Cancer Research Meeting Calendar  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.
[Cancer Research 64, 4965-4972, July 15, 2004]
© 2004 American Association for Cancer Research


Immunology

Immunotherapeutic Potential of B7-DC (PD-L2) Cross-Linking Antibody In Conferring Antitumor Immunity

Suresh Radhakrishnan1, Loc Tan Nguyen1, Bogoljub Ciric1, Dallas Flies1, Virginia P. Van Keulen1, Koji Tamada1, Lieping Chen1, Moses Rodriguez1,2 and Larry R. Pease1

Departments of 1 Immunology and 2 Neurology, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, Minnesota


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A naturally occurring human antibody potentiates dendritic cell function on cross-linking B7-DC (PD-L2), supporting robust T-cell responses in vitro. Moreover, treatment of dendritic cells with B7-DC cross-linking antibody resulted in secretion of interleukin-12, suggesting a TH1 polarization of this response. Here we show an in vivo immunotherapeutic effect of this B7-DC cross-linking antibody using a poorly immunogenic B16 melanoma tumor model. Treatment of mice systemically with antibody at the time of tumor cell engraftment prevented tumor growth in a CD4 and CD8 T-cell-dependent manner. The protective effect of B7-DC cross-linking antibody treatment was independent of endogenous antibody responses. Tumor-specific CTL precursors could be isolated from lymph nodes draining the tumor site in animals treated with B7-DC cross-linking antibody, but not from those treated with isotype control antibodies. The elicited antitumor responses in vivo were specific and long-lasting. More strikingly, treatment of mice with B7-DC cross-linking antibody after the tumors were established in the lungs resulted in protection in a CD8-, perforin-, and granzyme B-dependent fashion. Depletion of natural killer cells did not block the effects of treatment with B7-DC cross-linking antibody. Together, these findings demonstrate that cross-linking B7-DC with the human IgM antibody sHIgM12 can induce a protective immune response against a weakly antigenic experimental tumor and therefore has potential as a novel immunotherapeutic approach for treating cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We recently discovered that the immune-regulatory properties of dendritic cells (DCs) can be potentiated in vitro by treatment with an IgM antibody that cross-links the B7 costimulatory family member B7-DC (PD-L2) on their cell surface. After antibody treatment in vitro, the DCs display increased (a) survival, (b) processing of exogenous protein into antigenic peptides for presentation in the class I pathway, (c) production of cytokines such as interleukin (IL)-12, and (d) ability to activate naïve T cells (1 , 2) . Delivery of small amounts of the IgM antibody i.v. to animals at the time of DC transplantation enhanced the ability of the distantly implanted cells to migrate to the draining lymph nodes and effectively activate naïve T cells in vitro after recovery from the nodes (1) . The observation that endogenous DCs, freshly isolated from mice, are bound by the B7-DC cross-linking antibody (2) and the accompanying secretion of IL-12 in vitro (1) raised the possibility that systemic treatment of animals with antibody might be used to potentiate the immune response to growing tumors.

Developing tumors express sets of antigens that are potential targets for the immune system. When tumors become established, these antigens have either been ignored or ineffective in generating an immune response that can protect the host from tumor development. Tumor resistance mechanisms include down-modulation of MHC class I (3) , loss of tumor-associated antigens (4) , and expression of immunosuppressive molecules such as transforming growth factor ß (5) . Tumors also inhibit T-cell response by inducing peripheral tolerance (6) or by inducing T regulatory cells (7) . Immunotherapy strategies seek to provide the necessary stimuli to overcome factors limiting the immunogenicity of tumor-associated antigens to promote effective antitumor immunity. Among strategies that have proven effective are protocols designed to raise antigen dose, recruit and mobilize antigen-presenting cells, and promote the activation and survival of effector T cells (8 , 9) .

Antigen-specific T-cell responses are initiated by DCs. DCs are capable of capturing antigens that are secreted or shed by tumor cells, resulting in presentation of peptides on both class I and class II MHC molecules. In response to maturation signals, DCs up-regulate their expression of costimulatory molecules and cytokines, which efficiently prime CD4 and CD8 T cells (10, 11, 12) . Techniques have been established for generating DCs ex vivo, resulting in the development of DC-based vaccines for tumors (13 , 14) . Because costimulatory signals expressed by antigen-presenting cells are critical in determining the outcome of T-cell-dependent immune responses, improved CTL responses have been achieved by introducing costimulatory molecules such as B7-1, B7-2, and B7-DC into tumors (15, 16, 17) and then using the engineered cells to induce effective immune responses.

B7-DC/PD-L2 belongs to the expanding family of B7 proteins. B7-DC, like other family members, contains immunoglobulin-like extracellular domains, a transmembrane domain, and a short cytoplasmic tail. PD-1 has been identified as a cognate receptor for B7-DC. PD-1 is expressed on activated T cells. Data exist to support both positive and negative modulation of T-cell responses after interaction between B7-DC and its receptors (18 , 19) . These seemingly contradictory findings might be explained by the possible existence of receptors other than PD-1 that can interact with B7-DC. The ability of B7-DC to bind to PD-1-deficient T cells supports this possibility. Moreover, mutagenesis and modeling studies indicate that the binding site for B7-DC is distinct from that of B7-H1, another ligand for PD-1 (20 , 21) . Potential differences in the interaction of B7-DC and B7-H1 with different receptors may influence whether positive or negative immune modulation is elicited.

In this report, we document the potentiation of the immune response against B16 melanoma after systemic treatment of mice with small amounts (30 µg) of B7-DC cross-linking antibody in both prophylactic and therapeutic models. A number of different effector mechanisms involving cytotoxic cells and protective lymphokines have been defined in other immunotherapeutic schemes for treatment of B16 melanoma (22, 23, 24) . Here, we provide evidence that the enhanced immunity induced with B7-DC cross-linking antibody is mediated by T cells and dependent on key components of their cytotoxic granules.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice.
Wild-type C57BL/6J, B6.129S2-Cd4tm1Mak/J (CD4–/–), B6.129S2-Cd8tm1Mak/J (CD8–/–), B6.129S7-Rag1tm1Mom/J (Rag1–/–), B6.129S2-Gzmbtm1Ley/J (granzyme B–/–) strains of mice, all on the C57BL genetic background, were purchased from The Jackson Laboratory (Bar Harbor, ME). B6.129P2-B2mtm1Unc/J 2-microglobulin–/–) mice were bred in the immunogenetic mouse colony (C. David) at Mayo Clinic. B-cell-deficient µMT mice (25) were obtained from M. Cascalho (Mayo Clinic). C57BL/6-Prf1tm1Sdz/J (perforin–/–) mice were originally obtained from The Jackson Laboratory and subsequently bred in the mouse colony of M. Rodriguez (Mayo Clinic).

Reagents.
The B7-DC cross-linking antibody sHIgM12 was purified from serum from a patient with Waldenstrom’s macroglobulinemia as described previously (2) . A preparation of polyclonal human IgM antibody (2) and an IgM antibody (sHIgM39) purified from the serum of a patient with chronic lymphoproliferative disorder were used as isotype control antibodies. Bouin’s fixative was obtained from Sigma-Aldrich (St. Louis, MO). B16, B16-F10, and EL-4 lines of tumors were maintained in RPMI 1640 (Cambrex Bioscience, Walkersville, MD) containing 10% calf serum (GIBCO Invitrogen, Grand Island, NY). Phycoerythrin-coupled antibody to pan-natural killer (NK) cell marker DX-5 was obtained from PharMingen (San Diego, CA). NK1.1 (PK136) was obtained from L. Chen (Mayo Clinic). Lipopolysaccharide and polyinosinic polycytidylic acid (poly I:C) were purchased from Calbiochem. CpG (TCCATGACGTTCCTGACGTT) was synthesized in the Mayo Clinic molecular biology core facility.

Prophylactic Regimen.
In this protocol, mice received injection with 2 x 104 B16 cells on the right flank in a 100-µl volume. Animals received injection with 10 µg of sHIgM12 or control antibody in 100 µl of PBS the day before, the day of, and the day after tumor challenge. Mice were monitored for the development of tumor and euthanized when tumor size reached 225 mm2. The size of the tumors was determined in two dimensions using calipers (Dyer, Lancaster, PA). The mice that failed to develop tumors for 30 days were rechallenged with 2 x 104 B16 cells on the left flank. Rechallenged mice were monitored for another 30 days. Separate sets of mice that resisted B16 melanoma grafts were challenged with 2 x 106 EL-4 cells on the opposite flank and monitored for tumor growth. Naïve mice injected with 2 x 106 EL-4 cells served as controls for this test of specificity of tumor resistance.

Therapeutic Regimen.
In this protocol, mice received injection with 5 x 105 B16-F10 cells i.v. Mice were treated with 10 µg of sHIgM12 or control antibody on days 3, 4, and 5. Sentinel mice received injection with the tumor cells and received no further treatments. Tumor load in sentinel animals was monitored by examining the lungs of individual animals on a periodic basis to ascertain when a significant tumor load was present in the treatment groups. When a sentinel was detected that had developed 50 or more tumor nodules in its lungs, the animals in the experiment treatment groups were euthanized, and tumor nodules in their lungs were counted. For depletion experiments, 200 µg of NK1.1 monoclonal antibody was injected i.p. 72 and 48 h before tumor injection and every 3–4 days thereafter for the duration of the experiment. Depletion of the appropriate cell subset was confirmed by flow cytometry using anti-NK1.1 and anti-DX-5 antibody. In our hands, the sentinel mice developed nodules in the lungs by days 17–21. Mice from all of the experimental groups were then euthanized, and the lungs were fixed with Bouin’s fixative. The number of nodules was determined using a dissection microscope.

Flow Cytometry.
Sera were collected from mice that had been engrafted with B16 melanoma on the flank and treated using the prophylactic regimen with either control polyclonal IgM antibody or sHIgM12 antibody. Dilutions of the sera were assayed for the presence of antitumor antibodies using standard flow cytometry (1) to assess binding to B16 melanoma cells. DCs derived from bone marrow precursors in vitro or isolated directly from the spleens of animals as described previously (2) were analyzed by multicolor flow cytometry for incorporation of FITC and staining with anti-B7.1-PE or B7.2-PE and anti-CD11c-APC.

Cytotoxicity Assay.
Briefly, 5 x 105 B16 melanoma cells were injected in the right flank of C57BL/6 mice. Mice received i.v. injection with 10 µg of either control antibody or B7-DC cross-linking antibody on the day before, the day of, and the day after tumor injection. Seven days later, cells from the draining lymph nodes from 5 mice/group were harvested, pooled, and further stimulated by mitomycin C (Calbiochem)-treated B16 melanoma cells (2 x 106 cells/ml) for an additional 4 days. The effector cells were harvested and titrated in triplicate against 51Cr (Amersham)-labeled B16 or EL-4 cells in a standard 4-h cytotoxicity assay.

Statistical Analysis.
Statistical analysis was performed on normally distributed data using ANOVA for multiple comparisons or Student’s t test for comparisons of two groups. For data that were not distributed normally, the Whitney rank-sum test was used for analysis of two treatment groups and a rank ANOVA was used for comparison of more than two treatment groups.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Systemic Treatment with sHIgM12 B7-DC Cross-Linking Antibody Induces Resistance to B16 Melanoma Transplanted s.c. in the Flank of B6 Mice.
B16 melanoma is an aggressive tumor derived from C57BL mice that kills immunocompetent animals receiving a s.c. inoculum of as few as 2 x 104 cells. In this model, palpable tumors develop between 10 and 12 days after tumor transplantation. Typically, tumors progress to surface areas in excess of 225 mm2 by day 17, at which time animals are euthanized according to Institutional Animal Care and Use Committee protocol. Mice received treatments of isotype control antibody, PBS, or sHIgM12 B7-DC cross-linking antibody injected i.v. at a distant site on days –1, 0, and +1 relative to tumor transplant. Whereas only 1 of 13 mice (7%) treated with an isotype control polyclonal IgM antibody and 0 of 13 PBS-treated animals were tumor free at day 17, 11 of 16 (69%) mice receiving sHIgM12 antibody remained tumor free (P < 0.001, Table 1Citation ). For mice that did develop palpable tumors, sHIgM12 antibody treatment significantly inhibited the growth of the tumor as compared with tumors growing in mice treated with PBS or polyclonal human IgM antibody (P < 0.001; Table 1Citation ). The delay in growth was transient because tumors that did develop in sHIgM12-treated mice eventually progressed to 225 cm2 in size. In a separate experiment, mice treated with sHIgM12 antibody on days 9, 8, and 7 before challenge with B16 melanoma displayed no treatment effects on tumor growth; 100% of the animals treated with B7-DC cross-linking antibody (n = 8) or isotype control antibody (n = 8) developed tumors with the same kinetics (data not shown). This finding indicates that the timing of treatment relative to tumor engraftment is an important factor in determining treatment outcome.


View this table:
[in this window]
[in a new window]

 
Table 1 B7-DC cross-linking antibody treatment protects mice from s.c. challenge with B16 melanoma

Mice received 10 µg of sHIgM12 antibody, polyclonal human IgM, or PBS i.v. on days –1, 0, and +1. Categorical data were analyzed for all three groups together using {chi}2 distribution (P < 0.001). Fischer’s exact test was used to compare individual groups with the reference animals. The width and length of s.c. tumors were measured on day 17. The product of width x length was used as an estimate of tumor size. Statistical comparisons were made using ANOVA.

 
Induced Resistance to B16 Melanoma by Systemic sHIgM12 Antibody Treatment Is Immune Mediated.
We first considered the possibility that the sHIgM12 antibody acts directly on the B16 tumor cells. Some murine tumor cell lines, particularly those of hematopoietic origin, have been reported to express B7-DC mRNA message (26) . Using flow cytometry, we evaluated whether the antibody sHIgM12 binds directly to tumor cells and found no binding, suggesting that the antibody may be acting indirectly on the tumor cells by binding to cells derived from the host.

Our earlier studies demonstrated that sHIgM12 antibody binds to DCs derived from bone marrow precursors in vitro. This binding activity suggests that the induced resistance to the lethal tumor challenge may be mediated by antibody interactions with endogenous DCs. Modulation of DC function could promote changes in the immune response and be the underlying mechanism determining antibody-induced tumor resistance. We explored this possibility using two approaches. First, we evaluated whether sHIgM12 antibody administered systemically to mice modulated the phenotype of endogenous DCs. Second, we evaluated whether in vivo administration of the antibody induced tumor resistance by potentiating an antitumor response.

Using DCs generated in vitro from bone marrow precursors, we had previously shown that treatment with sHIgM12 B7-DC cross-linking antibody potentiates the ability of these cells to activate naïve antigen-specific T cells but does not induce traditional maturation markers in the DC. As DCs mature, they lose the ability to acquire antigen from their surroundings and increase their expression of the costimulatory molecules B7.1 (CD80) and B7.2 (CD86) at the cell surface (27) . We have demonstrated previously that B7.1 and B7.2 expression levels do not substantially increase after treatment of bone marrow-derived myeloid DCs with sHIgM12 antibody in vitro (2) . To evaluate functional changes associated with activation after sHIgM12 antibody treatment, we assessed changes in pinocytotic activity by monitoring the ability of DCs to take up FITC-tagged bovine serum albumin (BSA) in vitro. As shown in Table 2Citation , DCs treated with the toll-like receptor 4 (TLR-4) agonist lipopolysaccharide accumulated lower amounts of FITC-BSA compared with the levels acquired by DCs treated with control polyclonal IgM antibody. Because engagement of TLR-4 induces the maturation of DCs, this is an expected result. In contrast, DCs treated with the B7-DC cross-linking antibody sHIgM12 accumulated significantly more FITC-BSA than did DCs treated with isotype control antibody. This finding provides additional evidence that activation of DCs with B7-DC cross-linking antibody does not induce a traditionally defined maturation response but rather induces a distinctive activation phenotype.


View this table:
[in this window]
[in a new window]

 
Table 2 Antigen acquisition and expression of costimulatory molecules after DCa activation

 
The ability of endogenous DCs to pinocytose was evaluated to determine whether systemic treatment with B7-DC cross-linking antibody targets DCs in vivo, as well. C57BL/6 mice were treated i.v. on two successive days with either isotype control IgM antibody sHIgM39, the B7-DC cross-linking antibody sHIgM12, or a combination of the TLR-3 and TLR-9 agonists poly I:C and CpG oligonucleotide. Lipopolysaccharide was not used in the in vivo analysis to avoid known associated toxicities. At the time of the second treatment, the animals received 100 µg of FITC-OVA i.p. Twenty h later, splenic DCs were isolated and analyzed by flow cytometry for accumulation of FITC-OVA and expression levels of the costimulatory molecules B7.1 and B7.2. DCs were identified by their expression of the surface marker CD11c. As shown in Table 2Citation , DCs isolated from animals treated with the B7-DC cross-linking antibody sHIgM12 acquired significantly higher levels of FITC-OVA relative to DCs from animals treated with the isotype control antibody. This result mirrors our analysis of pinocytotic activity of bone marrow-derived DCs in vitro. Furthermore, DCs isolated from animals treated with the TLR agonists accumulated significantly lower levels of FITC-OVA, a finding consistent with the previously described decreases in antigen acquisition by matured DCs. The maturation status of these endogenous DCs in this analysis is illustrated by the levels of expression of the B7.1 and B7.2 costimulatory molecules in the different treatment groups. There was no significant difference in expression levels of costimulatory molecules on DCs isolated from animals treated with B7-DC cross-linking antibody or isotype control antibodies, demonstrating that treatment with sHIgM12 antibody does not induce maturation of DCs in vivo. This finding mirrors those we reported previously for bone marrow-derived DCs in vitro (2) . DCs from mice treated with the TLR agonists, on the other hand, expressed significantly higher levels of both costimulatory molecules, demonstrating that DC maturation is induced by engaging TLR-3 and TLR-9.

To determine whether treatment of mice with sHIgM12 B7-DC cross-linking antibody induces tumor resistance by potentiating an immune response, we evaluated the ability of antibody to induce tumor resistance in immunodeficient B6-RAG1–/– mice lacking B and T cells. Treatment of these animals with sHIgM12 antibody using the prophylactic treatment protocol had no effect on B16 melanoma appearance or growth, demonstrating that an intact immune system is essential for the induction of tumor resistance (Table 3)Citation . The failure of sHIgM12 antibody treatment to protect Rag-deficient mice also provides additional evidence that the antibody does not act directly on the tumor. The importance of the CD8 T cells in the host immune response to the tumors was established using ß2-microglobulin–/– mice. Although these knockout mice have an intact CD4 T-cell repertoire, the deficiency in CD8 T cells abolished the protective effect of sHIgM12 antibody treatment (Table 3)Citation . Likewise, the absence of a helper response in CD4 knockout mice abrogated the protective effect of sHIgM12 because all of these mice developed palpable tumors akin to mice receiving control treatment (Table 3)Citation .


View this table:
[in this window]
[in a new window]

 
Table 3 B7-DC cross-linking antibody is not protective in immunocompromised host

Mice received 10 µg of sHIgM12 antibody, polyclonal human IgM, or PBS i.v. on days –1, 0, and +1. Categorical data were analyzed for all three groups together using {chi}2 distribution. Fischer’s exact test was used to compare individual groups with the reference animals. The width and length of s.c. tumors were measured on day 11. The product of width x length was used as an estimate of tumor size. Statistical comparisons were made using ANOVA.

 
The B-cell immune response, as measured by serum levels of antitumor antibodies, was indistinguishable between C57BL/6 mice receiving sHIgM12 and those receiving polyclonal IgM treatment. Serum was collected from mice on day 17, when animals treated with isotype control antibodies had developed tumors approaching 225 mm2 in size. Animals treated with B7-DC cross-linking antibodies were tumor free. Serial dilutions of the sera were assessed for tumor-binding antibodies by flow cytometry. As shown in Fig. 1Citation , levels of tumor-reactive antibodies were indistinguishable in animals receiving tumor protective treatment with B7-DC cross-linking antibody or nonprotective treatment with polyclonal human IgM antibody. To further evaluate whether B-cell responses are important contributors to the antitumor response induced by B7-DC cross-linking, B-cell-deficient µMT animals were treated with B7-DC cross-linking antibodies and challenged with B16 melanoma using the prophylactic treatment model. Wild-type C57BL/6 mice treated with isotype control human IgM antibody developed rapidly growing tumors that reached 225 mm2 by day 17 after tumor engraftment (n = 4). In contrast, C57BL/6 (n = 5) and µMT (n = 5) mice treated with sHIgM12 B7-DC cross-linking antibody were strongly protected; one of five of the C57BL/6 mice eventually developed a tumor, whereas no tumors developed in the B-cell-deficient µMT animals. B16 melanoma grew rapidly in the µMT mouse line after treatment with isotype control antibody, demonstrating histocompatibility of the tumor with the µMT subline. These results demonstrate that an antitumor antibody response is not a critical factor distinguishing susceptible from resistant mice in this tumor model. Furthermore, the finding that B-cell-deficient mice are protected from B16 melanoma after treatment with the human antibody sHIgM12 excludes the possibility that an antihuman IgM antibody response by antibody-treated animals is an integral component of the treatment effect elicited with B7-DC cross-linking antibody.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Antibody responses to B16 melanoma. On days –1, 0, and +1 relative to B16 melanoma engraftment, mice received either 10 µg of polyclonal human IgM control antibody ({circ}) or sHIgM12 B7-DC cross-linking antibody ({bullet}) i.v. Serum was collected on day 17 from both groups. Antibodies in the sera were evaluated by serial dilution and flow cytometry for their ability to bind to B16 melanoma cells. Data are represented as mean fluorescent intensity (n = 5/group).

 
The hallmark of an effective adaptive immune response is a vigorous memory response on secondary challenge. To study whether a memory response against B16 tumor antigens was established after treatment with sHIgM12 antibody, we rechallenged the surviving mice with a lethal dose of B16 melanoma cells in the opposite flank. As shown in Table 4Citation , mice that had survived for at least 30 days after initial tumor challenge displayed significant resistance to a secondary challenge with tumor cells (P < 0.001). Because none of the surviving mice received additional treatments with sHIgM12, the resistance to secondary challenge indicates that an effective antitumor immune response was established in mice treated with sHIgM12 after the initial challenge. In contrast, animals that resisted B16 melanoma after sHIgM12 antibody treatment showed no increased resistance to the unrelated tumor, EL-4.


View this table:
[in this window]
[in a new window]

 
Table 4 B7-DC cross-linking antibody induces a recall response

C57BL/6J survivors from the sHIgM12 treatment group, described in Table 1Citation , were rechallenged with a lethal dose of tumor cells in the opposite flank without administration of additional antibody treatment. Naïve mice were treated in the same manner as indicated in Table 1Citation as a control for tumorigenicity of the cell line. Categorical data were analyzed for all three groups together using {chi} 2 distribution (P < 0.021). Fischer’s exact test was used to compare individual groups with the reference animals. The width and length of s.c. tumors were measured on day 17. The product of width x length was used as an estimate of tumor size. Statistical comparisons were made using ANOVA.

 
To determine whether treatment with B7-DC cross-linking antibody potentiates tumor-specific CTLs, the draining lymph nodes of mice bearing day 7 tumors were assayed for tumor-specific CTL precursors. The animals were treated with sHIgM12 antibody or control antibody as described before (one day before, the same day, and 1 day after tumor challenge). Harvested lymph node cells were cultured in the presence of mitomycin-treated B16 melanoma cells for an additional 4 days and then assessed for tumor-specific cytotoxic activity in a standard 51Cr release assay. Cytotoxic activity against B16 target cells was only observed in cultures of cells derived from animals treated with B7-DC cross-linking antibody (Fig. 2)Citation . Killing was specific for the B16 melanoma targets because EL-4 tumor cells were not killed. Lymph node cells from B16-challenged mice treated with control antibody displayed no activity, a finding consistent with the known weak innate antigenicity of the B16 melanoma tumor line.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Induction of tumor-specific CTLs in B16 tumor-bearing mice treated with B7-DC cross-linking antibody. Lymph node cells from five mice from each treatment group were pooled and stimulated in vitro with mitomycin-treated B16 tumor cells for 4 days. Subsequently, the effector cells from the treatment groups were harvested and assayed in the standard CTL assay using 51Cr-labeled B16 melanoma or EL-4 cells. The supernatant was harvested after 4 h and evaluated for released 51Cr. The open circles represent triplicate measurements of the responses of effector cells from control antibody-treated mice against B16 melanoma cells, whereas the filled circles represent the response of effector cells from B7-DC cross-linking antibody-treated mice. The open triangles and open squares represent the responses of effector cells from control antibody-treated mice or B7-DC cross-linking antibody-treated mice against EL-4 target cells, respectively.

 
Together, these findings demonstrate that systemic treatment with the B7-DC cross-linking antibody sHIgM12 potentiates a cellular immune response against B16 melanoma causing acute tumor rejection and long-term immunity.

Systemic Treatment of Mice with sHIgM12 B7-DC Cross-Linking Antibody Protects Mice in a B16 Lung Metastasis Model.
The B16-F10 subline of B16 melanoma has been selected for its efficient ability to metastasize to the lungs. This particular tumor line is highly virulent and weakly antigenic; moreover, it is characterized by depressed MHC class I gene expression. A useful modification of the metastasis model has been to introduce the B16-F10 melanoma i.v. as a cell suspension. This results in 50–200 tumor nodules in the lungs of all challenged animals within 3–4 weeks. To evaluate the effectiveness of sHIgM12 antibody treatment on the induction of tumor resistance in this model, animals were seeded with lung metastases 3 days before antibody treatment. Animals received 10 µg of sHIgM12 B7-DC cross-linking antibody i.v. on days 3, 4, and 5 after tumor challenge. Untreated sentinel mice that received identical tumor challenges were monitored for tumor burden. When tumor burdens exceeding 50 nodules were detected in the sentinel mice, the experiments were terminated, and the lungs of animals from all treatment groups were analyzed for the presence of tumor.

As shown in Fig. 3ACitation , the lungs of animals receiving sHIgM12 antibody treatment contained significantly fewer tumor nodules than mice receiving control polyclonal IgM antibody. In the illustrated experiment, all eight animals treated with sHIgM12 antibody developed fewer tumor nodules than the least number observed in the eight animals treated with control isotype-matched antibody (Fig. 3BCitation ; P < 0.001). In the experiment shown, three of the eight protected animals developed no tumor. Our overall experience is that approximately half the animals (14 of 29) treated with B7-DC cross-linking antibodies remained free of tumor. These findings demonstrate that systemic administration of B7-DC cross-linking antibody confers resistance to a highly lethal, weakly immunogenic tumor, even after the tumor is allowed to establish itself for 3 days before initiation of treatment.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Treatment of mice with B7-DC cross-linking antibody cures established tumor in mice. Wild-type C57BL/6J strains of mice received i.v. injection with 5 x 105 B16-F10 melanoma cells. B7-DC cross-linking antibody or the control antibody treatments were started 3 days after the injection of tumor as described in "Materials and Methods." Untreated control animals challenged only with tumor cells served as sentinels. When >50 tumor nodules were detected in a sentinel (day 21), the experiment was terminated. A (i) shows lungs from control antibody-treated mice. A (ii) shows the lungs from B7-DC cross-linking antibody-treated mice. B shows the number of nodules in the lungs from both treatment groups. Significantly fewer nodules were present in lungs of mice treated with B7-DC cross-linking antibody relative to animals treated with isotype control polyclonal human IgM (P < 0.001; n = 8/treatment group).

 
Induced Resistance to B16-F10 Melanoma Is Mediated by CD8+ T Cells and Is Perforin and Granzyme B Dependent.
Because the B16-F10 tumor expresses reduced amounts of MHC class I molecules on its cell surface, we considered the possibility that induced resistance by treatment with B7-DC cross-linking antibody might be mediated by NK cells. To evaluate this possibility, animals were treated with anti-NK1.1 antibody before tumor challenge. The efficiency of the NK cell depletion protocol was monitored by flow cytometry using NK1.1- and DX-5-specific antibodies to visualize NK cells. Splenic NK cells were reduced by >90% in animals treated with NK1.1-specific antiserum. As shown in Fig. 4Citation , direct comparison of sHIgM12-treated, NK cell-depleted animals with sHIgM12-treated mice suggests a minor but statistically significant (P < 0.001) contribution of NK cells to the antitumor response induced by systemic sHIgM12 treatment. However, NK cell-depleted mice were still responsive to the immunotherapeutic effects of B7-DC cross-linking antibody administered 3 days after i.v. challenge with B16-F10 melanoma (P = 0.002). In contrast, CD8 knockout mice were not responsive to treatment with B7-DC cross-linking antibody, indicating that CD8+ T cells are critical mediators of antitumor immunity in this model. NK-deficient or CD8-deficient mice that did not receive B7-DC cross-linking antibodies were no more susceptible or resistant to development of lung tumors than were untreated animals, findings consistent with the characteristically weak immunogenicity of the B16-F10 tumor line.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. B7-DC cross-linking antibody-mediated protection is CD8 T-cell dependent. Wild-type or CD8-deficient mice received injection with B16-F10 cells followed by antibody treatment with either isotype control antibody (polyclonal human IgM antibody, pHIgM) or B7-DC cross-linking antibody (sHIgM12). In parallel, two separate groups of mice were treated with NK cell-depleting antibody before injection of B16-F10 cells, followed by B7-DC cross-linking antibody treatment or control antibody treatment. Sentinel animals were used as described in the Fig. 1Citation legend. All mice were sacrificed at day 17. The lungs were harvested, and the number of nodules was counted. Data represent the number of nodules from five to seven mice in each group. Data were analyzed using rank-sum methods. Pairwise comparisons are shown. Comparison of animals receiving sHIgM12 antibody with those receiving sHIgM12 antibody and NK1.1 NK-depleting antibody revealed a significant difference (P < 0.001). A comparison of the three treatment groups receiving control antibodies (with or without other treatments) was also performed. No significant difference was evident (P = 0.116).

 
The ability of cytotoxic lymphocytes to kill tumor cells is known to be mediated, in part, by perforin- and granzyme-dependent pathways (28 , 29) , although in some circumstances, both mediators of cytotoxicity are not required (30) . We evaluated whether the protective effects induced by systemic antibody treatment are perforin mediated. Perforin knockout mice were treated with sHIgM12 antibody on days 3, 4, and 5 after i.v. tumor challenge, as described before, and their lungs were analyzed for growth of tumor nodules. As shown in Fig. 5Citation , sHIgM12 immunotherapy was ineffective in perforin-deficient animals but highly effective in wild-type B6 mice. In an independent experiment, B7-DC cross-linking with sHIgM12 antibody also was not protective in granzyme B-deficient mice. Using the therapeutic treatment model, an average of 98.2 ± 4.9 (n = 5) tumor nodules were found in the lungs of granzyme B-deficient mice treated with control polyclonal human IgM antibody, as compared with 99.2 ± 15.0 (n = 5) tumor nodules in the lungs of granzyme B-deficient mice treated with sHIgM12 B7-DC cross-linking antibody (data not shown). Because we have previously demonstrated that NK cells are not the primary mediators of the antitumor resistance induced by treatment with B7-DC cross-linking antibody, and because we have shown that the protective response is dependent on CD8 T cells, these findings are most consistent with the view that treatment of tumor-bearing mice with B7-DC cross-linking antibody potentiates cytolytic CD8+ T cells in vivo and that cytotoxicity is mediated by both perforin and granzyme B.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. The protective effect of B7-DC cross-linking antibody is perforin dependent. Wild-type mice or perforin-deficient mice received injection with B16-F10 cells followed by antibody treatment. Mice were sacrificed, and lungs were harvested on day 17, when sentinel animals contained >50 tumor nodules. Data represent the mean number of nodules in the lungs of four mice in the wild-type (WT) or perforin-dependent (PFP-1–/–) control antibody-treated (polyclonal human IgM antibody, pHIgM) or B7-DC cross-linking antibody-treated (sHIgM12) groups. n = 4 in all groups except for the wild-type, sHIgM12-treated group, where n = 6. Statistical evaluations were performed using rank-sum comparisons.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have devised a novel immunotherapeutic strategy for the treatment of cancer. Systemic administration of a human B7-DC cross-linking antibody induced protective cellular immune responses against the weakly antigenic B16 and B16-F10 melanoma lines using both prophylactic and therapeutic treatment schemes. Animals received i.v. treatments with the human B7-DC cross-linking antibody sHIgM12, without further manipulation of tumor or administration of antigen. This antibody binds and cross-links B7-DC expressed on mouse DCs and induces prolonged DC survival, up-regulation of cytokines, enhanced antigen processing, and potentiation of the ability of bone marrow-derived DCs to activate naïve T cells in vitro (1 , 2) . Here we show that systemic administration of the B7-DC cross-linking antibody enhances acquisition of the experimental antigen FITC-OVA by endogenous DCs and does not induce increased expression of the maturation markers B7.1 and B7.2. Thus, the activation phenotype induced by the sHIgM12 B7-DC cross-linking antibody is distinct from traditionally defined maturation responses induced by TLR and tumor necrosis factor receptor agonists. Mature DCs characteristically have down-regulated their ability to acquire soluble antigen and up-regulated their cell surface expression of B7.1 and B7.2.

All of the wild-type mice in our study treated with B7-DC cross-linking antibody showed protective antitumor treatment effects in comparison with animals receiving isotype-matched control human IgM antibodies. Approximately 70% of the animals treated with B7-DC cross-linking antibody and challenged with B16 melanoma remained tumor free; the remaining 30% grew tumor more slowly. Animals that resisted the growth of the initial B16 melanoma challenge resisted a secondary challenge with B16 melanoma, indicating a classical memory response. Resistance was antigen specific because an unrelated tumor, EL-4, grew unabatedly in mice that had previously resisted B16 melanoma as a result of sHIgM12 treatment. We interpret these findings as evidence that systemic treatment of animals with B7-DC cross-linking antibody potentiates a long-lasting, protective, adaptive, cellular immune response against weak tumor antigens expressed by B16 melanoma.

The stability of the peptide-MHC complex and T-cell receptor interaction has been directly correlated to protection against tumors (31) . We demonstrated previously that the amount of peptide-MHC complex generated on the surface of DCs in vitro was significantly increased on cross-linking B7-DC (1) . It is possible that antibody treatment enhances tumor rejection by augmenting antigen presentation, resulting in better priming and effector responses. Our finding that treatment with B7-DC cross-linking antibody enhances pinocytotic activity by DCs in vitro and in vivo is consistent with this view. A second, mutually nonexclusive mechanism by which the tumors might be rejected could involve IL-12 and IFN-{gamma} secretion leading to a pro-inflammatory tumor microenvironment. The enhanced production of IL-12 by DCs treated with B7-DC cross-linking antibody is consistent with this view (1) . Indeed, previous studies have shown that CD4 T cells present in the tumor microenvironment are mobilized by release of IL-12 to kill tumors, and this activity correlated with the serum levels of human IFN-{gamma} (32) . We find that CD4+ cells are required for the induction of antitumor resistance with sHIgM12 antibody. Because CD4+ cells were not protective in the absence of CD8+ cells, our findings are most consistent with a helper function of CD4+ T cells in support of a CD8+ CTL response. However, whether CD4+ T cells function as effector cells in this tumor model after treatment with sHIgM12 antibody is not known.

NK cells are known to play an important role in the rejection of tumors under some circumstances, and IL-12, perforin, and IFN-{gamma} contribute to the NK-mediated antitumor response (33 , 34) . Furthermore, NK cell-mediated rejection of tumor can lead to subsequent priming and onset of acquired immunity (34) . A protective role for NK cells in resistance to the development of B16-F10 tumor nodules would be consistent with the reduced levels of class I expression by these tumor cells (35 , 36) . In our study, depletion of NK cells with NK-reactive antibody had little effect on the ability of B7-DC cross-linking antibody to induce resistance to tumor. Expression of both perforin and granzyme B was shown to be critical for the induction of antitumor resistance with sHIgM12 B7-DC cross-linking antibody. Our interpretation is that despite the low levels of class I antigen-presenting molecules expressed by B16-F10 cells, an antibody-induced cytolytic T-cell response is protecting the animals.

Our current view, based on these findings, is that B7-DC cross-linking antibody binds to resident DCs, potentiating their ability to acquire tumor antigens in situ and process the antigens for presentation to T cells and enhancing their ability to activate naïve T cells, promoting a protective cellular cytolytic response. We have previously documented the ability of systemically administered antibody to mobilize and potentiate DCs introduced in a distal site and to augment their ability to reach draining lymph nodes. Here we have extended these results, demonstrating that systemic antibody treatment increases antigen acquisition by endogenous DCs of antigen administered i.p. These findings suggest the possibility that DCs at the site of tumor growth might also be mobilized by this treatment strategy.

B7-DC is known to interact with the T-cell ligand PD-1, inducing, under some circumstances, negative signals that dampen T-cell activation (19) . The extent to which treatment with small amounts of sHIgM12 antibody interferes with this regulatory interaction is not known, but any interference could lead to further increases in immune potentiation.

The sHIgM12 antibody may have important therapeutic potential for the treatment of human disease. The nature of the epitopes recognized by the IgM antibodies we have used to manipulate cell functions in vivo is not known but in several instances seems to be conserved across species. IgM antibodies we described that bind to rat oligodendrocytes also bind to human oligodendrocytes and mouse myelin tracts (37) . The ability of antibody sHIgM12 to bind to both mouse and human DCs (2) generalizes this concept. Because much is known about the biology of DCs, it will be possible to compare how cross-linking B7-DC expressed by human and mouse DCs will influence immune functions. These studies are ongoing, but it is already evident that the sHIgM12 antibody induces changes in human myeloid DCs that mirror some of the important changes we have described in mice (1 , 2) . It will be of great interest to determine whether the human antibody sHIgM12 can be used to manipulate human DCs in vivo and to modify the immune response in beneficial ways, just as we have done in the mouse. The induction of a protective immune response against an aggressive, weakly antigenic tumor, as described in this report, is one example of how this antibody might be used.


    FOOTNOTES
 
Grant support: A grant from The Ralph C. Wilson, Sr., and Ralph C. Wilson, Jr., Medical Research Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Larry R. Pease, Department of Immunology, Mayo Clinic College of Medicine, Mayo Clinic, 200 First Street SW, Rochester, MN 55905. Phone: (507) 284-8177; Fax: (507) 266-0981; E-mail: pease.larry{at}mayo.edu

Received 9/25/03. Revised 3/24/04. Accepted 5/ 7/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nguyen LT, Radhakrishnan S, Ciric B, et al Cross-linking the B7 family molecule B7-DC directly activates immune functions of dendritic cells. J Exp Med, 196: 1393-8, 2002.[Abstract/Free Full Text]
  2. Radhakrishnan S, Nguyen LT, Ciric B, et al Naturally occurring human IgM antibody that binds B7-DC and potentiates T cell stimulation by dendritic cells. J Immunol, 170: 1830-8, 2003.[Abstract/Free Full Text]
  3. Koopman LM, Corver WE, van der Slik AR, Giphart MJ, Fleuren GJ. Multiple genetic alterations cause frequent and heterogeneous human histocompatibility leukocyte antigen class I loss in cervical cancer. J Exp Med, 191: 961-76, 2000.[Abstract/Free Full Text]
  4. Uyttenhove C, Maryanski J, Boon T. Escape of mouse mastocytoma P815 after nearly complete rejection is due to antigen-loss variants rather than immunosuppression. J Exp Med, 157: 1040-52, 1983.[Abstract/Free Full Text]
  5. Van Belle P, Rodeck U, Nuamah I, Halpern AC, Elder DE. Melanoma-associated expression of transforming growth factor-beta isoforms. Am J Pathol, 148: 1887-94, 1996.[Abstract]
  6. Bogen B. Peripheral T cell tolerance as a tumor escape mechanism: deletion of CD4+ T cells specific for a monoclonal immunoglobulin idiotype secreted by a plasmacytoma. Eur J Immunol, 26: 2671-9, 1996.[Medline]
  7. Sutmuller RP, van Duivenvoorde LM, van Elsas A, et al Synergism of cytotoxic T lymphocyte-associated antigen 4 blockade and depletion of CD25(+) regulatory T cells in antitumor therapy reveals alternative pathways for suppression of autoreactive cytotoxic T lymphocyte responses. J Exp Med, 194: 823-32, 2001.[Abstract/Free Full Text]
  8. Smyth MJ, Godfrey DI, Trapani JA. A fresh look at tumor immunosurveillance and immunotherapy. Nat Immunol, 2: 293-9, 2001.[CrossRef][Medline]
  9. Pardoll DM. Spinning molecular immunology into successful immunotherapy. Nat Rev Immunol, 2: 227-38, 2002.[CrossRef][Medline]
  10. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med, 179: 1109-18, 1994.[Abstract/Free Full Text]
  11. Caux C, Massacrier C, Vanbervliet B, et al Activation of human dendritic cells through CD40 cross-linking. J Exp Med, 180: 1263-72, 1994.[Abstract/Free Full Text]
  12. Cella M, Scheidegger D, Palmer-Lehmann K, et al Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med, 184: 747-52, 1996.[Abstract/Free Full Text]
  13. Inaba K, Inaba M, Romani N, et al Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med, 176: 1693-702, 1992.[Abstract/Free Full Text]
  14. Thurner B, Haendle I, Roder C, et al Vaccination with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J Exp Med, 190: 1669-78, 1999.[Abstract/Free Full Text]
  15. Kim JJ, Bagarazzi ML, Trivedi N, et al Engineering of in vivo immune responses to DNA immunization via codelivery of costimulatory molecule genes. Nat Biotechnol, 15: 641-6, 1997.[CrossRef][Medline]
  16. Agadjanyan MG, Kim JJ, Trivedi N, et al CD86 (B7–2) can function to drive MHC-restricted antigen-specific CTL responses in vivo. J Immunol, 162: 3417-27, 1999.[Abstract/Free Full Text]
  17. Liu X, Gao JX, Wen J, et al B7DC/PDL2 promotes tumor immunity by a PD-1-independent mechanism. J Exp Med, 197: 1721-30, 2003.[Abstract/Free Full Text]
  18. Tseng SY, Otsuji M, Gorski K, et al B7-DC, a new dendritic cell molecule with potent costimulatory properties for T cells. J Exp Med, 193: 839-46, 2001.[Abstract/Free Full Text]
  19. Latchman Y, Wood CR, Chernova T, et al PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol, 2: 261-8, 2001.[CrossRef][Medline]
  20. Wang S, Bajorath J, Flies DB, et al Molecular modeling and functional mapping of B7–H1 and B7-DC uncouple costimulatory function from PD-1 interaction. J Exp Med, 197: 1083-91, 2003.[Abstract/Free Full Text]
  21. Shin T, Kennedy G, Gorski K, et al Cooperative B7-1/2 (CD80/CD86) and B7-DC costimulation of CD4+ T cells independent of the PD-1 receptor. J Exp Med, 198: 31-8, 2003.[Abstract/Free Full Text]
  22. Dobrzanski MJ, Reome JB, Dutton RW. Type 1 and type 2 CD8+ effector cell subpopulations promote long-term tumor immunity and protection to progressively growing tumor. J Immunol, 164: 916-25, 2000.[Abstract/Free Full Text]
  23. Yajima T, Nishimura H, Wajjwalku W, et al Overexpression of interleukin-15 in vivo enhances antitumor activity against MHC class I-negative and -positive malignant melanoma through augmented NK activity and cytotoxic T-cell response. Int J Cancer, 99: 573-8, 2002.[CrossRef][Medline]
  24. Bohm W, Thoma S, Leithauser F, et al T cell-mediated, IFN-gamma-facilitated rejection of murine B16 melanomas. J Immunol, 161: 897-908, 1998.[Abstract/Free Full Text]
  25. Kitamura D, Roes J, Kuhn R, Rajewsky K. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature (Lond), 350: 423-6, 1991.[CrossRef][Medline]
  26. Yamazaki T, Akiba H, Iwai H, et al Expression of programmed death 1 ligands by murine T cells and APC. J Immunol, 169: 5538-45, 2002.[Abstract/Free Full Text]
  27. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature (Lond), 392: 245-52, 1998.[CrossRef][Medline]
  28. Van den Broek ME, Kagi D, Ossendorp F, et al Decreased tumor surveillance in perforin-deficient mice. J Exp Med, 184: 1781-90, 1996.[Abstract/Free Full Text]
  29. Pardo J, Balkow S, Anel A, Simon MM. Granzymes are essential for natural killer cell-mediated and perf-facilitated tumor control. Eur J Immunol, 32: 2881-7, 2002.[CrossRef][Medline]
  30. Smyth MJ, Street SEA, Trapani JA. Cutting edge: granzymes A and B are not essential for perforin-mediated tumor rejection. J Immunol, 171: 515-8, 2003.[Abstract/Free Full Text]
  31. Slansky JE, Rattis FM, Boyd LF, et al Enhanced antigen-specific antitumor immunity with altered peptide ligands that stabilize the MHC-peptide-TCR complex. Immunity, 13: 529-38, 2000.[CrossRef][Medline]
  32. Hess SD, Egilmez NK, Bailey N, et al Human CD4+ T cells present within the microenvironment of human long tumors are mobilized by the local and sustained release of IL-12 to kill tumors in situ by indirect effects of IFN-gamma. J Immunol, 170: 400-12, 2003.[Abstract/Free Full Text]
  33. Hayakawa Y, Kelly JM, Westwood JA, et al Cutting edge: tumor rejection mediated by NKG2D receptor-ligand interaction is dependent upon perforin. J Immunol, 169: 5377-81, 2002.[Abstract/Free Full Text]
  34. Kelly JM, Takeda K, Darcy PK, Yagita H, Smyth MJ. A role for IFN-gamma in primary and secondary immunity generated by NK cell-sensitive tumor-expressing CD80 in vivo. J Immunol, 168: 4472-9, 2002.[Abstract/Free Full Text]
  35. Chiang EY, Henson M, Stroynowski I. Correction of defects responsible for impaired Qa-2 class Ib MHC expression on melanoma cells protects mice from tumor growth. J Immunol, 170: 4515-23, 2003.[Abstract/Free Full Text]
  36. Xu D, Gu P, Pan PY, et al NK and CD8+ T cell-mediated eradication of poorly immunogenic B16–F10 melanoma by the combined action of IL-12 gene therapy and 4-1BB costimulation. Int J Cancer, 109: 499-506, 2004.[CrossRef][Medline]
  37. Warrington AE, Asakura K, Bieber AJ, et al Human monoclonal antibodies reactive to oligodendrocytes promote remyelination in a model of multiple sclerosis. Proc Natl Acad Sci USA, 97: 6820-5, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
NeurologyHome page
M. Rodriguez, A. E. Warrington, and L. R. Pease
Invited Article: Human natural autoantibodies in the treatment of neurologic disease
Neurology, April 7, 2009; 72(14): 1269 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. D. Pavelko, M. J. Hansen, and L. R. Pease
CTL Activation Using the Natural Low-Affinity Epitope 222-229 from Tyrosinase-Related Protein 1 Leads to Tumor Rejection
Cancer Res., April 1, 2009; 69(7): 3114 - 3120.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Radhakrishnan, L. N. Arneson, J. L. Upshaw, C. L. Howe, S. J. Felts, M. Colonna, P. J. Leibson, M. Rodriguez, and L. R. Pease
TREM-2 Mediated Signaling Induces Antigen Uptake and Retention in Mature Myeloid Dendritic Cells
J. Immunol., December 1, 2008; 181(11): 7863 - 7872.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Radhakrishnan, R. Cabrera, E. L. Schenk, P. Nava-Parada, M. P. Bell, V. P. Van Keulen, R. J. Marler, S. J. Felts, and L. R. Pease
Reprogrammed FoxP3+ T Regulatory Cells Become IL-17+ Antigen-Specific Autoimmune Effectors In Vitro and In Vivo
J. Immunol., September 1, 2008; 181(5): 3137 - 3147.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. D. Pavelko, K. L. Heckman, M. J. Hansen, and L. R. Pease
An Effective Vaccine Strategy Protective against Antigenically Distinct Tumor Variants
Cancer Res., April 1, 2008; 68(7): 2471 - 2478.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Radhakrishnan, L. T. Nguyen, B. Ciric, V. P. Van Keulen, and L. R. Pease
B7-DC/PD-L2 Cross-Linking Induces NF-{kappa}B-Dependent Protection of Dendritic Cells from Cell Death
J. Immunol., February 1, 2007; 178(3): 1426 - 1432.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. S. Kornbluth and G. W. Stone
Immunostimulatory combinations: designing the next generation of vaccine adjuvants
J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. A. Blocki, S. Radhakrishnan, V. P. Van Keulen, K. L. Heckman, B. Ciric, C. L. Howe, M. Rodriguez, E. Kwon, and L. R. Pease
Induction of a gene expression program in dendritic cells with a cross-linking IgM antibody to the co-stimulatory molecule B7-DC
FASEB J, November 1, 2006; 20(13): 2408 - 2410.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Zhang, Y. Chung, C. Bishop, B. Daugherty, H. Chute, P. Holst, C. Kurahara, F. Lott, N. Sun, A. A. Welcher, et al.
Regulation of T cell activation and tolerance by PDL2
PNAS, August 1, 2006; 103(31): 11695 - 11700.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Lizee, L. G. Radvanyi, W. W. Overwijk, and P. Hwu
Immunosuppression in melanoma immunotherapy: potential opportunities for intervention.
Clin. Cancer Res., April 1, 2006; 12(7): 2359s - 2365s.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Radhakrishnan, E. Celis, and L. R. Pease
B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells
PNAS, August 9, 2005; 102(32): 11438 - 11443.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Bayry, S. Lacroix-Desmazes, M. D. Kazatchkine, O. Hermine, D. F. Tough, and S. V. Kaveri
Modulation of Dendritic Cell Maturation and Function by B Lymphocytes
J. Immunol., July 1, 2005; 175(1): 15 - 20.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Ohigashi, M. Sho, Y. Yamada, Y. Tsurui, K. Hamada, N. Ikeda, T. Mizuno, R. Yoriki, H. Kashizuka, K. Yane, et al.
Clinical Significance of Programmed Death-1 Ligand-1 and Programmed Death-1 Ligand-2 Expression in Human Esophageal Cancer
Clin. Cancer Res., April 15, 2005; 11(8): 2947 - 2953.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online