, and concurrent up-regulation of the endogenous inhibitor NPM); (c) the apparent specificity for antiestrogen resistance (cytotoxic drugs can induce IRF-1 in antiestrogen-resistant cells); and (d) the altered regulation of IRF-1 activity/expression in models of both de novo and acquired antiestrogen resistance. This node may be important in affecting other signals in breast cancer cells. For example, IRF-1 is downstream of tumor necrosis factor signaling, and both tumor necrosis factor {alpha} and its receptor tumor necrosis factor R1 are down-regulated in MCF7/LCC9 cells, implying a cross-resistance to tumor necrosis factor-mediated events (15 , 19) .

The ability of doxorubicin to induce IRF-1 in antiestrogen-resistant cells and to inhibit proliferation in these cells is a clinically relevant phenotype. We and others (36 , 68) have detected IRF-1 expression by immunohistochemistry in breast cancer specimens, this pattern of expression being consistent with a potential tumor suppressor role for IRF-1 (21 , 36) . Our preliminary data suggest that the pattern of IRF-1 expression in breast cancers, as measured by immunohistochemistry, is consistent with other components of our network. For example, we detect an inverse pattern of expression between IRF-1 and nuclear factor {kappa}B as seen in MCF7/LCC1 versus MCF7/LCC9 cells (19 , 68) . These observations may ultimately lead to a better ability to identify patients that will respond to antiestrogens and to predict which patients will ultimately develop antiestrogen resistance. Interfering with the putative "IRF-1 node" may allow for the development of novel therapeutic strategies in endocrine-resistant breast cancers.


    ACKNOWLEDGMENTS
 
Technical services were provided by the Flow Cytometry & Cell Sorting and Macromolecular Shared Resources.


    FOOTNOTES
 
Grant support: Public Health Service Award R01-CA/AG58022-10 (R. Clarke), Department of Defense Awards DAMD17-99-9189 (K. Bouker), DAMD17-99-1-9191, BC010619, and BC990358 (R. Clarke) from the United States Army Medical Research and Materiel Command, American Cancer Society Award IRG-97-1520-01-IRG (T. Skaar), and the Charles and Ella O. Latham Charitable Trust (T. Skaar).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Robert Clarke, Room W405A, Research Building, Department of Oncology, Georgetown University School of Medicine, 3970 Reservoir Road NW, Washington, DC 20007. Phone: (202) 687-3755. Fax: (202) 687-7505. E-mail: clarker{at}georgetown.edu

Received 11/17/03. Revised 2/26/04. Accepted 3/29/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Early Breast Cancer Trialists’ Collaborative Group. Tamoxifen for early breast cancer: an overview of the randomized trials. Lancet, 351: 1451-67, 1998.[CrossRef][Medline]
  2. Early Breast Cancer Trialists’ Collaborative Group. Systemic treatment of early breast cancer by hormonal, cytotoxic, or immune therapy. Lancet, 399: 1-15, 1992.[CrossRef]
  3. Winer EP, Hudis C, Burstein HJ, et al American Society of Clinical Oncology technology assessment on the use of aromatase inhibitors as adjuvant therapy for women with hormone receptor-positive breast cancer: status report 2002. J Clin Oncol, 20: 3317-27, 2002.[Abstract/Free Full Text]
  4. Ravdin P Aromatase inhibitors for the endocrine adjuvant treatment of breast cancer. Lancet, 359: 2126-7, 2002.[CrossRef][Medline]
  5. Chlebowski RT, Col N, Winer EP, et al American Society of Clinical Oncology technology assessment of pharmacologic interventions for breast cancer risk reduction including tamoxifen, raloxifene, and aromatase inhibition. J Clin Oncol, 20: 3328-43, 2002.[Abstract/Free Full Text]
  6. Clarke R, Leonessa F, Welch JN, Skaar TC Cellular and molecular pharmacology of antiestrogen action and resistance. Pharmacol Rev, 53: 25-71, 2001.[Abstract/Free Full Text]
  7. Robertson JFR ICI 182,780 (Fulvestrant): the first oestrogen receptor down-regulator: current clinical data. Br J Cancer, 85(Suppl 2): 11-14, 2001.
