Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyazaki, K.
Right arrow Articles by Kannagi, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyazaki, K.
Right arrow Articles by Kannagi, R.
[Cancer Research 64, 4498-4505, July 1, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Loss of Disialyl Lewisa, the Ligand for Lymphocyte Inhibitory Receptor Sialic Acid-Binding Immunoglobulin-Like Lectin-7 (Siglec-7) Associated with Increased Sialyl Lewisa Expression on Human Colon Cancers

Keiko Miyazaki1,2, Katsuyuki Ohmori3, Mineko Izawa1, Tetsufumi Koike1, Kensuke Kumamoto1, Koichi Furukawa4, Takayuki Ando5, Makoto Kiso5, Toshiyuki Yamaji6, Yasuhiro Hashimoto6, Akemi Suzuki6, Aruto Yoshida7, Makoto Takeuchi7 and Reiji Kannagi1,2

1 Department of Molecular Pathology, Aichi Cancer Center Research Institute, Nagoya; 2 Science and Technology Agency, Kawaguchi; 3 Central Clinical Laboratory, Kyoto University Hospital, Kyoto; 4 Second Department of Biochemistry, Nagoya University School of Medicine, Nagoya; 5 Department of Applied Bio-Organic Chemistry, Gifu University, Gifu; 6 Glyco-Chain Functions Laboratory, Supra-Biomolecular System Group, Frontier Research System, RIKEN Institute, Saitama; and 7 Central Laboratories for Key Technology, Kirin Brewery Company, Yokohama, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of sialyl Lewisa is known to be increased in cancers of the digestive organs. The determinant serves as a ligand for E-selectin and mediates hematogenous metastasis of cancers. In contrast, disialyl Lewisa, which has an extra sialic acid attached at the C6-position of penultimate GlcNAc in sialyl Lewisa, is expressed preferentially on nonmalignant colonic epithelial cells, and its expression decreases significantly on malignant transformation. Introduction of the gene for an {alpha}2->6 sialyl-transferase responsible for disialyl Lewisa synthesis to colon cancer cells resulted in a marked increase in disialyl Lewisa expression and corresponding decrease in sialyl Lewisa expression. This was accompanied by the complete loss of E-selectin binding activity of the cells. In contrast, the transfected cells acquired significant binding activity to sialic acid-binding immunoglobulin-like lectin-7 (Siglec-7)/p75/adhesion inhibitory receptor molecule-1, an inhibitory receptor expressed on lymphoid cells. These results indicate that the transition of carbohydrate determinants from disialyl Lewisa-dominant status to sialyl Lewisa-dominant status on malignant transformation has a dual functional consequence: the loss of normal cell-cell recognition between mucosal epithelial cells and lymphoid cells on one hand and the gain of E-selectin binding activity on the other. The transcription of a gene encoding the {alpha}2->6 sialyltransferase was markedly down-regulated in cancer cells compared with nonmalignant epithelial cells, which is in line with the decreased expression of disialyl Lewisa and increased expression of sialyl Lewisa in cancers. Treatment of cancer cells with butyrate or 5-azacytidine induced strongly disialyl Lewisa expression, suggesting that histone deacetylation and/or DNA methylation may be involved in the silencing of the gene in cancers.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The carbohydrate determinant sialyl Lewisa is known to be expressed strongly on cancers of the digestive organs and to serve as a ligand for vascular E-selectin in hematogenous metastasis of cancers (1, 2, 3, 4, 5) . However, the molecular mechanism underlying accelerated expression of sialyl Lewisa determinant in cancers is not well understood. The levels of many glycosyltransferases involved in the synthesis of the determinant and also the levels of their mRNA expression have been studied, but no conclusive results have been obtained to date (4 , 6, 7, 8, 9) .

It has long been known that cell surface carbohydrate determinants undergo drastic alteration during malignant transformation. The major mechanism that leads to the altered expression of carbohydrate determinant in cancer, in general, was called previously an "incomplete synthesis" in the early 1980s (10, 11, 12) . The synthesis of complex carbohydrate determinants, well-developed on normal epithelial cells, tends to be impaired on malignant transformation, predisposing the cells to express less complicated carbohydrate determinants.

In line with this notion, we showed previously that the 2->3, 2->6 disialyl Lewisa determinant, which has an extra sialic acid residue attached at the C6 position of penultimate GlcNAc through {alpha}2->6 linkage to the well-known sialyl Lewisa determinant, is expressed preferentially on nonmalignant epithelial cells of the digestive organs, and its expression decreases on malignant transformation (13, 14, 15) . In most specimens from patients with cancers of the pancreas, biliary tract, stomach, and colon, the 2->3 sialyl Lewisa determinant was expressed strongly in cancer cells, whereas disialyl Lewisa determinant having 2->6 sialyl modification was expressed preferentially on nonmalignant epithelial cells and expressed less frequently in cancer cells (13, 14, 15) . In these three preceding studies, we predicted that a disturbance of 2->6 sialylation of the determinants on malignant transformation of epithelial cells could be one of the major mechanisms leading to the increased expression of sialyl Lewisa, the monosialylated determinant, in cancers. This could well be a good example of the induction of cancer-associated carbohydrate determinants because of the above-mentioned incomplete synthesis.

We identified biochemically ST6GalNAc6 recently as a sialyltransferase responsible for the synthesis of 2->3/2->6 disialyl Lewisa determinant (16) . In the present study, we investigated the possible role of the 2->3, 2->6 disialyl Lewisa determinant in the enhancement of sialyl Lewisa expression in human colon cancers to see whether the classical concept of incomplete synthesis is applicable for the induction of sialyl Lewisa expression in human cancers. We attempted also to elucidate the biological function of 2->3, 2->6 disialyl Lewisa determinant using the cells transfected with ST6GalNAc6 cDNA.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells, Antibodies, and Transfection of Cells with ST6GalNAc6 cDNA.
Human colon cancer cell lines SW1083 and DLD-1, were maintained in DMEM (Life Technologies, Inc., Rockville, MD) supplemented with 10% FCS (BioWhittaker, Gaithersburg, MD) and cultured at 37°C in a humidified atmosphere of 5% CO2 in air. The ST6GalNAc6 transfectant cell lines, SW1083/ST6GalNAc6 clones 1–9, 1–5, 2–8, and 2–5, were established by the transfection of expression vector pcDNA3.1-hyg(+), containing cDNA for human ST6GalNAc6 (GenBank accession no. Ab035173) inserted at its NheI/XhoI site into SW1083 cells using the LipofectAMINE Plus Reagent (Life Technologies, Inc.) according to the manufacturer’s instructions. For analysis of the expression of carbohydrate determinants, the cells were mixed and incubated with the anticarbohydrate monoclonal antibody (purified antibody at 1 µg/ml or culture supernatant at a dilution of 1:10) at 4°C for 30 min. The anti-2->3 sialyl Lewisa antibody N19-9 (murine IgG1) was obtained from Alexis Biochemicals Corporation (Lausen, Switzerland). The anti-2->3, 2->6 disialyl Lewisa (FH7; murine IgG3) and anti-2->3, 2->6 disialyl Lewisc (FH9; murine IgG2a) were prepared as described previously (13, 14, 15) . The cells were then washed three times with PBS containing 0.5% BSA and stained with 1:200 dilution of FITC-conjugated goat antimouse immunoglobulin (Silenus Laboratories, Hawthorn, Victoria, Australia) at 4°C for 30 min. Binding of the antibodies to the cells was evaluated by flow cytometry performed with FACScan (Becton Dickinson, Mountain View, CA).

For preparation of the monoclonal antibodies to Siglec-7, DA rats (the Shizuoka Agriculture Cooperative Association for Laboratory Animals, Shizuoka, Japan) were immunized once with Siglec-7-Chinese hamster ovary cells (1.3 x 107 cells; Ref. 17 ), and iliac lymph node cells were fused with the PAI myeloma in 18 days. Supernatants that reacted with Siglec-7-Chinese hamster ovary cells but not parent Chinese hamster ovary cells were identified by immunostaining. Positive hybridomas were cultured in ASF104 nonserum medium (Ajinomoto, Tokyo, Japan), and antibodies in the supernatants were purified with protein G-Sepharose (Amersham). A neutralizing anti-Siglec-7 antibody (13-3-D and rat IgG2b) was used in this study.

Binding Studies of Recombinant E-Selectin and Siglec-7.
Recombinant human E-selectin-IgG chimera were kindly provided by Drs. Hirosato Kondo and Yoshimasa Inoue of the Department of Chemistry, R&D Laboratories, Nippon Organon K.K. (Osaka, Japan). For preparation of recombinant Siglec-7-immunoglobulin chimera and mutant Siglec-7-immunoglobulin chimera, the DNA fragment of extracellular domain of Siglec-7 and its mutant (R124K) were amplified by PCR using the following primers: 5'-CCAACCGTCGACATGCTGCTGCTGCTGCTG-3' (underline shows initiation codon, and an italic portion shows a SalI site); and 5'-CCAACCACTAGTACTCACCCTGTTGCAGGGAGAGGTTCA-3' (underline shows splicing donor, and an italic portion shows a SpeI site). The PCR products were digested with SalI and SpeI and then ligated to SalI and SpeI sites of pEF-Fc (a generous gift from Dr. Yoshihara, RIKEN, Saitama, Japan), to produce a fusion construct of Siglec-7 extracellular domain and human IgG Fc domain. The construct was then digested with SalI and NotI and ligated to XhoI and NotI sites of a modified pcXN2. The pcXN2-Siglec-7-Fc or -mutant Fc was transfected to Chinese hamster ovary cells to obtain a clone that secreted Siglec-7-Fc. The transfectants were cultured in ASF104 nonserum media, and Siglec-7-Fc in the supernatants was purified with protein G-Sepharose.

Recombinant E-selectin and Siglec-7 were preincubated with affinity-purified rabbit antihuman IgG (Dako, Glostrup, Denmark) followed by incubation with phycoerythrin-streptavidin (Dako) before application to the binding analyses with SW1083 or transfectant clones. Binding of recombinant molecules to the cells was evaluated by flow cytometry. When indicated, the cells were incubated with blocking antibodies (10 µg/ml) for 30 min at 37°C. For the inhibition experiments, rat monoclonal anti-Siglec-7 neutralizing antibody (clone 13-3-D) was used at 10 µg/ml. In some experiments, the binding specificity of recombinant Siglec-7-immunoglobulin was ascertained by ELISA using pure synthetic carbohydrate determinants (18) . The structures of carbohydrate determinants used in this study are summarized in Table 1Citation .


View this table:
[in this window]
[in a new window]
 
Table 1 Structures of carbohydrate determinants used in this study

The disialyl Lewisa and disialyl Lewisc determinants were shown previously to be preferentially expressed on nonmalignant epithelial cells of digestive organs, whereas (mono-) sialyl Lewisa determinant was known to be expressed predominantly on cancer cells, suggesting that a decrease in 2 -> 6 sialylation on malignant transformation is involved in the abnormal accumulation of sialyl Lewisa in cancer tissues (13 14 15) . "R" stands for "-> 3Galß1 -> 4Glaß1 -> ceramide" in the synthetic determinants used in the enzyme-linked immunosorbent assays in experiments described in Fig. 4Citation .

 
Cell Adhesion Experiments Mediated by E-Selectin and Siglec-7.
Nonstatic monolayer cell adhesion experiments were performed as described previously (5 , 19) . Parental SW1083 cells and SW1083/ST6GalNAc6 clones were cultured in monolayer in 24-well plates. To this, 2'7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester-labeled 300.19/E-selectin cells (1 x 106 cells/0.5 ml/well and murine B-lymphoma 300.19 cells transfected with human E-selectin cDNA; Ref. 20 ) were added, and the plate was placed on a rotating platform for incubation under shear (90 rpm) for 20 min at room temperature. The 300.19/E-selectin cells were kindly supplied by Dr. Geoffrey S. Kansas, Department of Microbiology-Immunology, Northwestern University Medical School (Chicago, IL). With Siglec-7-mediated cell adhesion, U937 cells transfected with cDNA for human Siglec-7 or mutant Siglec-7 were sialidase treated and labeled with 2'7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester. The U937 cells expressing mutant Siglec-7 were used as control for background binding. After nonadherent cells were washed out three times with PBS, the cells were lysed with 0.5% NP40, and the attached cells were counted by measuring fluorescence intensity using an Arvo 1420 multilabel counter (Wallac, Gaithersburg, MD). For generation of U937 cells expressing Siglec-7, pcDNA3.1-Siglec-7-myc (17) was digested with NheI and AflII. The fragment was then ligated to NheI-AflII sites of a modified pcXNc in which a multicloning site is inserted. A point mutant (R124K) was introduced using primers (sense, 5'-AGATACTTCTTTAAGATGGAGAAAGG-3'; and antisense, 5'-CCTTTCTCCATCTTAAAGAAGTATCT-3') by the same method as described previously. The constructs were transfected into U937 cells by electroporation in a GenePulser at 240V with 950 µF capacitance (Bio-Rad, Richmond, CA). After 48 h of culture, G418 (600 µg/ml) was added to the cells, and the clones were then isolated and analyzed by flow cytometry.

Real-Time Reverse Transcription-PCR (RT-PCR) Analysis of ST6GalNAc6 mRNA Expression in Colon Cancers.
Surgical specimens were obtained from 21 patients with colorectal cancer at surgical operation and processed as described previously (6 , 9) . The median age of patients was 59.8 years. The carcinomas were staged according to the Astler-Coller modification of Dukes’ classification (21) . Malignant and nonmalignant portions of each specimen were used for RNA extraction. Nonmalignant mucosa was scraped off using slide glasses, and tissue specimens of cancer were carefully excised to eliminate noncancerous tissue components. This was done with reference to histological findings of tissue sections prepared from the same specimens. The disialyl Lewisa determinant, the product of the ST6GalNAc6 gene, was expressed only on colonic epithelial cells and was not expressed in endothelial cells, fibroblasts, or mucosal leukocytes in the tissue sections. Samples were frozen rapidly and stored at –80°C until RNA extraction. Specimens were powdered in liquid N2, and total cellular RNA was extracted with guanidine isothiocyanate and purified by cesium chloride gradient centrifugation. Real-time RT-PCR analysis was performed using ABI prism 7000 (Perkin-Elmer) with a TaqMan probe for S6GalNAc6 provided by the manufacturer (assay Id Hs00203739_m1). The results were normalized as relative values using glyceraldehyde 3-phosphate dehydrogenase as a reference to compare mRNA expression. The results of real-time RT-PCR were ascertained by conventional RT-PCR using the set of primers described below.

Induction of 2->3, 2->6 Disialyl Lewisa Determinant and ST6GalNAc6 mRNA Expression in Colon Cancer Cells.
A cultured human colon cancer cell line, DLD-1, was cultured in the presence of butyrate (4 mM) or 5-azacytidine (20 µM) for 3 days and subjected to flow cytometric analysis for expression of 2->3, 2->6 disialyl Lewisa. Total RNA of cultured cells was isolated from 1 x 106 cells according to the acid guanidinium thiocyanate-chloroform extraction method using an Isogen kit (Nippon-Gene, Tokyo, Japan) and analyzed for ST6GalNAc6 mRNA by RT-PCR using ST6GalNAc6-specific primers (upper, CTCATCACCATCCTCATCCT; and lower, GAGACGGCATATGCTTCCAT) and human glyceraldehyde 3-phosphate dehydrogenase specific primers (upper, TGAAGGTCGGAGTCAACGGATTTGGT; and lower, CATGTGGGCCATGAGGTCCACCAC).

Confocal Microscopic Analysis.
Frozen sections of 10-µm thickness were prepared from a surgical specimen and studied for confocal microscopic observation. Polyclonal rabbit anti-Siglec-7 antibody (rabbit IgG raised against recombinant Siglec-7 and affinity purified) and monoclonal anti 2->3, 2->6 disialyl Lewisa (murine IgG) were used as primary antibodies. Alexa Fluor 488-labeled antirabbit IgG (green) and Alexa Fluor 594-labeled antimurine IgG (red) antibodies (Molecular Probes Inc., Eugene, OR) were used as secondary antibodies. A Bio-Rad Radiance 2100 inverted confocal laser scanning microscope equipped with LaserSharp 2000 software was used for observation.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transfection of Cells with ST6GalNAc6 sDNA.
The human cultured colon cancer cell line SW1083 expressed moderately 2->3 sialyl Lewisa determinant and essentially no 2->3, 2->6 disialyl Lewisa determinant under usual culture conditions. A significant induction of 2->3, 2->6 disialyl Lewisa determinant, as defined by the specific monoclonal antibody FH7, was observed when the cells were transfected with ST6GalNAc6 sDNA. Fig. 1ACitation shows the results of flow cytometric analysis of the four clones, clones 1–9, 1–5, 2–8, and 2–5, where clones 1–9 and 1–5 were weak expressors, and clones 2–8 and 2–5 were strong expressors of 2->3, 2->6 disialyl Lewisa determinant. Expression of the 2->3, 2->6 disialyl Lewisa determinant in these clones was well correlated with the amount of ST6GalNAc6 mRNA as ascertained by real-time RT-PCR analyses (Fig. 1B)Citation . The mRNA levels in terms of relative expression coefficient (the number of amplicons/103 glyceraldehyde 3-phosphate dehydrogenase amplicons) were 15.7 ± 1.2 and 26.7 ± 1.2 in low expressor clones 1–9 and 1–5, respectively, and 60.5 ± 5.0 and 65.8 ± 8.6 in high expressor clones 2–8 and 2–5, respectively, whereas that for parental SW1083 cells were 0.58 ± 0.06 (mean ± SD; all of the clones showed statistical significance in comparison with parental cells at P < 0.001).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Flow cytometric analysis of disialyl Lewisa and monosialyl Lewisa determinants on human colon cancer SW1083 cells and the clones transfected with ST6GalNAc6 cDNA. Results on four representative transfectant clones (1–9, 1–5, 2–8, and 2–5) are shown. A, ordinate, number of cells; abscissa, fluorescence intensity. Monoclonal antibody FH7 was used for detection of the 2->3, 2->6 disialyl Lewisa determinant and N19-9 for the 2->3 monosialyl Lewisa determinant. Percentage of positive cells is shown in the flow profiles. B, expression of ST6GalNAc6 mRNA in these clones analyzed by real-time reverse transcription-PCR. Delta Rn versus cycle number plot and Ct versus log concentration plot are shown. Rn, randon.

 
The expression of sialyl Lewisa, the cancer-associated monosialylated determinant defined by N19-9 antibody, showed an inverse correlation with that of 2->3, 2->6 disialyl Lewisa determinant among these clones (Fig. 1A)Citation , suggesting substrate competition for the synthesis of these determinants. The correlation coefficient between the sialyl Lewisa expression and the 2->3, 2->6 disialyl Lewisa expression was r = –0.988 (Pearson’s correlation coefficient), showing a good inverse correlation with statistical significance at P < 0.002. Because it has been shown previously that ST6GalNAc6 can transfer sialic acid only to the synthetic precursors of these determinants having no fucose residues, the substrate competition is predicted to occur at the level of conversion of 2->3 sialylated Lewisc to 2->3, 2->6 disialylated Lewisc as suggested previously (16) .

Significance of 2->3, 2->6 Disialyl Lewisa Determinant in E-Selectin-Mediated Cell Adhesion.
Although we have shown previously that sialyl Lewisa, the cancer-associated determinant, serves as a ligand for E-selectin and is capable of mediating E-selectin-mediated cell adhesion (4 , 5 , 22) , we tested next whether the transfectant cells, which have decreased sialyl Lewisa expression but an increased 2->3, 2->6 disialyl Lewisa expression, have any binding activity to E-selectin. As shown in Fig. 2ACitation , the transfectant clones showed a significantly decreased adhesion to E-selectin-expressing 300.19 cells compared with parental SW1083 cells, and the degree of decrease correlated well with the decrease in sialyl Lewisa expression, whereas no correlation was observed with the expression of 2->3, 2->6 disialyl Lewisa on the clones.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. Adhesion of cells transfected with ST6GalNAc6 cDNA to E-selectin. A, adhesion of 300.19/E-selectin cells to the parental SW1083 cells, and the transfectant clones as ascertained by the nonstatic monolayer cell adhesion experiments. *, difference from parental SW1083 cells was statistically significant at P < 0.001; **, P < 0.0001. B indicates binding of recombinant E-selectin-immunoglobulin (rec-E-sel) to the parental SW1083 cells, and the transfectant clones as ascertained by flow cytometric analysis. Percentage of positive cells are shown in the flow profiles. Recombinant E-selectin-immunoglobulin was polymerized and labeled using the secondary antibody phycoerythrin-streptavidin before addition to the cells (see "Materials and Methods"). EDTA and monoclonal antibodies N19-9 (anti-2->3 monosialyl Lewisa) and FH7 (anti-2->3, 2->6 disialyl Lewisa) were used for inhibition of binding at 10 µg/ml; bars, ±SD.

 
The results of cell-cell adhesion experiments were clearly reproduced and supported by the binding studies of recombinant E-selectin in flow-cytometry, as shown in Fig. 2BCitation , which indicated a good correlation of recombinant E-selectin-immunoglobulin binding to the expression of sialyl Lewisa determinant but not to 2->3, 2->6 disialyl Lewisa expression. The correlation coefficient between the sialyl Lewisa expression and E-selectin binding was r = 0.998 (statistically significant at P < 0.0005) in these clones. Addition of EDTA in the incubation medium almost suppressed completely the binding, thereby confirming that the binding is Ca2+-dependent, which is compatible with E-selectin-mediated binding. Addition of the N19-9 antibody specific to sialyl Lewisa abrogated completely the binding of recombinant E-selectin-immunoglobulin, whereas that of FH7 antibody specific to 2->3, 2->6 disialyl Lewisa had essentially no effect (Fig. 2B)Citation , indicating that only sialyl Lewisa served as a ligand for E-selectin, whereas 2->3, 2->6 disialyl Lewisa did not.

Significance of 2->3, 2->6 Disialyl Lewisa Determinant in Siglec-7-Mediated Cell Adhesion.
Because the 2->3, 2->6 disialyl Lewisc determinant, with its structure closely related to 2->3, 2->6 disialyl Lewisa determinant, was reported earlier to have a binding activity to a sialic-acid-dependent cell adhesion molecule, Siglec-7 (23) , we tested next the binding activity of the transfectant cells to recombinant Siglec-7-immunoglobulin. As shown in Fig. 3ACitation , the parental SW1083 cells, which are devoid of 2->3, 2->6 disialyl Lewisa expression, did not show any appreciable binding of recombinant Siglec-7-immunoglobulin, whereas high-expresser clones showed strong binding. The binding was blocked completely by the addition of anti-Siglec-7 antibody to the incubation medium, indicating that the observed binding was Siglec-7 specific. The mutant recombinant Siglec-7, which lacks the essential amino acid residue for binding, showed no binding. In inhibition studies, the binding of Siglec-7 was not affected by the addition of anti-2->3 sialyl Lewisa antibody N19–9 and inhibited strongly by the anti-2->3, 2->6 disialyl Lewisa antibody FH7, suggesting that most of the binding was mediated by the latter determinant (Fig. 3A)Citation .



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Adhesion of cells transfected with ST6GalNAc6 cDNA to Siglec-7. A, binding of recombinant Siglec-7-immunoglobulin to the parental SW1083 cells and the transfectant clones as ascertained by flow cytometric analysis. Recombinant Siglec-7-immunoglobulin was polymerized and labeled using the secondary antibody and phycoerythrin-streptavidin before addition to the cells (see "Materials and Methods"). Monoclonal antibodies 13-3-D (anti-Siglec-7), N19-9 (anti-2->3 monosialyl Lewisa), FH7 (anti-2->3, 2->6 disialyl Lewisa), and FH9 (anti-2->3, 2->6 disialyl Lewisc) were used for inhibition of binding at 10 µg/ml. B, adhesion of U937 cells expressing Siglec-7 to the parental SW1083 cells, and a transfectant clone ascertained by the nonstatic monolayer cell adhesion experiments. Percentage of positive cells are shown in flow profiles. For inhibition experiments, representative results using clone 2–8 are shown. *, difference from control was statistically significant at P < 0.005; **, at P < 0.002; and ***, at P < 0.0001. C shows expression of 2->3, 2->6 disialyl Lewisc determinant on the parental SW1083 cells, and the transfectant clones ascertained by flow cytometry. Parent, parental SW1083 cells. Ordinate, number of cells; abscissa and fluorescence intensity; bars, ±SD.

 
Another antibody, FH9, which is known to be specific to 2->3, 2->6 disialyl Lewisc determinant (15 , 24) , showed also a significant inhibition of the Siglec-7 binding to the clones. Combination of FH7 and FH9 led to almost complete inhibition of Siglec-7 binding to the cells (Fig. 3A)Citation .

These results were reproduced in the results of nonstatic monolayer cell adhesion assays, which indicate the interaction of these molecules at the cell-to-cell level, as shown in Fig. 3BCitation . The transfectant clones showed strong adhesion to Siglec-7-expressing U937 cells, whereas parental SW1083 cells showed no appreciable adhesion. The adhesion was abrogated almost completely by the addition of antisiglec-7 neutralizing antibody 13-3-D and inhibited strongly by the addition of anti-anti-2->3, 2->6 disialyl Lewisa antibody FH7. Combination of FH7 and FH9 conferred almost complete inhibition of adhesion.

These results suggest strongly that 2->3, 2->6 disialyl Lewisa served as a ligand for Siglec-7 on the clones transfected with ST6GalNAc6 cDNA, with an additional contribution of the 2->3, 2->6 disialyl Lewisc determinant on the clones. This was in line with the weak or moderate expression of 2->3, 2->6 disialyl Lewisc determinant on the clones but not on the parental SW1083 cells (Fig. 3C)Citation .

Confirmation of Binding of Recombinant Siglec-7 to Pure 2->3, 2->6 Disialyl Determinants.
It is well known that 2->3 sialyl Lewisa determinant serves as a suitable ligand for E-selectin (5 , 22 , 25) , and the binding activity of Siglec-7 to 2->3, 2->6 disialyl Lewisc has been reported also (23) . Because the binding activity of Siglec-7 to 2->3, 2->6 disialyl Lewisa has not been known before and first reported in the present study, we assured next the direct binding activity using pure carbohydrate determinant and recombinant Siglec-7. As shown in Fig. 4Citation , recombinant Siglec-7 showed significant binding activity to synthetic 2->3, 2->6 disialyl Lewisa, which was comparable with its binding to 2->3, 2->6 disialyl Lewisc, indicating that the addition of fucose residue to 2->3, 2->6 disialyl Lewisc had no apparent effect on the binding of Siglec-7 to its ligands.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Direct binding of recombinant Siglec-7-immunoglobulin to the pure synthetic carbohydrate determinants ascertained by ELISA. The synthetic carbohydrate determinants 2->3, 2->6 disialyl Lewisa and 2->3, 2->6 disialyl Lewisc were immobilized at the bottom of 96-well plates with phosphatidylcholine and cholesterol and reacted with a mixture of the recombinant Siglec-7-immunoglobulin or its mutant lacking the binding activity, affinity-purified biotinylated goat antihuman IgG antibody (20 µg/ml); avidin-peroxidase (20 µg/ml) was overlaid and incubated for 60 min at 4°C. The reaction was visualized with 3,3'-diaminobenzidine tetrahydrochloride followed by photometry at 490 nm (39) ; bars, ±SD.

 
Expression of ST6GalNAc6 mRNA in Human Colon Cancer Tissues.
As we have shown previously, the 2->3, 2->6 disialyl Lewisa determinant is expressed preferentially on nonmalignant epithelial cells of the digestive organs, and its expression tends to decrease on cancer cells (13, 14, 15) . We looked next at the expression of mRNA for ST6GalNAc6, the putative enzyme responsible for synthesis of the determinant in human colon cancer tissues. As shown in Table 2Citation , real-time RT-PCR analysis indicated that its mRNA expression is decreased significantly in cancer tissues compared with nonmalignant epithelial cells, something quite compatible with our previous findings that the 2->3, 2->6 disialyl Lewisa determinant is expressed preferentially on nonmalignant epithelial cells. A significant decrease in the expression of ST6GalNAc6 was confirmed by conventional RT-PCR (data not shown). This tendency was observed more prominently in patients in the relatively early stages of cancers (Dukes’ A and B) than in patients in the advanced stages (Dukes’ C and D; Table 2Citation ). The difference between the Dukes’ A and B group and the C and D group was statistically significant at P < 0.02.


View this table:
[in this window]
[in a new window]
 
Table 2 Quantitative RT-PCRa analysis of mRNA levels of ST6GalNAc6 in human colon cancer tissues and nonmalignant mucosa

Results of real-time RT-PCR analysis using specific TaqMan probe are shown. Sample RNA was prepared from the cancer tissue and nonmalignant colonic mucosa of the same patient (n = 21) except two cases where only cancer tissues were obtained.

 
Induction of Disialyl Lewisa and ST6GalNAc6 mRNA Expression in Cultured Human Colon Cancer Cells.
Most cultured human colon cancer cells strongly expressed sialyl Lewisa but did not express or only weakly expressed disialyl Lewisa. When such cells were treated with butyrate, a histone deacetylase inhibitor, or 5-azacytidine, an inhibitor of DNA methylation, significant disialyl Lewisa expression was induced, accompanied by significant induction of ST6GalNAc6 mRNA as shown in Fig. 5Citation . The time course and dose response studies indicated that the optimum concentration for butyrate was 2–4 mM and that for 5-aza-C was ~20 µM. Incubation of 3–5 days was necessary to detect a significant increase of ST6GalNAc6 mRNA in RT-PCR analysis, and incubation of 5–7 days was required to obtain maximum expression of the enzymatic product, disialyl Lewisa, in flow cytometric analyses. These results suggested collectively that the down-regulation of ST6GalNAc6 gene expression that synthesizes 2->3, 2->6 disialyl Lewisa determinant in nonmalignant epithelial cells occurred on malignant transformation, which led to the preferential expression of 2->3 sialyl Lewisa determinant in cancer cells. It implied also that the down-regulation of ST6GalNAc6 gene expression in cancer cells may well be because of epigenetic changes such as histone deacetylation and DNA methylation.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5. Induction of the 2->3, 2->6 disialyl Lewisa determinant and ST6GalNAc6 mRNA expression in cultured human colon cancer cells DLD-1 treated with histone deacetylase inhibitor butyrate or DNA methylation inhibitor 5-azacytidine. A, flow cytometric analysis of the 2->3, 2->6 disialyl Lewisa determinant. B, reverse transcription-PCR analysis of ST6GalNAc6 mRNA expression. DLD-1 cells were treated either with 4 mM butyrate or 20 µM 5-azacytidine for 3 days. For experimental details, see "Materials and Methods."

 
Siglec-7-Mediated Adhesion of Lymphocytes to Nonmalignant Epithelial Cells in Situ.
When frozen tissue sections prepared from 24 patients with colon cancers were immunohistochemically examined, the disialyl Lewisa determinant was found to be expressed preferentially in nonmalignant epithelia (P = 0.016 in {chi}2 test) and the monosialyl Lewisa determinant to be expressed preferentially in cancer cells (P = 0.011 in {chi}2 test), confirming our earlier results (13 , 14) . Typical results of the immunohistochemical study are shown in Fig. 6, A and BCitation .



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 6. Microscopic observation of epithelial cells expressing disialyl Lewisa and leukocytes expressing Siglec-7 in human colonic mucosa. A and B, expression of 2->3, 2->6 disialyl Lewisa and 2->3 monosialyl Lewisa in a representative colon cancer tissue analyzed by routine avidin-biotin-complex immunohistochemical staining using FH7 or N19-9 antibody. In confocal microscopic analysis in C–J, distribution of Siglec-7, as detected by polyclonal anti-Siglec-7 antibody, is shown in green, and distribution of the 2->3, 2->6 disialyl Lewisa determinant is shown in red. C, lower magnification of nonmalignant colonic mucosa adjacent to colon cancer tissue. D, adhesion of Siglec-7-expressing lymphoid cells to colonic epithelial cells (arrows). E, higher magnification showing adhesion of Siglec-7-expressing lymphoid cells (green) to nonmalignant colonic epithelial cells expressing the 2->3, 2->6 disialyl Lewisa determinant (red) through pseudopodia-like extensions (arrowheads). C and F–J, comparison of distribution of both molecules in cancer tissues and nonmalignant mucosa in 6 typical tissue sections. Most cancer tissues were devoid of 2->3, 2->6 disialyl Lewisa determinant and Siglec-7 expression as shown in portions labeled Ca in C and G–H, although some cancer cells expressed weakly 2->3, 2->6 disialyl Lewisa determinant as in I and J. C–E are sections from the same patient (case A), whereas sections for F–J were prepared from five independent patients (cases B–F). Ca, cancer tissues; N, nonmalignant mucosa. Bars, 10 µm.

 
Because Siglec-7 is known to be expressed on lymphocytes and monocytes, the above results showing the preferential expression of disialyl Lewisa in nonmalignant epithelial cells suggested that it could mediate adhesion of these leukocytes to normal epithelial cells. We chose six representative tissue sections (cases A–F) and performed confocal microscopic observation. The results indicated that a significant number of lymphocytes and monocytes expressing Siglec-7 were present in the connective tissue of lamina propria of colonic mucosal membranes (Fig. 6C)Citation , part of which exhibited a significant tendency to adhere to colonic epithelial cells (Fig. 6DCitation , indicated by arrows). Color resolution of the contact surface indicated that lymphocytes and monocytes adhered to the epithelial cells not by their cell body but rather through pseudopodia-like structures (Fig. 6E)Citation . Adhesion of lymphoid cells to epithelial cells through a pseudopodia-like structure was noted previously by electron-microscopic observations (26 , 27) , and our results indicated that these lymphoid cells express Siglec-7, and the epithelial cells express its ligand, disialyl Lewisa.

In cancer tissues, in contrast, the expression of 2->3, 2->6 disialyl Lewisa determinant showed a significant decrease as described earlier (13, 14, 15 , 28) , which was accompanied by the disappearance of Siglec-7-expressing lymphocytes and monocytes (cases A–D; Fig. 6, C and F–HCitation ). The weak expression of 2->3, 2->6 disialyl Lewisa determinant observed in cancer cells of some patients (cases E and F; Fig. 6, I and JCitation ) was accompanied occasionally by moderate infiltration of Siglec-7 expressing lymphocytes and/or monocytes (Fig. 6J)Citation .


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The results obtained in the present study indicate collectively that the loss of expression of 2->3, 2->6 disialyl Lewisa, the determinant expressed preferentially in nonmalignant colonic epithelial cells, is involved, at least partially, in the enhancement of expression of the 2->3 sialyl Lewisa determinant, a cancer-associated carbohydrate determinant, in colon cancer cells. Impairment of 2->6 sialylation at the GlcNAc moiety is proposed to occur on malignant transformation of colonic epithelial cells, which leads to the loss of 2->3, 2->6 disialyl Lewisa determinant and gain of the 2->3 sialyl Lewisa determinant in cancer cells. The 2->3 sialyl Lewisa determinant in cancer cells is involved in hematogenous metastasis, whereas the 2->3, 2->6 disialyl Lewisa determinant in nonmalignant epithelial cells mediates normal interaction with intramucosal lymphoid cells. This can be regarded as a typical example of the classical concept of incomplete synthesis for the abnormal expression of carbohydrate determinants in cancers. We reported earlier a very similar relationship between the distribution of sialyl Lewisx, another ligand for E-selectin, which was expressed preferentially on cancer cells, and the distribution of sialyl 6-sulfo Lewisx, which was localized predominantly in nonmalignant colonic epithelial cells (29) . In this case, some impairment of 6-sulfation was suggested to occur on malignant transformation of colonic epithelial cells, which led to the loss of sialyl 6-sulfo Lewisx determinant and gain of sialyl Lewisx in cancer cells (29) .

A significant down-regulation of ST6GalNAc6, the sialyltransferase responsible for the synthesis of 2->3, 2->6 disialyl Lewisa determinant, must be involved closely in the observed phenomenon. Many researchers have tried in vain to elucidate the mechanism for the increased expression of sialyl Lewisa in cancers by looking for evidence of the up-regulation of its synthetic enzymes (4 , 6, 7, 8, 9 , 30) . However, the present results suggest clearly that the problem revolves not necessarily around the up-regulation of its synthetic enzymes, but rather the down-regulation of such an enzyme, which leads to synthesis of other determinants having a structure more complicated than sialyl Lewisa.

The main cause for the down-regulation of the ST6GalNAc6 gene transcription is proposed to be epigenetic changes such as histone deacetylation and DNA methylation. It is well known that the expression of A- and B-determinants is decreased significantly in cancers, and DNA methylation of the genes for A- or B-enzyme is proposed to be responsible for their decrease in cancers (31 , 32) . We propose that these epigenetic changes would be one of the major mechanisms causing cancer-associated changes in carbohydrate determinants in early stage cancers, especially for the mechanism referred to previously as incomplete synthesis.

The 2->3, 2->6 disialyl Lewisa determinant, which is expressed preferentially on nonmalignant epithelial cells, is shown to have no apparent binding ability to E-selectin, yet a significant binding activity to another cell adhesion molecule, Siglec-7. Siglec-7 was described first as an inhibitory receptor p75/adhesion inhibitory receptor molecule-1 present on lymphocytes and monocytes, where the ligand binding is supposed to inhibit the cytotoxic and proliferative activity of the leukocytes (33, 34, 35, 36, 37) . The physiological significance of the 2->3, 2->6 disialyl Lewisa determinant on nonmalignant epithelial cells can be proposed to protect epithelial cells from unexpected cytotoxic attack by the autologous lymphocytes and monocytes. Siglec-7-positive natural killer cells are known to comprise usually <5% of normal peripheral blood mononuclear cells (33) , but in the present study, we found that many lymphocytes in colonic mucosa strongly express Siglec-7.

Induction of sialyl Lewisa expression in cancers of the digestive organs is accompanied by an increased ability of cancer cells to adhere to endothelial cells through the interaction with endothelial E-selectin (2 , 4 , 5) . This interaction was demonstrated earlier to be involved also in tumor angiogenesis (38) . The current study indicated that the gain of sialyl Lewisa expression is accompanied by the loss of the 2->3, 2->6 disialyl Lewisa determinant on epithelial cells, which binds to a leukocyte inhibitory receptor, Siglec-7, and may play a role in protecting normal epithelial cells. Confocal microscopic observation indicated that normal intramucosal trafficking of lymphocytes bearing an inhibitory receptor, Siglec-7/p75/adhesion inhibitory receptor molecule-1, in the colon is diminished accompanying the cancer-associated change in cell-adhesive carbohydrate determinants.


    ACKNOWLEDGMENTS
 
We thank Dr. Geoffrey S. Kansas for the gift of 300.19 cells transfected with human E-selectin cDNA. We are also indebted to Drs. Hirosato Kondo and Yoshimasa Inoue for the gift of human recombinant E-selectin-IgG chimera.


    FOOTNOTES
 
Grant support: Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology, Japan (15590263 and on priority areas 14030092), Grants-in-Aid for the Second Term Comprehensive Ten-Year Strategy for Cancer Control from the Ministry of Health, Labor and Welfare, Japan, and a grant from the CREST program of the Japan Science and Technology Agency.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Makoto Takeuchi was deceased on November 29, 2001. We mourn his loss while this study was in progress.

Requests for reprints: Reiji Kannagi, Department of Molecular Pathology, Research Institute, Aichi Cancer Center, 1-1 Kanokoden, Chikusaku, Nagoya 464-8681, Japan. Fax: 81-52-764-2793; E-mail: rkannagi{at}aichi-cc.jp

Received 11/18/03. Revised 3/23/04. Accepted 4/14/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hakomori S. Glycosylation defining cancer malignancy: new wine in an old bottle. Proc Natl Acad Sci USA, 99: 10231-3, 2002.[Free Full Text]
  2. Hakomori S. Tumor malignancy defined by aberrant glycosylation and sphingo-(glyco)lipid metabolism. Cancer Res, 56: 5309-18, 1996.[Abstract/Free Full Text]
  3. Kannagi R. Molecular mechanism for cancer-associated induction of sialyl Lewis X and sialyl Lewis A expression: the Warburg effect revisited. Glycoconj, 20: 353-64, 2004.
  4. Kannagi R. Carbohydrate-mediated cell adhesion involved in hematogenous metastasis of cancer. Glycoconj J, 14: 577-84, 1997.[CrossRef][Medline]
  5. Takada A, Ohmori K, Yoneda T, et al Contribution of carbohydrate antigens sialyl Lewis A and sialyl Lewis X to adhesion of human cancer cells to vascular endothelium. Cancer Res, 53: 354-61, 1993.[Abstract/Free Full Text]
  6. Ito H, Hiraiwa N, Sawada-Kasugai M, et al Altered mRNA expression of specific molecular species of fucosyl- and sialyltransferases in human colorectal cancer tissues. Int J Cancer, 71: 556-64, 1997.[CrossRef][Medline]
  7. Mack DR, Cheng PW, Perini F, Wei S, Hollingsworth MA. Altered expression of sialylated carbohydrate antigens in HT29 colonic carcinoma cells. Glycoconj J, 15: 1155-63, 1998.[CrossRef][Medline]
  8. Salvini R, Bardoni A, Valli M, Trinchera M. ß1,3-galactosyltransferase ß3Gal-T5 acts on the GlcNAcß1–3Galß1–4GlcNAcß1-R sugar chains of carcinoembryonic antigen and other N-linked glycoproteins and is down-regulated in colon adenocarcinomas. J Biol Chem, 276: 3564-73, 2001.[Abstract/Free Full Text]
  9. Kumamoto K, Goto Y, Sekikawa K, et al Increased expression of UDP-galactose transporter mRNA in human colon cancer tissues and its implication in synthesis of Thomsen-Friedenreich antigen and sialyl Lewis A/X determinants. Cancer Res, 61: 4620-7, 2001.[Abstract/Free Full Text]
  10. Hakomori S. Tumor-associated glycolipid antigens, their metabolism and organization. Chem Phys Lipids, 42: 209-33, 1986.[CrossRef][Medline]
  11. Hakomori S. Tumor-associated glycolipid antigens defined by monoclonal anti-bodies. Bull Cancer, 70: 118-26, 1983.[Medline]
  12. Hakomori S, Kannagi R. Glycosphyngolipids as tumor-associated and differentiation markers. J Natl Cancer Inst (Bethesda), 71: 231-51, 1983.
  13. Itai S, Nishikata J, Yoneda T, et al Tissue distribution of sialyl 2-3 and 2-6 Lewis a antigens and the significance of serum 2-3/2-6 sialyl Lewis a antigen ratio for the differential diagnosis of malignant and benign disorders of the digestive tract. Cancer (Phila), 67: 1576-87, 1991.[CrossRef]
  14. Itai S, Arii S, Tobe R, et al Significance of 2-3 and 2-6 sialylation of Lewis A antigen in pancreas cancer. Cancer (Phila), 61: 775-87, 1988.[CrossRef]
  15. Kannagi R, Kitahara A, Itai S, et al Quantitative and qualitative characterization of human cancer-associated serum glycoprotein antigens expressing epitopes consisting of sialyl or sialyl-fucosyl type 1 chains. Cancer Res, 48: 3856-63, 1988.[Abstract/Free Full Text]
  16. Tsuchida A, Okajima T, Furukawa K, et al Synthesis of disialyl Lewis a structure in colon cancer cell lines by a sialyltransferase ST6GalNAc VI responsible for the synthesis of {alpha}-series gangliosides. J Biol Chem, 278: 22787-94, 2003.[Abstract/Free Full Text]
  17. Yamaji T, Teranishi T, Alphey MS, Crocker PR, Hashimoto Y. A small region of the natural killer cell receptor, Siglec-7, is responsible for its preferred binding to {alpha} 2,8-disialyl and branched {alpha} 2,6-sialyl residues. A comparison with Siglec-9. J Biol Chem, 277: 6324-32, 2002.[Abstract/Free Full Text]
  18. Ando T, Ishida H, Kiso M. First total synthesis of {alpha}-(2->3)/{alpha}-(2->6)-disialyl lactotetraosyl ceramide and disialyl Lewis A ganglioside as cancer-associated carbohydrate antigens. Carbohydr Res, 338: 503-14, 2003.[CrossRef][Medline]
  19. Kimura N, Mitsuoka C, Kanamori A, et al Reconstitution of functional L-selectin ligands on a cultured human endothelial cell line by cotransfection of {alpha}1->3 fucosyltransferase VII and newly cloned GlcNAcß: 6-sulfotransferase cDNA. Proc Natl Acad Sci USA, 96: 4530-5, 1999.[Abstract/Free Full Text]
  20. Kansas GS, Ley K, Munro JM, Tedder TF. Regulation of leukocyte rolling and adhesion to high endothelial venules through the cytoplasmic domain of L-selectin. J Exp Med, 177: 833-8, 1993.[Abstract/Free Full Text]
  21. Astler VA, Coller FA. The prognostic significance of direct extension of the colon and rectum. Ann Surg, 139: 846-52, 1954.[Medline]
  22. Takada A, Ohmori K, Takahashi N, et al Adhesion of human cancer cells to vascular endothelium mediated by a carbohydrate antigen, sialyl Lewis A. Biochem Biophys Res Commun, 179: 713-9, 1991.[CrossRef][Medline]
  23. Ito A, Handa K, Withers DA, Satoh M, Hakomori S. Binding specificity of siglec7 to disialogangliosides of renal cell carcinoma: possible role of disialogangliosides in tumor progression. FEBS Lett, 504: 82-6, 2001.[CrossRef][Medline]
  24. Fukushi Y, Nudelman E, Levery SB, Higuchi T, Hakomori S. A novel disialoganglioside (IV3NeuAcIII6NeuAcLc4) of human adenocarcinoma and the monoclonal antibody (FH9) defining this disialosyl structure. Biochemistry, 25: 2859-66, 1986.[CrossRef][Medline]
  25. Berg EL, Robinson MK, Mansson O, Butcher EC, Magnani JL. A carbohydrate domain common to both sialyl Lea and sialyl Lex is recognized by the endothelial cell leukocyte adhesion molecule ELAM-1. J Biol Chem, 266: 14869-72, 1991.[Abstract/Free Full Text]
  26. Lundqvist C, Baranov V, Hammarstrom S, Athlin L, Hammarstrom ML. Intra-epithelial lymphocytes. Evidence for regional specialization and extrathymic T cell maturation in the human gut epithelium. Int Immunol, 7: 1473-87, 1995.[Abstract/Free Full Text]
  27. Hadziselimovic F, Emmons LR, Schaub U, et al Occurrence of large granular lymphocytes and natural killer cells in the epithelium of the gut distinguishes two different coeliac diseases. Gut, 33: 767-72, 1992.[Abstract/Free Full Text]
  28. Young WW, Jr, Mills SE, Lippert MC, Ahmed P, Lau SK. Deletion of antigens of the Lewis a/b blood group family in human prostatic carcinoma. Am J Pathol, 131: 578-86, 1988.[Abstract]
  29. Izawa M, Kumamoto K, Mitsuoka C, et al Expression of sialyl 6-sulfo Lewis x is inversely correlated with conventional sialyl Lewis x expression in human colorectal cancer. Cancer Res, 60: 1410-6, 2000.[Abstract/Free Full Text]
  30. Petretti T, Kemmner W, Schulze B, Schlag PM. Altered mRNA expression of glycosyltransferases in human colorectal carcinomas and liver metastases. Gut, 46: 359-66, 2000.[Abstract/Free Full Text]
  31. Hakomori S. Antigen structure and genetic basis of histo-blood groups A, B and O: their changes associated with human cancer[review]. Biochim Biophys Acta, 1473: 247-66, 1999.[Medline]
  32. Iwamoto S, Withers DA, Handa K, Hakomori S. Deletion of A-antigen in a human cancer cell line is associated with reduced promoter activity of CBF/NF-Y binding region, and possibly with enhanced DNA methylation of A transferase promoter. Glycoconj J, 16: 659-66, 1999.[CrossRef][Medline]
  33. Falco M, Biassoni R, Bottino C, et al Identification and molecular cloning of p75/AIRM1, a novel member of the sialoadhesin family that functions as an inhibitory receptor in human natural killer cells. J Exp Med, 190: 793-802, 1999.[Abstract/Free Full Text]
  34. Nicoll G, Ni J, Liu D, et al Identification and characterization of a novel siglec, siglec-7, expressed by human natural killer cells and monocytes. J Biol Chem, 274: 34089-95, 1999.[Abstract/Free Full Text]
  35. Angata T, Varki A. Siglec-7: a sialic acid-binding lectin of the immunoglobulin superfamily. Glycobiology, 10: 431-8, 2000.[Abstract/Free Full Text]
  36. Crocker PR. Siglecs: sialic-acid-binding immunoglobulin-like lectins in cell-cell interactions and signalling. Curr Opin Struct Biol, 12: 609-15, 2002.[CrossRef][Medline]
  37. Vitale C, Romagnani C, Falco M, et al Engagement of p75/AIRM1 or CD33 inhibits the proliferation of normal or leukemic myeloid cells. Proc Natl Acad Sci USA, 96: 15091-6, 1999.[Abstract/Free Full Text]
  38. Tei K, Kawakami-Kimura N, Taguchi O, et al Roles of cell adhesion molecules in tumor angiogenesis induced by cotransplantation of cancer and endothelial cells to nude rats. Cancer Res, 62: 6289-96, 2002.[Abstract/Free Full Text]
  39. Mitsuoka C, Ohmori K, Kimura N, et al Regulation of selectin binding activity by cyclization of sialic acid moiety of carbohydrate ligands on human leukocytes. Proc Natl Acad Sci USA, 96: 1597-602, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
N. Kimura, K. Ohmori, K. Miyazaki, M. Izawa, Y. Matsuzaki, Y. Yasuda, H. Takematsu, Y. Kozutsumi, A. Moriyama, and R. Kannagi
Human B-lymphocytes Express {alpha}2-6-Sialylated 6-Sulfo-N-acetyllactosamine Serving as a Preferred Ligand for CD22/Siglec-2
J. Biol. Chem., November 2, 2007; 282(44): 32200 - 32207.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. Varki and T. Angata
Siglecs--the major subfamily of I-type lectins
Glycobiology, January 1, 2006; 16(1): 1R - 27R.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. I. Kawamura, R. Kawashima, R. Fukunaga, K. Hirai, N. Toyama-Sorimachi, M. Tokuhara, T. Shimizu, and T. Dohi
Introduction of Sda Carbohydrate Antigen in Gastrointestinal Cancer Cells Eliminates Selectin Ligands and Inhibits Metastasis
Cancer Res., July 15, 2005; 65(14): 6220 - 6227.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
T. Yamaji, M. Mitsuki, T. Teranishi, and Y. Hashimoto
Characterization of inhibitory signaling motifs of the natural killer cell receptor Siglec-7: attenuated recruitment of phosphatases by the receptor is attributed to two amino acids in the motifs
Glycobiology, July 1, 2005; 15(7): 667 - 676.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. S. Bochner, R. A. Alvarez, P. Mehta, N. V. Bovin, O. Blixt, J. R. White, and R. L. Schnaar
Glycan Array Screening Reveals a Candidate Ligand for Siglec-8
J. Biol. Chem., February 11, 2005; 280(6): 4307 - 4312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire