| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Department of Obstetrics and Gynecology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas
| ABSTRACT |
|---|
|
|
|---|
was not significantly changed in either of the transgenic mouse strains, progesterone receptor levels was higher in both transgenic lines as compared with the nontransgenic littermates. Expression of G1 cyclins was prominently increased in the mammary glands of both the CSF-1 and c-fms transgenic lines, suggesting increased cell cycle progression in these strains. In addition, the proliferation marker proliferating cell nuclear antigen (PCNA) and the mitogen-responsive transcription factor c-jun were also increased as compared with the nontransgenic controls. These findings, along with the histological data, support the hypothesis that CSF-1 and its receptor are involved in the etiology of breast cancer. | INTRODUCTION |
|---|
|
|
|---|
The macrophage colony-stimulating factor (CSF-1) is a proteoglycan hematopoietic factor that was first detected in macrophages and monocytes. The binding of CSF-1 to its receptor c-fms, which is a cell surface receptor belonging to a family of tyrosine kinase receptors, results in the dimerization and phosphorylation of c-fms, leading to macrophage proliferation via signal transduction pathways. Studies involving certain hematopoietic growth factors, such as CSF-1, have demonstrated that these substrates also affect normal and malignant cells of nonhematopoietic origin (4) . High levels of CSF-1 were detected in pregnant human and mouse uterus as well as the placenta, suggesting a role for this growth factor in these tissues during pregnancy. High expression of CSF-1 has also been associated with a variety of gynecological cancers (5) . For example, high expression of CSF-1 and c-fms was detected in ovarian adenocarcinoma.
CSF-1 is also involved in mammary development, as suggested by observations from mice homozygous for the osteopetrotic mutation (op/op), designated recently CSF1op (6) . These mice completely lack active CSF-1 because of a frame shift in the CSF-1 open reading frame resulting in a severely truncated protein (6) . Homozygous CSF1op mice exhibit lactation defect due to incomplete mammary gland ductal growth, precocious development of the lobular alveolar system, and, despite the expression of milk proteins, a failure to switch to the lactational state (6) . Restoring normal circulating levels with externally supplied recombinant (human) CSF-1 enabled the correction of the lactational defect in these mice (5) . These data suggest that CSF-1 has a role in the development of mammary glands during pregnancy. In addition, immunohistochemical studies detected high levels of CSF-1 in breast carcinoma patients (5) . High CSF-1 levels were also found in the serum of patients with aggressive metastatic breast carcinomas (5) . High levels of c-fms without the expression of CSF-1 have also been detected in ovarian, endometrial, and breast cancer cell lines (5) . The above studies suggest the possible association of malignant phenotype and expression of CSF-1 and c-fms in the same tumor. These studies also indicate that autocrine and paracrine interactions of CSF-1 and its receptor, c-fms, may participate in the biology of human neoplasms, including breast cancer.
Recent studies by Lin et al. (6) have shown that the absence of CSF-1 (CSF1op/CSF1op) in mammary cancer-susceptible polyoma middle T antigen (PyMT) mice retarded tumor progression and metastasis but did not affect primary tumor development. Conversely, overexpression of CSF-1 in the PyMT background resulted in the acceleration of malignant progression and metastasis.
Although the studies by Lin et al. (6) strongly suggest that CSF-1 is involved in tumor progression and metastasis, they did not directly address whether the overexpression of CSF-1 or its receptor c-fms results in initiation of changes that could lead to tumor development. The aim of our study was to investigate the roles of CSF-1 and/or c-fms as initiating factors in mammary carcinogenesis. For this purpose, we have generated a CSF-1 transgenic mouse line and a c-fms transgenic mouse line that overexpress CSF-1 and c-fms, respectively, under the regulation of the mouse mammary tumor virus (MMTV) promoter. These mice exhibited hyperplastic developments of the mammary glands and decreased gland regression during involution, as well as severe dysplasia and spontaneous tumor development with age, which was accelerated with 7,12-dimethylbenz(a)anthracene (DMBA) treatment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA Analysis.