  8. Howell A, DeFriend D, Robertson JFR, Blamey RW, Walton P Response to a specific antioestrogen (ICI 182,780) in tamoxifen-resistant breast cancer. Lancet, 345: 29-30, 1995.[CrossRef][Medline]
  9. Howell A, Robertson JF, Quaresma AJ, et al Fulvestrant, formerly ICI 182,780, is as effective as anastrozole in postmenopausal women with advanced breast cancer progressing after prior endocrine treatment. J Clin Oncol, 20: 3396-403, 2002.[Abstract/Free Full Text]
  10. Osborne CK, Pippen J, Jones SE, et al Double-blind, randomized trial comparing the efficacy and tolerability of fulvestrant versus anastrozole in postmenopausal women with advanced breast cancer progressing on prior endocrine therapy: results of a North American trial. J Clin Oncol, 20: 3386-95, 2002.[Abstract/Free Full Text]
  11. Wakeling AE The future of new pure antiestrogens in clinical breast cancer. Breast Cancer Res Treat, 25: 1-9, 1993.[CrossRef][Medline]
  12. Dauvois S, Danielian PS, White R, Parker MG Antiestrogen ICI 164,384 reduces cellular estrogen receptor content by increasing its turnover. Proc Natl Acad Sci USA, 89: 4037-41, 1992.[Abstract/Free Full Text]
  13. Fawell SE, White R, Hoare S, Sydenham M, Page M, Parker MG Inhibition of estrogen receptor-DNA binding by the "pure" antiestrogen ICI 164,384 appears to be mediated by impaired receptor dimerization. Proc Natl Acad Sci USA, 87: 6883-7, 1990.[Abstract/Free Full Text]
  14. Wakeling AE, Bowler J Novel antioestrogens without partial agonist activity. J Steroid Biochem, 31: 645-53, 1988.[CrossRef][Medline]
  15. Clarke R, Liu M, Bouker KB, et al Antiestrogen resistance in breast cancer and the role of estrogen receptor signaling. Oncogene, 22: 7316-39, 2003.[CrossRef][Medline]
  16. Fisher B, Costantino JP, Wickerham DL, et al Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 study. J Natl Cancer Inst (Bethesda), 90: 1371-88, 1998.[Abstract/Free Full Text]
  17. Veronesi U, Maisonneuve P, Rotmensz N, et al Italian randomized trial among women with hysterectomy: tamoxifen and hormone-dependent breast cancer in high-risk women. J Natl Cancer Inst (Bethesda), 95: 160-5, 2003.[Abstract/Free Full Text]
  18. Clarke R, Brünner N Acquired estrogen independence and antiestrogen resistance in breast cancer: estrogen receptor-driven phenotypes?. Trends Endocrinol Metab, 7: 25-35, 1996.
  19. Gu Z, Lee RY, Skaar TC, et al Association of interferon regulatory factor-1, nucleophosmin, nuclear factor-{kappa}B, and cyclic AMP response element binding with acquired resistance to Faslodex (ICI 182,780). Cancer Res, 62: 3428-37, 2002.[Abstract/Free Full Text]
  20. Tanaka N, Ishihara M, Kitagawa M, et al Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell, 77: 829-39, 1994.[CrossRef][Medline]
  21. Tanaka N, Ishihara M, Taniguchi T Suppression of c-myc or fosB-induced cell transformation by the transcription factor IRF-1. Cancer Lett, 83: 191-6, 1994.[CrossRef][Medline]
  22. Yim JH, Wu SJ, Casey MJ, Norton JA, Doherty GM IFN regulatory factor-1 gene transfer into an aggressive, nonimmunogenic sarcoma suppresses the malignant phenotype and enhances immunogenicity in syngeneic mice. Hokkaido Igaku Zasshi, 71: 509-16, 1997.
