Cancer Research Donn Young  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ford, C. E.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ford, C. E.
Right arrow Articles by Rawlinson, W. D.
[Cancer Research 64, 4755-4759, July 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Progression from Normal Breast Pathology to Breast Cancer Is Associated with Increasing Prevalence of Mouse Mammary Tumor Virus-Like Sequences in Men and Women

Caroline E. Ford1,2, Margaret Faedo1,2, Roger Crouch3, James S. Lawson4 and William D. Rawlinson1,2

1 Virology Division, Department of Microbiology, South Eastern Area Laboratory Services, Prince of Wales Hospital, Randwick, New South Wales, Australia; 2 Department of Biotechnology and Biomolecular Science, University of New South Wales, Kensington, New South Wales, Australia; 3 Department of Anatomical Pathology, Prince of Wales Hospital, Randwick, New South Wales, Australia; and 4 School of Public Health, University of New South Wales, Kensington, New South Wales, Australia


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mouse mammary tumor virus (MMTV)-like sequences have been found in up to 40% of breast cancer samples but in <2% of normal breast tissue samples from Australian women studied by our group. Screening of a larger and more diverse cohort of female breast cancer samples has now shown a correlation of MMTV-like sequences with the severity (grade) of breast cancer. Thirty-two percent (43 of 136) of female breast cancer samples were positive for MMTV-like sequences when screened using PCR. A significant gradient of MMTV positivity was observed with increasing severity of cancer from 23% of infiltrating ductal carcinoma (IDC) grade I tumors to 34% of IDC grade II tumors (P = 0.00034) and 38% of IDC grade III tumors (P = 0.00002). We also report for the first time the detection of MMTV-like sequences in 62% (8 of 13) of male breast cancer samples and 19% (10 of 52) of male gynecomastia samples screened. MMTV-like sequences were demonstrated in various premalignant breast lesions of females, including fibroadenoma (20%) and fibrocystic disease (28%) samples, at a significantly higher prevalence than that seen in normal breast tissue (1.8%; P = 0.00001). Study of a longitudinal cohort of female breast cancer patients indicated that MMTV was co-incident with tumor but was not present when tumor was absent on histology. These results support the association of MMTV-like sequences with development of breast tumors in men and women and suggest association of MMTV with increasing severity of cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The possible role of mouse mammary tumor virus (MMTV)-like sequences in human breast cancer remains controversial. The majority of recent reports linking MMTV and human breast cancer have come from one research group (1, 2, 3, 4) , including sequences of two complete pro-viral structures from human breast cancer tissue (5) . A second group has confirmed these results and also reported the presence of MMTV-like sequences in lymphomas (6) . We have independently reported the presence of MMTV-like sequences in 42% of Australian breast cancer samples and 1.8% of normal breast tissue samples (7) , similar to the results in studies of American, Argentinian, and Italian women (1 , 2) . However, there have recently been two small studies reporting the absence of MMTV-like sequences in breast tumors from Italian (8) and Austrian women (9) . Although all other studies to date demonstrate strong associations between the presence of MMTV-like sequences and human breast cancer, no causal link has yet been shown.

Investigations into the role of MMTV-like sequences in the progression from normal breast pathology to breast cancer were undertaken by examining a longitudinal cohort of breast cancer patients. We sought to determine whether MMTV-like sequences would be present in nonmalignant (NM) tissues and whether cases of MMTV-like sequences would be detected before positive breast cancer to further support the causal role of MMTV in tumorigenesis.

The prevalence of MMTV-like sequences has been shown to increase with severity of breast cancer from 1.8% in normal breast tissue to 26% in cases of ductal carcinoma in situ to 54% in infiltrating ductal carcinoma (IDC) cases in previous studies of Australian women (7) . We have subsequently followed up the two cases of MMTV sequence-positive normal breast tissue (2 of 111, 1.8%) and learned that breast cancer was present in one patient before testing for MMTV and in one patient after testing for MMTV, in the contralateral and ipsilateral breasts, respectively (10) . We have tested a larger and more diverse cohort of female breast cancer samples in this study to confirm our previous results showing a high prevalence of MMTV-like sequences in the Australian population. We also sought to correlate virus positivity with the specific grade of cancer in cases of IDC.

An area of controversy in the etiology of breast cancer is the effect of previous benign breast conditions (often referred to as premalignant breast lesions), such as fibrocystic disease, hyperplasia, and fibroadenoma, on the risk of subsequent breast cancer. These are relatively common breast lesions in women, although their contribution to the overall risk of breast cancer remains unclear (11 , 12) . Although not all women with a premalignant breast lesion develop breast cancer, it appears that a large number of patients do, and the reasons for this association remain unclear (13, 14, 15, 16, 17) . Explanations include the involvement of an oncogenic virus (18) and the coexistence of hormonal factors in benign and malignant conditions.

Gynecomastia is a benign breast disorder of males, characterized by enlargement of the breasts, that often occurs during puberty and other periods of hormonal imbalance in the breast (19) . The role of gynecomastia as a risk factor for breast cancer is contentious and is further complicated by the fact that many males choose to undergo surgery after the diagnosis of gynecomastia, thereby reducing the incidence of subsequent breast cancer (20) .

The vast majority of reports linking MMTV-like sequences and breast cancer have studied tissue from women only. Male breast cancer is a rare yet severe cancer of men (21) . Subsequently, due to the rarity of this disease in comparison with female breast cancer, much of what we know about the disease has been extrapolated from women (22) . No clear cause of male breast cancer has yet been determined, and the risk factors for the development of the disease in men are still unclear (23) . There has been one published study of the association between MMTV and male breast cancer (24) . This study has potential confounders because human endogenous retroviruses with close sequence homology to MMTV may also have been detected by the methods used (1 , 24) . We have therefore examined for the first time using molecular techniques the prevalence of these gene sequences in male breast cancer samples.

In summary, this study uses a new approach to examine the possibility of involvement of a MMTV-like virus in the progression from normal breast pathology to breast cancer. The prevalence of MMTV-like sequences was studied in female premalignant breast lesions, a graded cohort of female breast cancer samples, a longitudinal cohort of women with breast cancer, males with gynecomastia, and males with breast cancer. Results demonstrate the increasing prevalence of MMTV-like sequences in more severe tumors, association with tumors during overt cancer, and an apparent gradation of prevalence with the progression from normal to malignant pathology. These data support association of virus with tumorigenesis but also indicate wider prevalence of the virus in premalignant conditions.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissues.
The NIH3T3 (MMTV-positive murine cell line) and MCF-7 (MMTV-like env-positive human breast tumor cell line) cell lines were cultured according to conditions recommended by the manufacturer (American Type Culture Collection, Manassas, VA) and used as positive controls for PCR.

Tissue culture was conducted in a separate laboratory in a separate area of the hospital to the main laboratory. All breast tissues studied were from formalin-fixed, paraffin-embedded tissue samples selected from the archives of the Department of Anatomical Pathology, Prince of Wales Hospital (Sydney, Australia) between the years 1995 and 2003. This study was approved by the South Eastern Sydney Area Health Service Ethics Committee (00/189). Samples in the longitudinal cohort were selected on the basis of the availability of multiple biopsies taken between 1995 and 2003. Breast tissue samples were graded histopathologically as either high- or low-grade ductal carcinoma in situ; grade I, II, or III IDC; infiltrating lobular carcinoma; or NM/normal tissue by an experienced histopathologist, and grading was confirmed by a second histopathologist (R. C.) (25 , 26) . DNA was extracted and quantitated from the cell line, original breast cancer samples, subsequent episodes, and premalignant breast lesions as described previously (7) .

Detection of MMTV-Like Sequences using PCR.
Samples were tested for housekeeping genes and MMTV-like sequences using standard PCR precautions and procedures to avoid contamination, as described previously (7 , 27) . Due to problems with fragmentation of DNA from formalin fixation (28 , 29) , a new internal primer (MMTV 5F, GTATGAAGCAGGATGGGTAGA) was specifically designed to amplify a smaller (190-bp) template of MMTV envelope gene, thereby allowing improved amplification of MMTV-like sequences. The first round of amplification using primers 1X and 2NR (1) was performed as described previously (7) , followed by a semi-nested PCR step (primers MMTV 5F and 2NR), with cycling conditions of 94°C for 2 min; 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and 72°C for 3 min. Samples positive using PCR were retested and sequenced to confirm the presence of MMTV-like sequences in the sample and rule out amplification of nonspecific or endogenous retroviral sequences (7) . Sequences were analyzed using BLAST and EclustalW programs from the Australian National Genomic information Service to compare sequences between positive longitudinal samples and previously reported MMTV-like sequences amplified from human breast tissue.

Statistical Analysis.
Statistical analysis (Fisher’s exact test) was performed using the computer program SPSS Version 6.1.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Longitudinal Cohort.
Thirty-six cases of breast cancer were tested using PCR, and 10 (28%) of these were positive for MMTV-like sequences (Fig. 1Citation ; Table 1Citation ). Four of the 10 MMTV-positive patients (patients A-D) had NM breast tissue excised adjacent to the MMTV-positive breast cancer tissue. All four cases consisted of an original local excision to remove tumor, followed by a full mastectomy to remove additional tissue and clear tumor margins. All of the NM tissues were negative for MMTV-like sequences. An additional four patients (patients D-G) with recurrences of breast cancer had both breast cancer samples positive for MMTV-like sequences. These four cases consisted of local excisions to remove tumor, followed by the removal of additional tissue and/or mastectomy. Sequencing of the samples from initial and recurrent tumors showed 100% nucleotide identity and between 96.5% and 97.4% identity to the MMTV C3H strain (GenBank accession numbers AY496179-AY496184). There were two cases in which the second biopsy specimen (following original mastectomy to remove breast tumor) was located elsewhere than the breast (patients H and I). In patient H, in whom the second tumor biopsy was located in the cervix, MMTV-like sequences were detected, whereas in patient I, in whom the second tumor biopsy was located in the neck, no MMTV-like sequences were detected. There was one case of a lymph node excised (axillary dissection) following MMTV-like gene sequence-positive breast cancer that was also positive for MMTV-like sequences (patient J). The lymph node was histopathologically graded as NM but was positive on PCR for MMTV-like sequences. This was not due to contamination because appropriate controls and procedures were undertaken as described above, and the result were reproducible. All secondary tumor biopsies were negative from the 26 breast cancer samples negative on initial PCR for MMTV-like sequences. Twenty-two of the 26 negative tumor biopsies were located in the breast; however, there was one case each of a second biopsy taken from lymph node, nipple, leg, and skin tissue, all of which were negative for MMTV-like sequences.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Products amplified from longitudinal cohort using mouse mammary tumor virus semi-nested PCR (A) and glyceraldehyde-3-phosphate dehydrogenase housekeeping gene PCR (B). Lane M, size marker; Lane 1, patient A, infiltrating ductal carcinoma (IDC) grade II; Lane 2, patient A, nonmalignant (NM) breast tissue; Lane 3, patient B, IDC grade I; Lane 4, patient B, NM breast tissue; Lane 5, patient C, IDC grade III; Lane 6, patient C, fibrocystic disease; Lane 7, patient C, NM breast tissue; Lane 8, patient C, NM breast tissue; Lane 9, patient D, high-grade IDC; Lane 10, patient D, NM breast tissue; Lane 11, patient D, IDC grade III; Lane 12, patient E, IDC grade I; Lane 13, patient E, IDC grade I; Lane 14, negative control; Lane 15, extraction control; Lane 16, patient F, IDC grade II; Lane 17, patient F, low-grade ductal carcinoma in situ; Lane 18, patient G, IDC grade II; Lane 19, patient G, high-grade ductal carcinoma in situ; Lane 20, patient G, high-grade ductal carcinoma in situ; Lane 21, patient H, IDC grade II; Lane 22, patient H, papillary serous adenocarcinoma; Lane 23, patient I, IDC grade II; Lane 24, patient I, basal cell carcinoma; Lane 25, patient J, IDC grade I; Lane 26, patient J, NM lymph node; Lane 27, negative control; Lane 28, extraction control.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Summary of longitudinal breast cancer samples positive for MMTVa-like sequences with initial and subsequent biopsies from the same individuals