Total RNA was isolated from mice mammary glands using the Tri-reagent according to the manufacturers protocol (Sigma, St. Louis. MO). Two hundred ng of the total RNA isolated from nontransgenic and CSF-1 transgenic mice was then used in reverse transcription (RT)-PCR to amplify human CSF-1-, endogenous mouse CSF-1-, and endogenous mouse c-fms-specific mRNAs. The human CSF-1-specific primer sequences used for the amplification were ATGACAGACAGGTGGAACTGCCAG and TCACACAACTTCAGTAGGTTCAGG. The mouse CSF-1-specific primer sequences were CGGGCATCATCCTAGTCTTGCTGACTGT and ATAGTGGCAGTATGTGGGGGGCATCCTC. The mouse c-fms-specific primer sequences were GACTGGAGAGGAGAGACCAGGACTATG and GTGCACCAGTTGGCATAGTAAATGTAGAGGCT. RNA amplification of CSF-1 and c-fms was carried out as described previously, and the PCR products were visualized by gel electrophoresis using 1% agarose gels. Real-time PCR was also performed on cDNA from RT reactions, using platinum Taq polymerase (Invitrogen, Carlsbad, CA) according to the manufacturers protocol. SYBR green dye (1x; Fisher Scientific; Atlanta, GA) was added to the reaction mixture to detect amplicon synthesis in the SmartCycler real-time PCR thermal cycler (Cepheid, Sunnyvale, CA). For quantification, the cycle threshold number (Ct) exhibiting the maximum curve growth rate was determined by the Cepheid SmartCycler software. The relative gene expression of each sample, normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was calculated by the formula 2Ct (GAPDH) Ct (gene).
Western Blot Analysis.
After homogenizing and sonicating the mammary gland tissue in lysis buffer, the protein lysate was collected and used in Western blot analysis with specific antibodies. The conditions for Western hybridization were carried out as described previously (8)
. The antibodies used for Western analysis are: mouse-specific antibodies for anti-ER
(Ab-10; clone TE111.5D11), ERß (PA1310), progesterone receptor (PR; Ab-10), proliferating cell nuclear antigen (PCNA; Ab-1; clone PC10), and cyclin D1 (Ab-1; DCS-6) were purchased from Neomarkers (Fremont, CA). Mouse-specific antibodies, antiactin (119) anticyclin E (M-20), were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The human CSF-1 (AF216), the mouse c-fms (06-174), and the mouse CSF-1 (I-16) antibodies were purchased from R&D systems (Minneapolis, MO), Upstate Biotechnology (Lake Placid, NY), and Santa Cruz Biotechnology, respectively.
Morphological, Histological, and Immunohistological Assessment of Mammary Glands.
After fixing with 10% neutral buffered formalin, the mammary glands were dissected free from the skin and the whole mounts of mammary glands were processed as described by Medina (9)
. They were then stained with hematoxylin and were examined with a dissecting microscope. Mammary growth was measured by quantitative analysis of ductal branching. Briefly, at least three ducts reaching lymph node (a hallmark of complete mammary epithelial growth into fat pad) from individual whole mounts (n = 6 whole mounts from each group) were examined under dissection microscope (x10) for counting the number of branches, and mean and SD was used for graphical representation. Statistical significance between the wild-type and transgenic groups was determined using Students t test. Routine sections of mammary tissue were prepared after fixation in 10% neutral buffered formalin by embedding in paraffin, sectioning at 5 µm, and staining with H&E. To immunolocalize the expression of CSF-1 and its receptor c-fms and the presence of infiltrating macrophages, we used 5-µm-thick sections of transgenic and nontransgenic mammary gland tissue. After deparaffinization and rehydration in xylene and ethanol, nonspecific sites were blocked by incubating with 1% normal goat serum in 0.05 M Tris-HCl buffer. After decanting the reagents, the sections were covered with specific antibodies. For the detection of CSF-1 and c-fms expression, we used goat polyclonal antimouse CSF-1 antibody (N-16, 1:100 dilution) from Santa Cruz Biotechnology and rabbit polyclonal mouse anti-c-fms antibody (CSF-1R, 1:200 dilution) from Upstate Biotechnology. For the detection of tissue macrophages, rat antimouse (F4/80) antibody (1:200 dilution) from Serotec (Oxford, United Kingdom) was used. The samples were incubated overnight at 4°C in a humidified chamber. After three washings with 0.05 M Tris-HCl buffer, the slides were incubated with secondary antibody for 30 min at room temperature. The secondary antibodies used were biotinylated antirat IgG (H+L), biotinylated antigoat IgG (H+L), and biotinylated antirabbit IgG (H+L) and were obtained from Vector Labs. Slides were subjected to repeated washings, and sections were incubated with 1% Fast Red/naphthol solution for 5 min. Sections were washed again and coverslipped, and the staining pattern was observed using a light microscope.