  23. Sillman CL, Sever CE, Pallavicini MG, et al Deletion of IRF-1, mapping to chromosome 5q31.1, in human leukemia and preleukemic myelodysplasia. Science, 259: 968-70, 1993.[Abstract]
  24. Tamura G, Ogasawara S, Hishizuka S, et al Two distinct regions of deletion on the long arm of chromosome 5 in differentiated adenocarcinomas of the stomach. Cancer Res, 56: 612-5, 1996.[Abstract/Free Full Text]
  25. Nozawa H, Oda E, Nakao K, et al Loss of transcription factor IRF-1 affects tumor susceptibility in mice carrying the Ha-ras transgene or nullizygosity for p53. Genes Dev, 1–3: 1240-5, 1999.
  26. Tanaka N, Ishihara M, Lamphier MS, et al Cooperation of the tumour suppressors IRF-1 and p53 in response to DNA damage. Nature, 382: 816-818, 1996.[CrossRef][Medline]
  27. Tamura T, Ishihara M, Lamphier MS, et al An IRF-1-dependent pathway of DNA damage-induced apoptosis in mitogen-activated T lymphocytes. Nature, 376: 596-9, 1995.[CrossRef][Medline]
  28. Moro A, Santos A, Arana MJ, Perea SE Activation of the human p27(Kip1) promoter by IFN{alpha} 2b. Biochem Biophys Res Commun, 269: 31-4, 2000.[CrossRef][Medline]
  29. Sanceau J, Hiscott J, Delattre O, Wietzerbin J IFN-ß induces serine phosphorylation of Stat-1 in Ewing’s sarcoma cells and mediates apoptosis via induction of IRF-1 and activation of caspase-7. Oncogene, 19: 3372-83, 2000.[CrossRef][Medline]
  30. Suk K, Chang I, Kim Y, et al Interferon {gamma} (IFN{gamma}) and tumor necrosis factor {alpha} synergism in ME-180 cervical cancer cell apoptosis and necrosis: IFN{gamma} inhibits cytoprotective NF-{kappa}B through STAT1/IRF-1 pathways. J Biol Chem, 276: 13153-9, 2001.[Abstract/Free Full Text]
  31. Chow W, Fang J, Yee J The IFN regulatory factor family participates in regulation of Fas ligand gene expression in T cells. J Immunol, 164: 3512-8, 2000.[Abstract/Free Full Text]
  32. Elledge RM, Allred DC The p53 tumor suppressor gene in breast cancer. Breast Cancer Res Treat, 32: 39-47, 1994.[CrossRef][Medline]
  33. Early Breast Cancer Trialists’ Collaborative Group. Polychemotherapy for early breast cancer: an overview of randomised trials. Lancet, 352: 930-42, 1998.[CrossRef][Medline]
  34. Berry D, Muss H, Thor A, et al HER-2/neu and p53 expression versus tamoxifen resistance in estrogen receptor-positive, node-negative breast cancer. J Clin Oncol, 18: 3471-9, 2000.[Abstract/Free Full Text]
  35. Harroch S, Revel M, Chebath J Induction by interleukin-6 of interferon regulatory factor 1 (IRF-1) gene expression through the palindromic interferon response element pIRE and cell type-dependent control of IRF-1 binding to DNA. EMBO J, 13: 1942-9, 1994.[Medline]
  36. Doherty GM, Boucher L, Sorenson K, Lowney J Interferon regulatory factor expression in human breast cancer. Ann Surg, 233: 623-9, 2001.[CrossRef][Medline]
  37. Brooks SC, Locke ER, Soule HD Estrogen receptor in a human cell line (MCF-7) from breast carcinoma. J Biol Chem, 248: 6251-3, 1973.[Abstract/Free Full Text]
  38. Chalbos D, Vignon F, Keydar I, Rochefort H Estrogens stimulate cell proliferation and induce secretory proteins in a human breast cancer cell line (T47D). J Clin Endocrinol Metab, 55: 276 1982.[Abstract/Free Full Text]
  39. Brünner N, Boulay V, Fojo A, Freter C, Lippman ME, Clarke R Acquisition of hormone-independent growth in MCF-7 cells is accompanied by increased expression of estrogen-regulated genes but without detectable DNA amplifications. Cancer Res, 53: 283-90, 1993.[Abstract/Free Full Text]
  40. Brünner N, Boysen B, Jirus S, et al MCF7/LCC9: an antiestrogen resistant MCF-7 variant in which acquired resistance to the steroidal antiestrogen ICI 182,780 confers an early crossresistance to the non-steroidal antiestrogen tamoxifen. Cancer Res, 57: 3486-93, 1997.[Abstract/Free Full Text]
  41. Pratt MAC, Bishop TE, White D, et al Estrogen withdrawal-induced NF-{kappa}B activity and bcl-3 expression in breast cancer cells: roles in growth and hormone independence. Mol Cell Biol, 23: 6887-900, 2003.[Abstract/Free Full Text]
  42. Fisher B, Dignam J, Bryant J, Wolmark N Five versus more than five years of tamoxifen for lymph node-negative breast cancer: updated findings from the National Surgical Adjuvant Breast and Bowel Project B-14 randomized trial. J Natl Cancer Inst (Bethesda), 93: 684-90, 2001.[Abstract/Free Full Text]
  43. Clarke R, Brünner N, Katzenellenbogen BS, et al Progression from hormone dependent to hormone independent growth in MCF-7 human breast cancer cells. Proc Natl Acad Sci USA, 86: 3649-53, 1989.[Abstract/Free Full Text]
  44. LaBorda J 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res, 19: 3998 1991.[Free Full Text]
  45. Clarke R, Brünner N, Katz D, et al The effects of a constitutive production of TGF-{alpha} on the growth of MCF-7 human breast cancer cells in vitro and in vivo. Mol Endocrinol, 3: 372-80, 1989.[Abstract/Free Full Text]
  46. Sledz CA, Holko M, De Veer MJ, Silverman RH, Williams BR Activation of the interferon system by short-interfering RNAs. Nat Cell Biol, 5: 834-9, 2003.[CrossRef][Medline]
  47. Bridge AJ, Pebernard S, Ducraux A, Nicoulaz AL, Iggo R Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet, 34: 263-4, 2003.[CrossRef][Medline]
  48. Vindelov LL, Christensen IJ, Nissen NI A detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis. Cytometry, 3: 323-7, 1983.[CrossRef][Medline]
  49. Lindner DJ, Ma X, Hu J, Karra S, Kalvakolanu DV Thioredoxin reductase plays a critical role in IFN retinoid-mediated tumor-growth control in vivo. Clin Cancer Res, 8: 3210-8, 2002.[Abstract/Free Full Text]
  50. Del Bino G, Darzynkiewicz Z, Degraef C, Mosselmans R, Fokan D, Galand P Comparison of methods based on annexin-V binding, DNA content or TUNEL for evaluating cell death in HL-60 and adherent MCF-7 cells. Cell Prolif, 32: 25-37, 1999.[Medline]
  51. Gad S, Weil CS . Statistics and experimental design for toxicologists, Telford Press Caldwell, NJ 1988.
  52. Kano A, Haruyama T, Akaike T, Watanabe Y IRF-1 is an essential mediator in IFN-{gamma}-induced cell cycle arrest and apoptosis of primary cultured hepatocytes. Biochem Biophys Res Commun, 257: 672-7, 1999.[CrossRef][Medline]
  53. Howell A, DeFriend DJ, Robertson JFR, et al Pharmacokinetics, pharmacological and anti-tumor effects of the specific anti-oestrogen ICI 182780 in women with advanced breast cancer. Br J Cancer, 74: 300-8, 1996.[Medline]
  54. Paik S, Bryant J, Park C, et al ErbB-2 and response to doxorubicin in patients with axillary lymph node-positive, hormone receptor-negative breast cancer. J Natl Cancer Inst (Bethesda), 90: 1361-70, 1998.[Abstract/Free Full Text]
  55. Trock BJ, Leonessa F, Clarke R Multidrug resistance in breast cancer: a meta analysis of MDR1/gp170 expression and its possible functional significance. J Natl Cancer Inst (Bethesda), 89: 917-31, 1997.[Abstract/Free Full Text]
  56. Carroll JS, Prall OW, Musgrove EA, Sutherland RL A pure estrogen antagonist inhibits cyclin E-Cdk2 activity in MCF-7 breast cancer cells and induces accumulation of p130–E2F4 complexes characteristic of quiescence. J Biol Chem, 275: 38221-9, 2000.[Abstract/Free Full Text]
  57. Bartek J, Iggo R, Gannon J, Lane DP Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines. Oncogene, 5: 893-9, 1990.[Medline]
  58. Mandlekar S, Hebbar V, Christov K, Kong AN Pharmacodynamics of tamoxifen and its 4-hydroxy and N-desmethyl metabolites: activation of caspases and induction of apoptosis in rat mammary tumors and in human breast cancer cell lines. Cancer Res, 60: 6601-6, 2000.[Abstract/Free Full Text]
  59. Kurokawa H, Nishio K, Fukumoto H, et al Alteration of caspase-3 (CPP32/Yama/apopain) in wild-type MCF-7, breast cancer cells. Oncol Rep, 6: 33-7, 1999.[Medline]
  60. Tamura T, Ueda S, Yoshida M, Matsuzaki M, Mohri H, Okubo T Interferon-{gamma} induces ICE gene expression and enhances cellular susceptibility to apoptosis in the U937 leukemia cell line. Biochem Biophys Res Commun, 229: 21-6, 1996.[CrossRef][Medline]
  61. Boudreau N, Sympson CJ, Werb Z, Bissell MJ Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science, 267: 891-3, 1995.[Abstract/Free Full Text]
  62. Keane MM, Ettenberg SA, Lowrey GA, Russell EK, Lipkowitz S Fas expression and function in normal and malignant breast cell lines. Cancer Res, 56: 4791-8, 1996.[Abstract/Free Full Text]
  63. Liang Y, Yan C, Schor NF Apoptosis in the absence of caspase 3. Oncogene, 20: 6570-8, 2001.[CrossRef][Medline]
  64. Ruiz-Ruiz C, Munoz-Pinedo C, Lopez-Rivas A Interferon-{gamma} treatment elevates caspase-8 expression and sensitizes human breast tumor cells to a death receptor-induced mitochondria-operated apoptotic program. Cancer Res, 60: 5673-80, 2000.[Abstract/Free Full Text]
  65. Kondo T, Minamino N, Nagamura-Inoue T, Matsumoto M, Taniguchi T, Tanaka N Identification and characterization of nucleophosmin/B23/numatrin which binds the anti-oncogenic transcription factor IRF-1 and manifests oncogenic activity. Oncogene, 15: 1275-81, 1997.[CrossRef][Medline]
  66. Skaar TC, Prasad SC, Sharaeh S, Lippman ME, Brunner N, Clarke R Two-dimensional gel electrophoresis analyses identify nucleophosmin as an estrogen regulated protein associated with acquired estrogen-independence in human breast cancer cells. J Steroid Biochem Mol Biol, 67: 391-402, 1998.[CrossRef][Medline]
  67. Brankin B, Skaar TC, Trock BJ, Berris M, Clarke R Autoantibodies to numatrin: an early predictor for relapse in breast cancer. Cancer Epidemiol Biomark Prev, 7: 1109-15, 1998.[Abstract/Free Full Text]
  68. Zhu Y, Bouker KB, Skaar TC, et al High throughput tissue microarray study of antiestrogen related genes in human breast cancers [abstract]. Proceedings of the 85th Annual Meeting of the Endocrine Society, p.140 2003.



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
R. Arakaki, A. Nagaoka, N. Ishimaru, A. Yamada, S. Yoshida, and Y. Hayashi
Role of Plasmacytoid Dendritic Cells for Aberrant Class II Expression in Exocrine Glands from Estrogen-Deficient Mice of Healthy Background
Am. J. Pathol., May 1, 2009; 174(5): 1715 - 1724.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
N. Ishimaru, R. Arakaki, S. Yoshida, A. Yamada, S. Noji, and Y. Hayashi
Expression of the retinoblastoma protein RbAp48 in exocrine glands leads to Sjogren's syndrome-like autoimmune exocrinopathy
J. Exp. Med., November 24, 2008; 205(12): 2915 - 2927.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. B. Riggins, J. P-J. Lan, U. Klimach, A. Zwart, L. R. Cavalli, B. R. Haddad, L. Chen, T. Gong, J. Xuan, S. P. Ethier, et al.
ERR{gamma} Mediates Tamoxifen Resistance in Novel Models of Invasive Lobular Breast Cancer
Cancer Res., November 1, 2008; 68(21): 8908 - 8917.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. S. Samaddar, V. T. Gaddy, J. Duplantier, S. P. Thandavan, M. Shah, M. J. Smith, D. Browning, J. Rawson, S. B. Smith, J. T. Barrett, et al.
A role for macroautophagy in protection against 4-hydroxytamoxifen-induced cell death and the development of antiestrogen resistance
Mol. Cancer Ther., September 1, 2008; 7(9): 2977 - 2987.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
B. P. Gomez, R. B. Riggins, A. N. Shajahan, U. Klimach, A. Wang, A. C. Crawford, Y. Zhu, A. Zwart, M. Wang, and R. Clarke
Human X-Box binding protein-1 confers both estrogen independence and antiestrogen resistance in breast cancer cell lines
FASEB J, December 1, 2007; 21(14): 4013 - 4027.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Magnusson, R. Ehrnstrom, J. Olsen, and A. Sjolander
An Increased Expression of Cysteinyl Leukotriene 2 Receptor in Colorectal Adenocarcinomas Correlates with High Differentiation
Cancer Res., October 1, 2007; 67(19): 9190 - 9198.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. M. Joyce, R. C. Burghardt, R. D. Geisert, J. R. Burghardt, R. N. Hooper, J. W. Ross, M. D. Ashworth, and G. A. Johnson
Pig Conceptuses Secrete Estrogen and Interferons to Differentially Regulate Uterine STAT1 in a Temporal and Cell Type-Specific Manner
Endocrinology, September 1, 2007; 148(9): 4420 - 4431.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
A. J Lengi, R. A Phillips, E. Karpuzoglu, and S. A. Ahmed
17{beta}-Estradiol downregulates interferon regulatory factor-1 in murine splenocytes
J. Mol. Endocrinol., December 1, 2006; 37(3): 421 - 432.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Hur, D. W. Bell, K. L. Dean, K. R. Coser, P. C. Hilario, R. A. Okimoto, E. M. Tobey, S. L. Smith, K. J. Isselbacher, and T. Shioda
Regulation of Expression of BIK Proapoptotic Protein in Human Breast Cancer Cells: p53-Dependent Induction of BIK mRNA by Fulvestrant and Proteasomal Degradation of BIK Protein.
Cancer Res., October 15, 2006; 66(20): 10153 - 10161.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. B. Bouker, T. C. Skaar, R. B. Riggins, D. S. Harburger, D. R. Fernandez, A. Zwart, A. Wang, and R. Clarke
Interferon regulatory factor-1 (IRF-1) exhibits tumor suppressor activities in breast cancer associated with caspase activation and induction of apoptosis
Carcinogenesis, September 1, 2005; 26(9): 1527 - 1535.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
R. B. Riggins, A. Zwart, R. Nehra, and R. Clarke
The nuclear factor {kappa}B inhibitor parthenolide restores ICI 182,780 (Faslodex; fulvestrant)-induced apoptosis in antiestrogen-resistant breast cancer cells
Mol. Cancer Ther., January 1, 2005; 4(1): 33 - 41.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Pizzoferrato, Y. Liu, A. Gambotto, M. J. Armstrong, M. T. Stang, W. E. Gooding, S. M. Alber, S. H. Shand, S. C. Watkins, W. J. Storkus, et al.
Ectopic Expression of Interferon Regulatory Factor-1 Promotes Human Breast Cancer Cell Death and Results in Reduced Expression of Survivin
Cancer Res., November 15, 2004; 64(22): 8381 - 8388.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bouker, K. B.
Right arrow Articles by Clarke, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bouker, K. B.
Right arrow Articles by Clarke, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online