 
Female Samples.
An additional 136 female breast cancer samples were tested for the presence of MMTV-like sequences, and 43 samples were positive (32%). Of these 43 positive samples, a gradient of positivity was observed with increasing severity of breast cancer. The percentage of MMTV-positive tumors was significantly higher in IDC grade II (34%; P = 0.00034) and IDC grade III tumors (38%; P = 0.00002) when compared with IDC grade I tumors (23%; Table 2Citation ). Common breast lesions of females, identified as premalignant by some authors (11, 12, 13, 14, 15, 16, 17) , were also tested for MMTV-like sequences because these conditions have been suspected to be risk factors for subsequent breast cancer. Five of 25 (20%) fibroadenoma, 7 of 25 (28%) fibrocystic disease, and 1 of 4 (25%) hyperplasia samples tested were positive for MMTV-like sequences. Sequences amplified from female premalignant tissues were between 95.8% and 97.6% similar to the MMTV C3H strain (GenBank accession numbers AY600608-AY600615). The sequence differences to MMTV C3H noted in female premalignant breast conditions were not different from those noted previously in female breast cancer samples (7) . The difference in prevalence of MMTV-like sequences between all premalignant breast lesions and normal breast tissues was found to be highly significant (P = 0.00001; Table 2Citation ).


View this table:
[in this window]
[in a new window]

 
Table 2 Summary of archival breast tissue samples tested using seminested PCR, showing the percentage of samples positive for MMTVa-like sequences

 
Male Samples.
Due to the extreme rarity of male breast cancer in the Australian and other populations, establishment of a large cohort was difficult (30) . Eight of 13 (62%) male breast cancer samples were positive for MMTV-like sequences. Sequences amplified from male breast cancer tissue were between 96.6% and 98.6% similar to the MMTV C3H strain (GenBank accession numbers AY600596-AY600601). These 13 samples consisted of 8 IDC grade II tumors, 2 IDC grade III tumors, 2 ductal carcinoma in situ tumors, and 1 adenocarcinoma. Testing of male gynecomastia samples for the presence of MMTV-like sequences showed that 10 of 52 (19%) were positive, and these sequences were between 96.5% and 97.4% similar to the MMTV C3H strain (GenBank accession numbers AY600602-AY60007; Table 2Citation ). Whereas there were significant sequence differences between isolates from male breast cancer and gynecomastia and the MMTV C3H strain, there were no significant differences between sequences amplified from males and those amplified from females.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
These data contribute to the growing number of studies supporting the involvement (causal or epiphenomenon) of MMTV-like sequences in human breast cancer. There are several postulates that need to be fulfilled to establish a causal link between an agent and tumor development (31 , 32) . Firstly, it must be conclusively shown that the putative causative agent is consistently associated with the disease in question. Three independent groups have now demonstrated the presence of MMTV-like sequences in a large proportion of breast cancer samples, as opposed to normal breast samples (1 , 6 , 7) . Additionally, MMTV-like sequences have also consistently been shown to be present in a very low percentage of normal breast tissues (0–1.8%), including those from within the same breast (1 , 7 , 33) . Furthermore, the longitudinal study reported here shows that all NM breast tissues excised up to 24 months after breast cancer surgery are negative for MMTV-like sequences. The specificity of detecting MMTV-like sequences in virus-associated tumors is also supported by the 26 cases of breast cancer that were initially negative for MMTV and remained negative in their secondary tumor biopsy samples, which were located in the breast or elsewhere. The one other cancer positive for MMTV-like sequences was a case of papillary serous adenocarcinoma of the endocervix, a gynecological carcinoma (34 , 35) . This carcinoma occurred 4 years after a MMTV-like sequence-positive breast cancer was treated in the same woman.

The second postulate to be fulfilled in proving causality is to show that the suspected casual agent precedes the disease (31 , 32) . This has not yet been demonstrated in relation to MMTV-like sequences and human breast cancer. We have attempted to address this postulate by studying longitudinal breast cancer samples from a cohort of women, to follow the progression from normal breast pathology to breast cancer. The second approach taken to address this postulate was to test benign and possibly precancerous breast disease samples from both males and females for MMTV-like sequences.

For the first time, a clear gradient of samples positive for MMTV-like sequences with increasing severity of breast cancer has been demonstrated. The percentage of female breast cancer samples positive for MMTV-like sequences increased from 23% of IDC grade I tumors, to 34% of IDC grade II tumors to 38% of IDC grade III tumors. Furthermore, the prevalence of MMTV-like sequences in premalignant breast lesions (20–28%) was lower than that of cancerous tissue yet significantly higher (P = 0.00001) than that recorded in normal breast tissue (1.8%; Ref. 7 ). The recent description that the two cases of MMTV-positive normal breast tissue both had episodes of breast cancer adds further support to the association of a MMTV-like virus with breast cancer (10) . The gradient of MMTV prevalence with severity was also found in tumors taken from the male cohort, with 19% of gynecomastia samples positive for MMTV-like sequences compared with 62% of male breast cancer samples. The presence of MMTV-like sequences in fibroadenoma, fibrocystic disease, and gynecomastia samples is intriguing. There is evidence that these conditions increase a patient’s risk for subsequent breast cancer. If these are premalignant conditions, the presence of sequences from a possible oncogenic virus is of great interest. This raises the possibility that the presence of these sequences may act as a marker for future carcinogenesis. However, the possibility that these sequences do not contribute to the etiology of breast cancer and are instead an epiphenomenon cannot be ruled out at this stage. The absence of MMTV-like sequences from normal breast tissues anatomically related (NM tissue adjacent to MMTV-positive cancer tissue) and anatomically unrelated (normal breast tissue from reduction mammoplasties) to cancerous tissues suggests that these MMTV-like sequences do play a role in development of breast cell oncogenesis.

The connection between MMTV-like sequences and hormones is not yet clear; however, the results from this study suggest that some link exists. Breast cancer is a hormonally related tumor, as is endometrial carcinoma, both of which have been shown to be positive for MMTV-like sequences. The female premalignant breast lesions and male gynecomastia samples with significant rates of MMTV positivity (20–28% and 19%, Table 2Citation ) have strong links to hormonal imbalances of the breast (36 , 37) . Both MMTV and the putative human homolog of the virus have been shown to have hormone-responsive elements in the long terminal repeat regions of their genomes (5 , 38) . We have previously proposed a multifactorial model for breast carcinogenesis involving viral infection, hormones, and genetic elements (18) , and these additional data are consistent with such a model.

Overall, these new data support the association of a MMTV-like virus with human breast cancer. This study was conducted independently of earlier studies reporting a high prevalence of MMTV-like sequences in human breast cancer (1 , 6) and is in direct contrast to two recent negative reports questioning the association of MMTV-like sequences with breast cancer (8 , 9) . We have carefully refined the detection of MMTV-like sequences in formalin-fixed, paraffin-embedded breast tissues and used a different approach to the question of causality or epiphenomenon than previously undertaken. This is the first report of MMTV-like sequences in male gynecomastia samples and the first report to use molecular techniques to describe the prevalence of these sequences in male breast cancer and female premalignant breast lesions. These data, taken together, add to the growing number of studies implicating a MMTV-like virus in human breast cancer, although a clear causal relationship of MMTV to breast cancer remains to be established.


    ACKNOWLEDGMENTS
 
We thank Ting Ly and Enisa Hasic for technical assistance.


    FOOTNOTES
 
Grant support: Cancer Council New South Wales.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: William Rawlinson, Virology Division, Department of Microbiology, South Eastern Area Laboratory Services, The Prince of Wales Hospital, Randwick NSW 2031, Australia. Phone: 61-2-93829050; Fax: 61-2-93984275; E-mail: w.rawlinson{at}unsw.edu.au

Received 12/ 5/03. Revised 4/19/04. Accepted 5/ 6/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wang Y, Holland JF, Bleiweiss IJ, et al Detection of mammary tumor virus env gene-like sequences in human breast cancer. Cancer Res, 55: 5173-9, 1995.[Abstract/Free Full Text]
  2. Wang Y, Go V, Holland JF, Melana SM, Pogo BGT. Expression of mouse mammary tumor virus-like env gene sequences in human breast cancer. Clin Cancer Res, 4: 2565-8, 1998.[Abstract/Free Full Text]
  3. Wang Y, Pelisson I, Melana SM, et al MMTV-like env gene sequences in human breast cancer. Arch Virol, 146: 171-80, 2001.[CrossRef][Medline]
  4. Melana SM, Picconi MA, Rossi C, et al Detection of murine mammary tumor virus (MMTV) env gene-like sequences in breast cancer from Argentine patients. Medicina, 62: 323-7, 2002.
  5. Liu B, Wang Y, Melana SM, et al Identification of a proviral structure in human breast cancer. Cancer Res, 61: 1754-9, 2001.[Abstract/Free Full Text]
  6. Etkind P, Du J, Khan A, Pillitteri J, Wiernik PH. Mouse mammary tumor virus-like env gene sequences in human breast tumors and in a lymphoma of a breast cancer patient. Clin Cancer Res, 6: 1273-8, 2000.[Abstract/Free Full Text]
  7. Ford CE, Rawlinson WD, Tran D, et al MMTV-like gene sequences in breast tumors of Australian and Vietnamese women. Clin Cancer Res, 9: 1118-20, 2003.[Abstract/Free Full Text]
  8. Zangen R, Harden S, Cohen D, Parrella P, Sidransky D. Mouse mammary tumor-like env gene as a molecular marker for breast cancer?. Int J Cancer, 102: 304-7, 2002.[CrossRef][Medline]
  9. Witt A, Hartmann B, Marton E, et al The mouse mammary tumor virus-like env gene sequence is not detectable in breast cancer tissue of Austrian patients. Oncology Rep, 10: 1025-9, 2003.[Medline]
  10. Ford CE, Faedo M, Delprado W, Rawlinson WD. Corrigium to "mouse mammary tumor virus-like gene sequences in breast tumors of Australian and Vietnamese women[Letter]. Clin Cancer Res, 10: 802 2004.[Free Full Text]
  11. Schnitt SJ. Benign breast disease and breast cancer risk: potential role for antiestrogens. Clin Cancer Res., 7: 4419s-22s, 2001.
  12. Schnitt SJ. Benign breast disease and breast cancer risk: morphology and beyond. Am J Surg Pathol, 27: 836-41, 2003.[CrossRef][Medline]
  13. Ali-Fehmi R, Carolin K, Wallis T, Visscher W. Clinocopathologic analysis of breast lesions associated with multiple papillomas. Hum Pathol, 34: 234-9, 2003.[CrossRef][Medline]
  14. Going JJ. Stages on the way to breast cancer. J Pathol, 199: 1-3, 2002.[CrossRef]
  15. Hoogerbrugge N, Bult P, de Widt-Levert LM, et al High prevalence of premalignant lesions in prophylactically removed breast from women at hereditary risk for breast cancer. J Clin Oncol, 21: 41-5, 2003.[Abstract/Free Full Text]
  16. Levi F, Randimbison L, Te VC, La Vecchia C. Incidence of breast cancer in women with fibroadenoma. Int J Cancer, 57: 681-3, 1994.[Medline]
  17. Simmons RM, Osborne MP. The evaluation of high risk and pre-invasive breast lesions and the decision process for follow up and surgical intervention. Surg Oncol, 8: 55-65, 1999.[CrossRef][Medline]
  18. Lawson JS, Tran D, Rawlinson WD. From Bittner to Barr: a viral, diet and hormone breast cancer aetiology hypothesis. Breast Cancer Res, 3: 81-5, 2000.
  19. Daniels IR, Layer GT. Gynaecomastia. Eur J Surg, 167: 885-92, 2001.[CrossRef][Medline]
  20. Olsson HK, Bladstrom A, Alm P. Gynecomastia and the risk for malignant tumours: a cohort investigation. BMC Cancer, 2: 26-31, 2002.[CrossRef][Medline]
  21. Giordano SH, Buzdar AU, Hortobagyi GN. Breast cancer in men. Ann Intern Med, 137: 678-87, 2002.[Abstract/Free Full Text]
  22. Clamp A, Danson S, Clemons M. Hormonal risk factors for breast cancer: identification, chemoprevention, and other intervention strategies. Lancet Oncol, 3: 611-9, 2002.[CrossRef][Medline]
  23. Meguerditchian AN, Falardeau M, Martin G. Male breast carcinoma. Can J Surg, 45: 296-302, 2002.[Medline]
  24. Lloyd RV, Rosen PP, Sarkar NH, et al Murine mammary tumor virus related antigen in human male mammary carcinoma. Cancer (Phila), 51: 654-61, 1983.
  25. Dupont WD, Page DL. Risk factors for breast cancer in women with proliferative breast disease. New Engl J Med, 312: 146-51, 1985.[Abstract]
  26. Bloom HJG, Richardson WW. Histological grading and prognosis in breast cancer. Br J Cancer, 11: 359-77, 1957.[Medline]
  27. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature (Lond), 339: 237-8, 1989.[CrossRef][Medline]
  28. Greer CE, Peterson SL, Kiviat NB, Manos MM. PCR amplification from paraffin-embedded tissues. Effects of fixative and fixation time. Am J Clin Pathol, 95: 117-24, 1991.[Medline]
  29. Greer CE, Lund JK, Manos MM. PCR amplification from paraffin-embedded tissues: recommendations on fixatives for long-term storage and prospective studies. PCR Methods Applications, 1: 46-50, 1991.[Medline]
  30. Australian Institute of Health and Welfare. . Cancer in Australia 1998, p. 97 Australian Institute of Health and Welfare, Australasian Association of Cancer Registries Canberra, Australia 2001.
  31. Evans AS, Mueller NE. Viruses and cancer. Causal associations. AEP, 1: 71-92, 1990.
  32. Vonka V. Causality in medicine: the case of tumours and viruses. Philos Trans R Soc Lond, 355: 1831-41, 2000.[Abstract/Free Full Text]
  33. Melana SM, Holland JF, Pogo BG-T. Search for mouse mammary tumor virus-like env sequences in cancer and normal breast from the same individuals. Clin Cancer Res, 7: 283-4, 2001.[Abstract/Free Full Text]
  34. Batistatou A, Zolota V, Tzoracoleftherakis E, Scopa CD. Papillary serous adenocarcinoma of the endocervix: a rare neoplasm. Immunohistochemical profile. Int J Gynecol Cancer, 10: 336-9, 2000.[CrossRef][Medline]
  35. Re A, Taylor TH, DiSaia PJ, Anton-Culver A. Risk for breast and colorectal cancers subsequent to cancer of the endometrium in a population-based case series. Gynecol Oncol, 66: 255-7, 1997.[CrossRef][Medline]
  36. Fuqua SAW, Wiltschke C, Zhang QX, et al A hypersensitive estrogen receptor-a mutation in premalignant breast lesions. Cancer Res, 60: 4026-9, 2000.[Abstract/Free Full Text]
  37. Tan-Chiu E, Wang J, Costantino JP, et al Effects of tamoxifen on benign breast diseases in women at high risk for breast cancer. J Natl Cancer Inst (Bethesda), 95: 302-7, 2003.[Abstract/Free Full Text]
  38. Wang Y, Pelisson I, Melana SM, Holland JF, Pogo BG. Detection of MMTV-like LTR and LTR-env gene sequences in human breast cancer. Int J Oncol, 18: 1041-4, 2001.[Medline]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
A. Bindra, S. Muradrasoli, R. Kisekka, H. Nordgren, F. Warnberg, and J. Blomberg
Search for DNA of exogenous mouse mammary tumor virus-related virus in human breast cancer samples
J. Gen. Virol., June 1, 2007; 88(6): 1806 - 1809.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
J S Lawson, D D Tran, E Carpenter, C E Ford, W D Rawlinson, N J Whitaker, and W Delprado
Presence of mouse mammary tumour-like virus gene sequences may be associated with morphology of specific human breast cancer
J. Clin. Pathol., December 1, 2006; 59(12): 1287 - 1292.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Mant, J. Cason, B. G.T. Pogo, and J. F. Holland
Mouse Mammary Tumor Virus and Human Breast Cancer
Cancer Res., February 1, 2005; 65(3): 1112 - 1113.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. E. Ford, M. Faedo, and W. D. Rawlinson
Mouse Mammary Tumor Virus-like RNA Transcripts and DNA Are Found in Affected Cells of Human Breast Cancer
Clin. Cancer Res., November 1, 2004; 10(21): 7284 - 7289.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. F. Holland and B. G. T. Pogo
Mouse Mammary Tumor Virus-Like Viral Infection and Human Breast Cancer
Clin. Cancer Res., September 1, 2004; 10(17): 5647 - 5649.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ford, C. E.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ford, C. E.
Right arrow Articles by Rawlinson, W. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online