Exposure of Transgenic Mice to DMBA.
MMTV-CSF-1 (n = 9) and MMTV-c-fms (n = 9) virgin female transgenic mice (56-day old), along with nontransgenic (FVB) virgin female mice (n = 11), were exposed to four doses of DMBA (1.0 mg/mouse/once a week). DMBA (1.0 mg; Sigma) in 100 µl of corn oil was delivered via orogastric tube. Four weeks after the last dose of DMBA exposure, the mice were palpated for tumors, and weekly observations continued until the termination of experiment. Mice were sacrificed shortly after tumor identification or at the termination of experiment when the animals reached the age of 12 months (about 10 months after the last dose of carcinogen exposure). Mammary gland, along with tumor (if tumor was present) along with non-tumor-containing mammary gland, was processed for microscopic observation, as described above.
| RESULTS |
|---|
|
|
|---|
15 copies of stably integrated CSF-1 transgene, as shown by Southern hybridization (Fig. 1B)
10 copies of stably integrated c-fms transgene. Both CSF-1 and c-fms transgenic colonies are more than 3 years old and have undergone at least 10 generations of breeding. The transgene copy number and its expression are very stable throughout all generations. All of the studies were carried out with mice from the established colony that was generated using the founder mouse.
|
|
Transgenic gene expression was also confirmed by real-time PCR of reverse-transcribed RNA from the mammary glands of CSF-1 and c-fms transgenic strains and the FVB wild-type. Fig. 2D
shows about a 23-fold increase in the expression of CSF-1 in the CSF-1 strain as compared with control FVB (top panel). A 12-fold increase is observed in c-fms expression in the c-fms transgenic strain as compared with control (Fig. 2D)
.
To examine the morphological features of the mammary glands, whole mounts of fat pads from transgenic and nontransgenic littermates were prepared (Fig. 3, AF)
. As compared with wild-type mammary gland (Fig. 3A)
, increased ductal branching and lobulo-alveolar growth was observed in both age-matched (68 months) virgin CSF-1 (Fig. 3B)
and c-fms (Fig. 3C)
transgenic mice mammary glands. Quantitative analysis of ductal branch data indicate (Fig. 3
, bottom panels) that, compared with age- and physiological-stage-matched wild-type FVB mice, the ductal branching is about 24-fold more in CSF-1 and c-fms transgenic females, respectively. The differences are statistically highly significant (P < 0.001). Although no mammary tumors were observed in young transgenic CSF-1 or c-fms females, severe glandular dysplasia, ductal hyperplasia, and palpable, as well as microscopic, mammary tumors (about 50%; n = 22) were observed in both CSF-1 and c-fms animals, ages >12 months (Fig. 4)
. Hyperplasia and dysplasia were evident in all of the observed animals. Both adenocarcinoma and papillary carcinoma was the main phenotype of these tumors. The size of the tumors was small (<1 cm3), weighing
150225 mg (wet weight) at the time of sacrifice. Even though mammary tumors (palpable and microscopic) were observed in aged animals, the long latency, low tumor burden (not more than one or two palpable tumors per animal; n = 9), small tumors, and lack of metastasis indicated that other secondary factors or events may play a role in the aggressive tumor formation with increased incidence and metastasis in these mice.
|
|
|
DMBA Treatment Accelerates Mammary Tumorigenesis in CSF-1 and c-fms Transgenic Mice.
The early presence of preneoplastic lesions (48 months) and development of mammary tumors with long latency in aged (>12 months) CSF-1 and c-fms mice suggest that additional biochemical changes are required for the development of mammary tumors from preneoplastic changes. To determine whether carcinogen treatment could accelerate tumor formation, 56-day-old transgenic mice along with control (FVB) animals were treated with DMBA as described in "Materials and Methods." None of the control mice (n = 11) developed either palpable or microscopic tumors at the termination of the experiment, whereas all of the CSF-1 (n = 9) and c-fms (n = 9) transgenic female mice developed either palpable or microscopic tumors during the same period of time (when the animals reached 12 months of age). The median tumor incidence (tumor size, >1.0 cm3) was 31 and 37 weeks, respectively, for CSF-1 and c-fms mice. Even though all of the transgenic mice developed tumors, none of them developed multiple palpable tumors. However, microscopic evidence of additional tumors in non-tumor-bearing mammary glands was quite evident in some mammary glands (data not shown). As seen in hyperplastic tissue, all tumors expressed CSF-1 and c-fms. Furthermore, the expression of both of the steroid receptors (ER and PR) was still present, suggesting that these tumors still maintain hormone responsiveness despite the overexpression of the growth factor and its receptor.
Expression of Steroid Receptors in the CSF-1 and c-fms Transgenic Mammary Glands.
To investigate how the overexpression of CSF-1 in the mammary gland affects the expression of steroid receptors, we tested the expression of ER
, ERß, and PR in the CSF-1 transgenic animals and compared them with that in the nontransgenic animals. Whereas the expression of ER
showed no significant difference between the transgenic and nontransgenic mice (Fig. 6A)
, the expression of both ERß and PR was increased in the transgenic mice by
3.0-fold and >10-fold, respectively (Fig. 6A)
. Even though the PR has two isoforms, only the major isoform (PR
) was detected. The observations were consistent with previous studies (10)
. As in the case of the CSF-1 transgenic line, no difference was detected in the expression of ER
in the c-fms line as compared with the nontransgenic control (Fig. 6B)
; however, neither was a difference detected in the expression of ERß (Fig. 6B)
. The expression of PR was 2-fold higher in the c-fms transgenic mice than in the nontransgenic mice (Fig. 7B)
.
|
|
| DISCUSSION |
|---|
|
|
|---|
Consistent with the known role of CSF-1 (5 , 6 , 12) and its receptor in the progression of breast cancer and the role of CSF-1 infiltration of tissue macrophages (13) and their sustenance, the presence of infiltrating macrophages are higher in and around preneoplastic lesions and mammary tumors in CSF-1 transgenic mice. These observations further suggest that, in addition to initiation of mammary hyperplastic and dysplastic changes and tumor formation in transgenic mice, CSF-1 may also help in the infiltration and sustenance of tissue macrophages.
The appearance of spontaneous mammary tumors with long latency (only in aged mice) and low tumor burden in CSF-1 and c-fms mice suggests that additional events accumulating with age may need to take place to promote mammary tumor development in these mice. We, therefore, tested whether treatment with carcinogen would accelerate tumor development. Transgenic mice (CSF-1 and c-fms) treated with DMBA developed palpable mammary tumors by age 89 months (67 months after treatment). The data suggest that the mutagenic effects of DMBA advanced the mammary preneoplastic changes, brought on by CSF-1 or c-fms overexpression, to tumor development. It could also be argued that initiating events took place during aging or carcinogen treatment, and the presence of increased CSF-1 or c-fms levels acted as promoter for tumor development; however, this may not be as likely as the first possibility, because the onset of preneoplastic changes due to CSF-1 or c-fms overexpression occurred in young mice (68 months) and without DMBA treatment. The expression of CSF-1 and c-fms and the presence of steroid receptors (ER and PR) in tumors, like our other transgenic mammary cancer model (14) suggests that CSF-1 and c-fms mammary tumors are still hormone responsive despite growth-factor activation and makes this model the more interesting one for further investigation. Furthermore, the data reported by Lin et al. (12) showed that, in CSF1op/CSF1op mice, the lack of active CSF-1 in the PyMT background resulted in delay in tumor progression and metastasis but had no effect on primary tumor development. The data strongly suggest that CSF-1 is not involved in primary tumor development but, rather, in progression and metastasis. It is worth noting that these studies addressed mammary tumor progression due to CSF-1 in PyMT mice, which are prone to mammary tumor development. Similarly, the data from our CSF-1 and c-fms transgenic models suggest that CSF-1 signaling alone may result only in extensive preneoplastic changes and delayed spontaneous tumor development, and that other alterations are required for increased tumor incidence with decreased latency and metastatic potential. Combined, the data suggest that through its mitogenic activity, CSF-1 could act on initiating hyperplastic and dysplastic changes, and, although it may not be involved in promoting tumor development, it does play an important role in progression and metastasis.
CSF-1 mammary-specific expression of the human CSF-1 transgene in virgin CSF-1 transgenic mice (68 months) was confirmed by RT-PCR and Western blot analysis. Whereas there was no detectable expression of endogenous CSF-1 between the nontransgenic and CSF-1 transgenic mice, at least a 3-fold increase was observed in the expression of the endogenous c-fms in the transgenic versus nontransgenic mammary glands. This suggests that CSF-1 can induce the expression of its receptor, which is required for CSF-1 function. In addition, a similar increase in mRNA and protein levels in the CSF-1 transgenic mice suggests that the regulation of c-fms by CSF-1 is probably occurring at the transcriptional level.
The increase in endogenous c-fms expression in CSF-1 mammary glands may be due to an increase in the infiltration of c-fms-positive macrophages. However, the observed increase in endogenous c-fms expression may not be attributed solely to macrophage infiltration because mouse (endogenous) CSF-1 expression, also occurring in macrophages, was not changed in the CSF-1 transgenic mammary glands. Consistent with the known role of CSF-1 (5
, 6
, 12)
and its receptor in the progression of breast cancer and the role of CSF-1 in the filtration of tissue macrophages (13)
and their sustenance, the presence of infiltrating macrophages is greater in and around preneoplastic lesions and mammary tumors in CSF-1 transgenic mice than in non-transgenic mice. These observations further suggest that, in addition to the initiation of mammary hyperplastic and dysplastic changes and tumor formation in transgenic mice, CSF-1 may also help in the infiltration and sustenance of tissue macrophages. The lack of demonstrable expression of CSF-1 in macrophages in early lesions, and the increase in expression of CSF-1 only macrophages in tumors (Fig. 5)
, it is possible that at this early stage of initiation, there may not be significant macrophage infiltration; therefore, they may have little contribution to the increase in c-fms expression in the CSF-1 transgenic mammary glands. Thus, it is likely that the increase in c-fms expression is due to an autocrine feedback loop in CSF-1-overexpressing mammary cells.
Signaling by the CSF-1/c-fms system results in accelerating cellular proliferation. Consistently, stimulation by CSF-1 results in the induction of G1 cyclins that promote cell cycle progression from the G1 to S phase. Our expression data of factors involved in cell cycle and cellular proliferation is in agreement with the enhanced cellular proliferation in the mammary glands of CSF-1 transgenic mice and suggests that CSF-1 via c-fms induce the expression of these factors in the mammary glands of the transgenic mice. We have observed an increase in the expression of both cyclin D1 and cyclin E (which promote cell cycle advance from the G1 phase into S phase), as well as of PCNA (a marker for cellular proliferation), in the transgenic mammary glands as compared with the nontransgenic gland. We have also observed, in the CSF-1 transgenic mice, an increase in c-jun, which is an early transcription factor activated during the induction of cellular growth. Combined, the expression profile of these factors is indicative of increased cellular proliferation in the mammary glands of the CSF-1 and c-fms transgenic mice.
The expression of ER
was not affected in the CSF-1 transgenic mammary gland; however, the expression of ERß, and more drastically PR (>10-fold), was increased in the virgin transgenic gland as compared with the nontransgenic gland. The presence of steroid receptors in these mice and increased mammary growth in parous animals suggests that the mammary tumors are still hormone responsive despite growth factor activation. The ongoing studies of CSF-1/c-fms double transgenic mice with MMTV-aromatase mice (7
, 8
, 14)
should shed more light on the synergistic role of steroid hormones and growth factor interaction in promoting mammary tumor growth. Increased ductal branching and the consistent overexpression of (15)
the major isoform of progesterone receptor (PRA) (10)
in CSF-1 transgenic mice suggest that this growth factor, in some way, influences PR expression by growth factor cross-talk through membrane-mediated signal transduction pathways. Furthermore, the ability of CSF-1 and other members of this family (16)
to bind and activate unique tyrosine kinase receptors [leading to proliferation of early progenitor or stem cells and induction of PR in ductal or lobular progenitors depending on the type of mitogenic stimulus (17)
] suggests that the CSF-1/c-fms action that led to increased lateral branching and lobulo-alveolar growth might have contributed to increased PR expression. More studies are needed to address the role of CSF-1/c-fms-mediated mechanism in up-regulation of PR. The ongoing studies with PR knockout mice with CSF-1/c-fms double transgenic mice should shed more light on these observations. These findings suggest that CSF-1 may also regulate gene expression by inducing the expression of the steroid receptors ERß and PR by nongenomic pathways, because there is no known direct interaction of CSF-1 with steroid receptors; this, in turn, could have additional mitogenic effects on the cellular component of mammary ducts. Interestingly, although no difference was observed in ERß expression, PR expression was increased by 2-fold in the c-fms transgenic mice as compared with nontransgenic control. Thus, the difference in ERß and PR expression, as compared with control, is more pronounced in the CSF-1 transgenic strain than in the c-fms strain. One possible explanation is that in the CSF-1 strain, both CSF-1 and endogenous c-fms are elevated, whereas only c-fms expression is elevated in the c-fms transgenic strain; therefore, the CSF-1 signaling pathway may be activated at a higher extent in the CSF-1 transgenic mice, resulting in a more pronounced induction of ERß and PR. This is consistent with the induction profile of the expression of downstream genes, such as cyclin D and PCNA, in the CSF-1 strain as compared with the c-fms strain.
