| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Departments of 1 Immunology and 2 Neurology, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, Minnesota
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Developing tumors express sets of antigens that are potential targets for the immune system. When tumors become established, these antigens have either been ignored or ineffective in generating an immune response that can protect the host from tumor development. Tumor resistance mechanisms include down-modulation of MHC class I (3) , loss of tumor-associated antigens (4) , and expression of immunosuppressive molecules such as transforming growth factor ß (5) . Tumors also inhibit T-cell response by inducing peripheral tolerance (6) or by inducing T regulatory cells (7) . Immunotherapy strategies seek to provide the necessary stimuli to overcome factors limiting the immunogenicity of tumor-associated antigens to promote effective antitumor immunity. Among strategies that have proven effective are protocols designed to raise antigen dose, recruit and mobilize antigen-presenting cells, and promote the activation and survival of effector T cells (8 , 9) .
Antigen-specific T-cell responses are initiated by DCs. DCs are capable of capturing antigens that are secreted or shed by tumor cells, resulting in presentation of peptides on both class I and class II MHC molecules. In response to maturation signals, DCs up-regulate their expression of costimulatory molecules and cytokines, which efficiently prime CD4 and CD8 T cells (10, 11, 12) . Techniques have been established for generating DCs ex vivo, resulting in the development of DC-based vaccines for tumors (13 , 14) . Because costimulatory signals expressed by antigen-presenting cells are critical in determining the outcome of T-cell-dependent immune responses, improved CTL responses have been achieved by introducing costimulatory molecules such as B7-1, B7-2, and B7-DC into tumors (15, 16, 17) and then using the engineered cells to induce effective immune responses.
B7-DC/PD-L2 belongs to the expanding family of B7 proteins. B7-DC, like other family members, contains immunoglobulin-like extracellular domains, a transmembrane domain, and a short cytoplasmic tail. PD-1 has been identified as a cognate receptor for B7-DC. PD-1 is expressed on activated T cells. Data exist to support both positive and negative modulation of T-cell responses after interaction between B7-DC and its receptors (18 , 19) . These seemingly contradictory findings might be explained by the possible existence of receptors other than PD-1 that can interact with B7-DC. The ability of B7-DC to bind to PD-1-deficient T cells supports this possibility. Moreover, mutagenesis and modeling studies indicate that the binding site for B7-DC is distinct from that of B7-H1, another ligand for PD-1 (20 , 21) . Potential differences in the interaction of B7-DC and B7-H1 with different receptors may influence whether positive or negative immune modulation is elicited.
In this report, we document the potentiation of the immune response against B16 melanoma after systemic treatment of mice with small amounts (30 µg) of B7-DC cross-linking antibody in both prophylactic and therapeutic models. A number of different effector mechanisms involving cytotoxic cells and protective lymphokines have been defined in other immunotherapeutic schemes for treatment of B16 melanoma (22, 23, 24) . Here, we provide evidence that the enhanced immunity induced with B7-DC cross-linking antibody is mediated by T cells and dependent on key components of their cytotoxic granules.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Reagents.
The B7-DC cross-linking antibody sHIgM12 was purified from serum from a patient with Waldenstrom’s macroglobulinemia as described previously (2)
. A preparation of polyclonal human IgM antibody (2)
and an IgM antibody (sHIgM39) purified from the serum of a patient with chronic lymphoproliferative disorder were used as isotype control antibodies. Bouin’s fixative was obtained from Sigma-Aldrich (St. Louis, MO). B16, B16-F10, and EL-4 lines of tumors were maintained in RPMI 1640 (Cambrex Bioscience, Walkersville, MD) containing 10% calf serum (GIBCO Invitrogen, Grand Island, NY). Phycoerythrin-coupled antibody to pan-natural killer (NK) cell marker DX-5 was obtained from PharMingen (San Diego, CA). NK1.1 (PK136) was obtained from L. Chen (Mayo Clinic). Lipopolysaccharide and polyinosinic polycytidylic acid (poly I:C) were purchased from Calbiochem. CpG (TCCATGACGTTCCTGACGTT) was synthesized in the Mayo Clinic molecular biology core facility.
Prophylactic Regimen.
In this protocol, mice received injection with 2 x 104 B16 cells on the right flank in a 100-µl volume. Animals received injection with 10 µg of sHIgM12 or control antibody in 100 µl of PBS the day before, the day of, and the day after tumor challenge. Mice were monitored for the development of tumor and euthanized when tumor size reached 225 mm2. The size of the tumors was determined in two dimensions using calipers (Dyer, Lancaster, PA). The mice that failed to develop tumors for 30 days were rechallenged with 2 x 104 B16 cells on the left flank. Rechallenged mice were monitored for another 30 days. Separate sets of mice that resisted B16 melanoma grafts were challenged with 2 x 106 EL-4 cells on the opposite flank and monitored for tumor growth. Naïve mice injected with 2 x 106 EL-4 cells served as controls for this test of specificity of tumor resistance.
Therapeutic Regimen.
In this protocol, mice received injection with 5 x 105 B16-F10 cells i.v. Mice were treated with 10 µg of sHIgM12 or control antibody on days 3, 4, and 5. Sentinel mice received injection with the tumor cells and received no further treatments. Tumor load in sentinel animals was monitored by examining the lungs of individual animals on a periodic basis to ascertain when a significant tumor load was present in the treatment groups. When a sentinel was detected that had developed 50 or more tumor nodules in its lungs, the animals in the experiment treatment groups were euthanized, and tumor nodules in their lungs were counted. For depletion experiments, 200 µg of NK1.1 monoclonal antibody was injected i.p. 72 and 48 h before tumor injection and every 3–4 days thereafter for the duration of the experiment. Depletion of the appropriate cell subset was confirmed by flow cytometry using anti-NK1.1 and anti-DX-5 antibody. In our hands, the sentinel mice developed nodules in the lungs by days 17–21. Mice from all of the experimental groups were then euthanized, and the lungs were fixed with Bouin’s fixative. The number of nodules was determined using a dissection microscope.
Flow Cytometry.
Sera were collected from mice that had been engrafted with B16 melanoma on the flank and treated using the prophylactic regimen with either control polyclonal IgM antibody or sHIgM12 antibody. Dilutions of the sera were assayed for the presence of antitumor antibodies using standard flow cytometry (1)
to assess binding to B16 melanoma cells. DCs derived from bone marrow precursors in vitro or isolated directly from the spleens of animals as described previously (2)
were analyzed by multicolor flow cytometry for incorporation of FITC and staining with anti-B7.1-PE or B7.2-PE and anti-CD11c-APC.
Cytotoxicity Assay.
Briefly, 5 x 105 B16 melanoma cells were injected in the right flank of C57BL/6 mice. Mice received i.v. injection with 10 µg of either control antibody or B7-DC cross-linking antibody on the day before, the day of, and the day after tumor injection. Seven days later, cells from the draining lymph nodes from 5 mice/group were harvested, pooled, and further stimulated by mitomycin C (Calbiochem)-treated B16 melanoma cells (2 x 106 cells/ml) for an additional 4 days. The effector cells were harvested and titrated in triplicate against 51Cr (Amersham)-labeled B16 or EL-4 cells in a standard 4-h cytotoxicity assay.
Statistical Analysis.
Statistical analysis was performed on normally distributed data using ANOVA for multiple comparisons or Student’s t test for comparisons of two groups. For data that were not distributed normally, the Whitney rank-sum test was used for analysis of two treatment groups and a rank ANOVA was used for comparison of more than two treatment groups.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). For mice that did develop palpable tumors, sHIgM12 antibody treatment significantly inhibited the growth of the tumor as compared with tumors growing in mice treated with PBS or polyclonal human IgM antibody (P < 0.001; Table 1
). The delay in growth was transient because tumors that did develop in sHIgM12-treated mice eventually progressed to 225 cm2 in size. In a separate experiment, mice treated with sHIgM12 antibody on days 9, 8, and 7 before challenge with B16 melanoma displayed no treatment effects on tumor growth; 100% of the animals treated with B7-DC cross-linking antibody (n = 8) or isotype control antibody (n = 8) developed tumors with the same kinetics (data not shown). This finding indicates that the timing of treatment relative to tumor engraftment is an important factor in determining treatment outcome.
|
Our earlier studies demonstrated that sHIgM12 antibody binds to DCs derived from bone marrow precursors in vitro. This binding activity suggests that the induced resistance to the lethal tumor challenge may be mediated by antibody interactions with endogenous DCs. Modulation of DC function could promote changes in the immune response and be the underlying mechanism determining antibody-induced tumor resistance. We explored this possibility using two approaches. First, we evaluated whether sHIgM12 antibody administered systemically to mice modulated the phenotype of endogenous DCs. Second, we evaluated whether in vivo administration of the antibody induced tumor resistance by potentiating an antitumor response.
Using DCs generated in vitro from bone marrow precursors, we had previously shown that treatment with sHIgM12 B7-DC cross-linking antibody potentiates the ability of these cells to activate naïve antigen-specific T cells but does not induce traditional maturation markers in the DC. As DCs mature, they lose the ability to acquire antigen from their surroundings and increase their expression of the costimulatory molecules B7.1 (CD80) and B7.2 (CD86) at the cell surface (27)
. We have demonstrated previously that B7.1 and B7.2 expression levels do not substantially increase after treatment of bone marrow-derived myeloid DCs with sHIgM12 antibody in vitro (2)
. To evaluate functional changes associated with activation after sHIgM12 antibody treatment, we assessed changes in pinocytotic activity by monitoring the ability of DCs to take up FITC-tagged bovine serum albumin (BSA) in vitro. As shown in Table 2
, DCs treated with the toll-like receptor 4 (TLR-4) agonist lipopolysaccharide accumulated lower amounts of FITC-BSA compared with the levels acquired by DCs treated with control polyclonal IgM antibody. Because engagement of TLR-4 induces the maturation of DCs, this is an expected result. In contrast, DCs treated with the B7-DC cross-linking antibody sHIgM12 accumulated significantly more FITC-BSA than did DCs treated with isotype control antibody. This finding provides additional evidence that activation of DCs with B7-DC cross-linking antibody does not induce a traditionally defined maturation response but rather induces a distinctive activation phenotype.
|
, DCs isolated from animals treated with the B7-DC cross-linking antibody sHIgM12 acquired significantly higher levels of FITC-OVA relative to DCs from animals treated with the isotype control antibody. This result mirrors our analysis of pinocytotic activity of bone marrow-derived DCs in vitro. Furthermore, DCs isolated from animals treated with the TLR agonists accumulated significantly lower levels of FITC-OVA, a finding consistent with the previously described decreases in antigen acquisition by matured DCs. The maturation status of these endogenous DCs in this analysis is illustrated by the levels of expression of the B7.1 and B7.2 costimulatory molecules in the different treatment groups. There was no significant difference in expression levels of costimulatory molecules on DCs isolated from animals treated with B7-DC cross-linking antibody or isotype control antibodies, demonstrating that treatment with sHIgM12 antibody does not induce maturation of DCs in vivo. This finding mirrors those we reported previously for bone marrow-derived DCs in vitro (2)
. DCs from mice treated with the TLR agonists, on the other hand, expressed significantly higher levels of both costimulatory molecules, demonstrating that DC maturation is induced by engaging TLR-3 and TLR-9.
To determine whether treatment of mice with sHIgM12 B7-DC cross-linking antibody induces tumor resistance by potentiating an immune response, we evaluated the ability of antibody to induce tumor resistance in immunodeficient B6-RAG1–/– mice lacking B and T cells. Treatment of these animals with sHIgM12 antibody using the prophylactic treatment protocol had no effect on B16 melanoma appearance or growth, demonstrating that an intact immune system is essential for the induction of tumor resistance (Table 3)
. The failure of sHIgM12 antibody treatment to protect Rag-deficient mice also provides additional evidence that the antibody does not act directly on the tumor. The importance of the CD8 T cells in the host immune response to the tumors was established using ß2-microglobulin–/– mice. Although these knockout mice have an intact CD4 T-cell repertoire, the deficiency in CD8 T cells abolished the protective effect of sHIgM12 antibody treatment (Table 3)
. Likewise, the absence of a helper response in CD4 knockout mice abrogated the protective effect of sHIgM12 because all of these mice developed palpable tumors akin to mice receiving control treatment (Table 3)
.
|
, levels of tumor-reactive antibodies were indistinguishable in animals receiving tumor protective treatment with B7-DC cross-linking antibody or nonprotective treatment with polyclonal human IgM antibody. To further evaluate whether B-cell responses are important contributors to the antitumor response induced by B7-DC cross-linking, B-cell-deficient µMT animals were treated with B7-DC cross-linking antibodies and challenged with B16 melanoma using the prophylactic treatment model. Wild-type C57BL/6 mice treated with isotype control human IgM antibody developed rapidly growing tumors that reached 225 mm2 by day 17 after tumor engraftment (n = 4). In contrast, C57BL/6 (n = 5) and µMT (n = 5) mice treated with sHIgM12 B7-DC cross-linking antibody were strongly protected; one of five of the C57BL/6 mice eventually developed a tumor, whereas no tumors developed in the B-cell-deficient µMT animals. B16 melanoma grew rapidly in the µMT mouse line after treatment with isotype control antibody, demonstrating histocompatibility of the tumor with the µMT subline. These results demonstrate that an antitumor antibody response is not a critical factor distinguishing susceptible from resistant mice in this tumor model. Furthermore, the finding that B-cell-deficient mice are protected from B16 melanoma after treatment with the human antibody sHIgM12 excludes the possibility that an antihuman IgM antibody response by antibody-treated animals is an integral component of the treatment effect elicited with B7-DC cross-linking antibody.
|
, mice that had survived for at least 30 days after initial tumor challenge displayed significant resistance to a secondary challenge with tumor cells (P < 0.001). Because none of the surviving mice received additional treatments with sHIgM12, the resistance to secondary challenge indicates that an effective antitumor immune response was established in mice treated with sHIgM12 after the initial challenge. In contrast, animals that resisted B16 melanoma after sHIgM12 antibody treatment showed no increased resistance to the unrelated tumor, EL-4.
|
. Killing was specific for the B16 melanoma targets because EL-4 tumor cells were not killed. Lymph node cells from B16-challenged mice treated with control antibody displayed no activity, a finding consistent with the known weak innate antigenicity of the B16 melanoma tumor line.
|
Systemic Treatment of Mice with sHIgM12 B7-DC Cross-Linking Antibody Protects Mice in a B16 Lung Metastasis Model.
The B16-F10 subline of B16 melanoma has been selected for its efficient ability to metastasize to the lungs. This particular tumor line is highly virulent and weakly antigenic; moreover, it is characterized by depressed MHC class I gene expression. A useful modification of the metastasis model has been to introduce the B16-F10 melanoma i.v. as a cell suspension. This results in 50–200 tumor nodules in the lungs of all challenged animals within 3–4 weeks. To evaluate the effectiveness of sHIgM12 antibody treatment on the induction of tumor resistance in this model, animals were seeded with lung metastases 3 days before antibody treatment. Animals received 10 µg of sHIgM12 B7-DC cross-linking antibody i.v. on days 3, 4, and 5 after tumor challenge. Untreated sentinel mice that received identical tumor challenges were monitored for tumor burden. When tumor burdens exceeding 50 nodules were detected in the sentinel mice, the experiments were terminated, and the lungs of animals from all treatment groups were analyzed for the presence of tumor.
As shown in Fig. 3A
, the lungs of animals receiving sHIgM12 antibody treatment contained significantly fewer tumor nodules than mice receiving control polyclonal IgM antibody. In the illustrated experiment, all eight animals treated with sHIgM12 antibody developed fewer tumor nodules than the least number observed in the eight animals treated with control isotype-matched antibody (Fig. 3B
; P < 0.001). In the experiment shown, three of the eight protected animals developed no tumor. Our overall experience is that approximately half the animals (14 of 29) treated with B7-DC cross-linking antibodies remained free of tumor. These findings demonstrate that systemic administration of B7-DC cross-linking antibody confers resistance to a highly lethal, weakly immunogenic tumor, even after the tumor is allowed to establish itself for 3 days before initiation of treatment.
|
, direct comparison of sHIgM12-treated, NK cell-depleted animals with sHIgM12-treated mice suggests a minor but statistically significant (P < 0.001) contribution of NK cells to the antitumor response induced by systemic sHIgM12 treatment. However, NK cell-depleted mice were still responsive to the immunotherapeutic effects of B7-DC cross-linking antibody administered 3 days after i.v. challenge with B16-F10 melanoma (P = 0.002). In contrast, CD8 knockout mice were not responsive to treatment with B7-DC cross-linking antibody, indicating that CD8+ T cells are critical mediators of antitumor immunity in this model. NK-deficient or CD8-deficient mice that did not receive B7-DC cross-linking antibodies were no more susceptible or resistant to development of lung tumors than were untreated animals, findings consistent with the characteristically weak immunogenicity of the B16-F10 tumor line.
|
, sHIgM12 immunotherapy was ineffective in perforin-deficient animals but highly effective in wild-type B6 mice. In an independent experiment, B7-DC cross-linking with sHIgM12 antibody also was not protective in granzyme B-deficient mice. Using the therapeutic treatment model, an average of 98.2 ± 4.9 (n = 5) tumor nodules were found in the lungs of granzyme B-deficient mice treated with control polyclonal human IgM antibody, as compared with 99.2 ± 15.0 (n = 5) tumor nodules in the lungs of granzyme B-deficient mice treated with sHIgM12 B7-DC cross-linking antibody (data not shown). Because we have previously demonstrated that NK cells are not the primary mediators of the antitumor resistance induced by treatment with B7-DC cross-linking antibody, and because we have shown that the protective response is dependent on CD8 T cells, these findings are most consistent with the view that treatment of tumor-bearing mice with B7-DC cross-linking antibody potentiates cytolytic CD8+ T cells in vivo and that cytotoxicity is mediated by both perforin and granzyme B.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
All of the wild-type mice in our study treated with B7-DC cross-linking antibody showed protective antitumor treatment effects in comparison with animals receiving isotype-matched control human IgM antibodies. Approximately 70% of the animals treated with B7-DC cross-linking antibody and challenged with B16 melanoma remained tumor free; the remaining 30% grew tumor more slowly. Animals that resisted the growth of the initial B16 melanoma challenge resisted a secondary challenge with B16 melanoma, indicating a classical memory response. Resistance was antigen specific because an unrelated tumor, EL-4, grew unabatedly in mice that had previously resisted B16 melanoma as a result of sHIgM12 treatment. We interpret these findings as evidence that systemic treatment of animals with B7-DC cross-linking antibody potentiates a long-lasting, protective, adaptive, cellular immune response against weak tumor antigens expressed by B16 melanoma.
The stability of the peptide-MHC complex and T-cell receptor interaction has been directly correlated to protection against tumors (31)
. We demonstrated previously that the amount of peptide-MHC complex generated on the surface of DCs in vitro was significantly increased on cross-linking B7-DC (1)
. It is possible that antibody treatment enhances tumor rejection by augmenting antigen presentation, resulting in better priming and effector responses. Our finding that treatment with B7-DC cross-linking antibody enhances pinocytotic activity by DCs in vitro and in vivo is consistent with this view. A second, mutually nonexclusive mechanism by which the tumors might be rejected could involve IL-12 and IFN-
secretion leading to a pro-inflammatory tumor microenvironment. The enhanced production of IL-12 by DCs treated with B7-DC cross-linking antibody is consistent with this view (1)
. Indeed, previous studies have shown that CD4 T cells present in the tumor microenvironment are mobilized by release of IL-12 to kill tumors, and this activity correlated with the serum levels of human IFN- (32)
. We find that CD4+ cells are required for the induction of antitumor resistance with sHIgM12 antibody. Because CD4+ cells were not protective in the absence of CD8+ cells, our findings are most consistent with a helper function of CD4+ T cells in support of a CD8+ CTL response. However, whether CD4+ T cells function as effector cells in this tumor model after treatment with sHIgM12 antibody is not known.
NK cells are known to play an important role in the rejection of tumors under some circumstances, and IL-12, perforin, and IFN- contribute to the NK-mediated antitumor response (33
, 34) . Furthermore, NK cell-mediated rejection of tumor can lead to subsequent priming and onset of acquired immunity (34)
. A protective role for NK cells in resistance to the development of B16-F10 tumor nodules would be consistent with the reduced levels of class I expression by these tumor cells (35
, 36)
. In our study, depletion of NK cells with NK-reactive antibody had little effect on the ability of B7-DC cross-linking antibody to induce resistance to tumor. Expression of both perforin and granzyme B was shown to be critical for the induction of antitumor resistance with sHIgM12 B7-DC cross-linking antibody. Our interpretation is that despite the low levels of class I antigen-presenting molecules expressed by B16-F10 cells, an antibody-induced cytolytic T-cell response is protecting the animals.
Our current view, based on these findings, is that B7-DC cross-linking antibody binds to resident DCs, potentiating their ability to acquire tumor antigens in situ and process the antigens for presentation to T cells and enhancing their ability to activate naïve T cells, promoting a protective cellular cytolytic response. We have previously documented the ability of systemically administered antibody to mobilize and potentiate DCs introduced in a distal site and to augment their ability to reach draining lymph nodes. Here we have extended these results, demonstrating that systemic antibody treatment increases antigen acquisition by endogenous DCs of antigen administered i.p. These findings suggest the possibility that DCs at the site of tumor growth might also be mobilized by this treatment strategy.
B7-DC is known to interact with the T-cell ligand PD-1, inducing, under some circumstances, negative signals that dampen T-cell activation (19) . The extent to which treatment with small amounts of sHIgM12 antibody interferes with this regulatory interaction is not known, but any interference could lead to further increases in immune potentiation.
The sHIgM12 antibody may have important therapeutic potential for the treatment of human disease. The nature of the epitopes recognized by the IgM antibodies we have used to manipulate cell functions in vivo is not known but in several instances seems to be conserved across species. IgM antibodies we described that bind to rat oligodendrocytes also bind to human oligodendrocytes and mouse myelin tracts (37) . The ability of antibody sHIgM12 to bind to both mouse and human DCs (2) generalizes this concept. Because much is known about the biology of DCs, it will be possible to compare how cross-linking B7-DC expressed by human and mouse DCs will influence immune functions. These studies are ongoing, but it is already evident that the sHIgM12 antibody induces changes in human myeloid DCs that mirror some of the important changes we have described in mice (1 , 2) . It will be of great interest to determine whether the human antibody sHIgM12 can be used to manipulate human DCs in vivo and to modify the immune response in beneficial ways, just as we have done in the mouse. The induction of a protective immune response against an aggressive, weakly antigenic tumor, as described in this report, is one example of how this antibody might be used.
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Larry R. Pease, Department of Immunology, Mayo Clinic College of Medicine, Mayo Clinic, 200 First Street SW, Rochester, MN 55905. Phone: (507) 284-8177; Fax: (507) 266-0981; E-mail: pease.larry{at}mayo.edu
Received 9/25/03. Revised 3/24/04. Accepted 5/ 7/04.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. Radhakrishnan, R. Cabrera, E. L. Schenk, P. Nava-Parada, M. P. Bell, V. P. Van Keulen, R. J. Marler, S. J. Felts, and L. R. Pease Reprogrammed FoxP3+ T Regulatory Cells Become IL-17+ Antigen-Specific Autoimmune Effectors In Vitro and In Vivo J. Immunol., September 1, 2008; 181(5): 3137 - 3147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. D. Pavelko, K. L. Heckman, M. J. Hansen, and L. R. Pease An Effective Vaccine Strategy Protective against Antigenically Distinct Tumor Variants Cancer Res., April 1, 2008; 68(7): 2471 - 2478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Radhakrishnan, L. T. Nguyen, B. Ciric, V. P. Van Keulen, and L. R. Pease B7-DC/PD-L2 Cross-Linking Induces NF-{kappa}B-Dependent Protection of Dendritic Cells from Cell Death J. Immunol., February 1, 2007; 178(3): 1426 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Kornbluth and G. W. Stone Immunostimulatory combinations: designing the next generation of vaccine adjuvants J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. A. Blocki, S. Radhakrishnan, V. P. Van Keulen, K. L. Heckman, B. Ciric, C. L. Howe, M. Rodriguez, E. Kwon, and L. R. Pease Induction of a gene expression program in dendritic cells with a cross-linking IgM antibody to the co-stimulatory molecule B7-DC FASEB J, November 1, 2006; 20(13): 2408 - 2410. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, Y. Chung, C. Bishop, B. Daugherty, H. Chute, P. Holst, C. Kurahara, F. Lott, N. Sun, A. A. Welcher, et al. Regulation of T cell activation and tolerance by PDL2 PNAS, August 1, 2006; 103(31): 11695 - 11700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lizee, L. G. Radvanyi, W. W. Overwijk, and P. Hwu Immunosuppression in melanoma immunotherapy: potential opportunities for intervention. Clin. Cancer Res., April 1, 2006; 12(7): 2359s - 2365s. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Radhakrishnan, E. Celis, and L. R. Pease B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells PNAS, August 9, 2005; 102(32): 11438 - 11443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bayry, S. Lacroix-Desmazes, M. D. Kazatchkine, O. Hermine, D. F. Tough, and S. V. Kaveri Modulation of Dendritic Cell Maturation and Function by B Lymphocytes J. Immunol., July 1, 2005; 175(1): 15 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ohigashi, M. Sho, Y. Yamada, Y. Tsurui, K. Hamada, N. Ikeda, T. Mizuno, R. Yoriki, H. Kashizuka, K. Yane, et al. Clinical Significance of Programmed Death-1 Ligand-1 and Programmed Death-1 Ligand-2 Expression in Human Esophageal Cancer Clin. Cancer Res., April 15, 2005; 11(8): 2947 - 2953. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||
2 distribution (P < 0.001). Fischer’s exact test was used to compare individual groups with the reference animals. The width and length of s.c. tumors were measured on day 17. The product of width x length was used as an estimate of tumor size. Statistical comparisons were made using ANOVA.
) or sHIgM12 B7-DC cross-linking antibody (
) i.v. Serum was collected on day 17 from both groups. Antibodies in the sera were evaluated by serial dilution and flow cytometry for their ability to bind to B16 melanoma cells. Data are represented as mean fluorescent intensity (n = 5/group).