We report the development of mouse transgenic models expressing CSF-1 and c-fms in the mammary glands. These models provide the opportunity to examine directly the effects of CSF-1 and its receptor in mammary gland development and tumorigenesis. The CSF-1/c-fms transgenic models provide in vivo tools to examine the effects of CSF-1 signaling on the mammary gland during pregnancy and lactation as well as on the regulatory pathways involved in breast cancer. We have shown that increased expression of CSF-1 and/or its receptor results in the development of preneoplastic changes that could lead to tumor formation in aged transgenic mice.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Note: N. Kirma is currently at the Division of Endocrinology, Department of Medicine, Emory University, and R. Luthra is currently at the Department of Biochemistry, at Emory University, Atlanta, Georgia. U. Mandava is currently at the Center for Disease Control, Atlanta, Georgia.
Requests for reprints: Rajeshwar Rao Tekmal, Department of Obstetrics and Gynecology, The University of Texas Health Science Center at San Antonio, MSC 7836, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900. Phone: (210) 567-4930; Fax: (210) 567-4958; E-mail: Tekmal{at}uthscsa.edu
Received 9/19/03. Revised 4/ 7/04. Accepted 4/16/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
JNJ-28312141, a novel orally active colony-stimulating factor-1 receptor/FMS-related receptor tyrosine kinase-3 receptor tyrosine kinase inhibitor with potential utility in solid tumors, bone metastases, and acute myeloid leukemia Mol. Cancer Ther., November 1, 2009; 8(11): 3151 - 3161. |
||||
![]() |
E. Gonzalez-Suarez, D. Branstetter, A. Armstrong, H. Dinh, H. Blumberg, and W. C. Dougall RANK Overexpression in Transgenic Mice with Mouse Mammary Tumor Virus Promoter-Controlled RANK Increases Proliferation and Impairs Alveolar Differentiation in the Mammary Epithelia and Disrupts Lumen Formation in Cultured Epithelial Acini Mol. Cell. Biol., February 15, 2007; 27(4): 1442 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schalk-Hihi, H.-C. Ma, G. T. Struble, S. Bayoumy, R. Williams, E. Devine, I. P. Petrounia, T. Mezzasalma, L. Zeng, C. Schubert, et al. Protein Engineering of the Colony-stimulating Factor-1 Receptor Kinase Domain for Structural Studies J. Biol. Chem., February 9, 2007; 282(6): 4085 - 4093. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohno, K. Kubo, H. Murooka, Y. Kobayashi, T. Nishitoba, M. Shibuya, T. Yoneda, and T. Isoe A c-fms tyrosine kinase inhibitor, Ki20227, suppresses osteoclast differentiation and osteolytic bone destruction in a bone metastasis model. Mol. Cancer Ther., November 1, 2006; 5(11): 2634 - 2643. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bonafe, M. Gilmore-Hebert, N. L. Folk, M. Azodi, Y. Zhou, and S. K. Chambers Glyceraldehyde-3-Phosphate Dehydrogenase Binds to the AU-Rich 3' Untranslated Region of Colony-Stimulating Factor-1 (CSF-1) Messenger RNA in Human Ovarian Cancer Cells: Possible Role in CSF-1 Posttranscriptional Regulation and Tumor Phenotype Cancer Res., May 1, 2005; 65(9): 3762 - 3771. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |