| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Lung Biology Research Programme and Canadian Institutes of Health Research Group in Lung Development, The Hospital for Sick Children, 2 Departments of Laboratory Medicine and Pathobiology, 3 Division of Surgical Oncology at Princess Margaret Hospital, 4 Ontario Cancer Institute/Princess Margaret Hospital, and 5 Department of Paediatrics, The University of Toronto, Toronto, Ontario, and 6 Department of Surgery and Department of Oncology, McGill University and The Royal Victoria Hospital, Montreal, Quebec, Canada
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
COUP-TFs are the best characterized "orphan" (ligands not yet identified) nuclear receptors (2) . They belong to the steroid/thyroid hormone receptor superfamily of nuclear receptor proteins and are required for regulation of gene expression (3) , development, differentiation, and homeostasis (4) . Angiogenesis in COUP-TFII mutant mice is largely impaired (5) , and defects mimic the phenotypes exhibited by mice lacking angiopoietin-1 or its receptor, TIE2. It has also been suggested that COUP-TFII plays an important role in mesenchymal-endothelial interactions (5) . COUP-TFs are expressed in some tumor cell lines (6) , including human endometrial cancer cells (7) , lung cancer cells (8) , and in adrenal tumors (9) , but are not expressed in terminally differentiated epithelial cells. The relationship between COUP-TFII expression and cancer development is not known.
Several types of proteases contribute to the degradation of the extracellular matrix: serine proteases (e.g., plasmin and urokinase-type plasminogen activator; uPA; Ref. 10 ), cysteine proteases (e.g., cathepsins B and L; Ref. 11 ), and matrix metalloproteinases (MMP; Ref. 12 ). MMPs are implicated in tumor invasion and metastasis (13) . Other features of tumor evolution, including survival, growth, and angiogenesis, may also be dependent on MMPs (14) . MMP members are classified into subgroups on the basis of their structure and substrate preference (15) . Among these, the gelatinases (MMP-2 and MMP-9) are closely associated with tumor invasiveness and metastasis because of their potent ability to degrade type IV collagen present in the basement membrane that surrounds blood vessels. Elevated levels of gelatinases are found in many types of human cancers (16) .
In the extracellular milieu, the activity of MMPs is controlled by tissue inhibitors of MMPs (TIMP; Ref. 17 ). Although these inhibitors have similar inhibitory activities against most MMPs, they differ in many aspects including their interactions with pro-MMPs, solubility, transcriptional regulation, and tissue specificity (17) . TIMP-1 forms complexes with pro-MMP-9, and TIMP-2 and TIMP-4 with pro-MMP-2 (18) .
MMPs are produced by cells as proenzymes, and they require additional processing to generate the active enzyme. The activation of pro-MMPs is facilitated by active forms of other MMPs. For example, the activation of pro-MMP-2 requires a membrane-type MMP at the cell surface (16) . The activation of pro-MMPs can also be mediated by other groups of proteinases (19) . For example, a serine proteinase, plasmin, can activate gelatinases without the action of other metallo- or acidic proteinases (20) . It has been shown that increased expression of uPA and its membrane-bound receptor (uPAR; CD87) is closely correlated with an increase in disease recurrence and with early death of lung and other cancer patients (21) . Cell membrane-associated uPAR is a key molecule for the induction of pericellular proteolysis, because plasminogen is efficiently activated to plasmin by cell surface-associated interactions with uPAR-bound uPA (22) .
Interference with the membrane-associated function of uPAR should result in a reduction in plasminogen activation, which would decrease tumor cell proliferation, invasion, and metastasis (23) . In this context, it is important to note that the membrane anchoring of uPAR is not a prerequisite for uPA activation but is necessary for plasminogen activation (22) . In addition to the proteolytic function of uPA, the uPA/uPAR interaction induces downstream signaling, resulting in the induction of cell proliferation, adherence, migration, and chemotaxis (24) .
We examined the relationship between COUP-TFII and ECM proteinases. We demonstrate that COUP-TFII-transfected A549 cells (a human lung cancer cell line in which COUP-TFII is not normally expressed) acquired invasive ability, had increased in vitro tumorigenicity and migratory ability, and displayed enhanced expression of collagenase type IV (MMP-2). These results were confirmed by transduction of different human lung cancer cell lines and a human breast carcinoma cell line (MDA-MB231) with purified COUP-TFII protein.
Interestingly, transfection of a very invasive human lung cancer cell line (H460SM) with COUP-TFII in the antisense orientation decreased COUP-TFII expression level, suppressed their invasive and migratory ability, and profoundly reduced the synthesis of both pro- and active forms of MMP-2. To analyze more specifically the contribution of COUP-TFII to the process of invasion, the regulations of human (h)uPA and/or huPAR were studied. Our study suggests a critical role for COUP-TFII in human lung cancer invasion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Preparation and Transfection.
A549 cells were transfected with a pCR 3.1 expression cassette containing a 1.5-Kb mouse COUP-TFII cDNA fragment (kindly provided by Dr. Ming-Jer Tsai, Baylor College of Medicine, Houston, TX) or with the empty vector (mock). To suppress the expression of COUP-TFII, H460SM cells were transfected with a plasmid containing the COUP-TFII coding region in the antisense orientation. This plasmid was made by ligating an EcoRI-XhoI fragment corresponding to the full-length COUP-TFII cDNA into the pEGFP.C1 expression vector (Clontech, Palo Alto, CA), in the antisense orientation.
Transfections were carried out using coprecipitation with calcium phosphate (26) , and stable G418-resistant clones were isolated.
COUP-TFII Expression and Purification.
To generate a transducible TAT fusion COUP-TFII protein, we used a bacterial expression vector, pTAT-HA (27)
, which contains an NH2-terminal 6-histidine leader followed by the 11-amino acid TAT protein transduction domain and a hemagglutinin (HA) tag. The murine COUP-TFII coding region, which has >90% homology to its human analog, was inserted into the polylinker region of pTAT-HA. To facilitate the cloning, restriction sites NcoI and EcoRI were included in the 5'(GCACCATGGCAATGGTAGTCAGCACGTGGC) and 3'(GGAATTCTTATTGAATTGCCATATATGGCCAG) primers, respectively. To express a control protein, we cloned a 1.1-kb Cre cDNA sequence into XhoI-EcoR1 sites of pTAT-HA.
The pTAT-HA-COUP-TFII and pTAT-HA-Cre plasmids were used to transform Escheria coli DH5
and, after sequencing confirmation, put into E. coli BL21(DE3). The transformed E. coli BL21(DE3) were cultured as described (28)
and the fusion proteins purified under denaturing conditions (27)
. The proteins were refolded by gradually decreasing the concentration of guanidine hydrochloride (Gu-HCl) from 6 M to 0 M, by dialysis against a buffer containing 100 mM potassium phosphate (pH 6.0), 500 mM KCl, 10% glycerol, EDTA-free protease inhibitor mixture tablets (Roche), 8 mM ßmercaptoethanol, and 0.1% Tween 20, and then dialysis against PBS containing 10% glycerol, 2 mM DTT, and 50 µM 4-(2-aminoethyl) benzenesulfonylfluoride.
Transduction of Tumor Cells with Purified Proteins and Immunostaining.
To transduce the tumor cells with TAT-HA-COUP-TFII and TAT-HA-Cre, we followed the method described by Vives et al. (29)
. Cells were seeded at a concentration of 2 x 105 per 10-cm dish (for Matrigel invasion and migration assays) or 3 x 104 cells/well on coverslips (for immunostaining).
The purified proteins were dissolved in serum-free medium at a concentration of 1 nM, incubated at 37°C for 15 min, then incubated with the cells at 37°C for 24 h. The cells were then rinsed three times with PBS (pH 7.3) at room temperature and prepared for Matrigel invasion and migration assays or immunostaining. Immunostaining was performed using monoclonal anti-HA antibody (BAbCO, Richmond CA) as described (28) .
Tumor Cell Invasion, Migration, and Clonogenic Growth Assays.
Invasive and migratory ability of tumor cells was measured using the Matrigel invasion assay (30)
. The soft agar cloning assay was performed as described (31)
. Briefly, tumor cells (104) were suspended in 0.8% low melting point agarose (Difco Laboratories Inc., Detroit, MI) at room temperature, mixed with an equal volume of 2x concentrated culture medium, and plated onto an agarose bed consisting of 2% low melting point agarose and the same medium. After 12 days, colonies were stained with neutral red and those exceeding 250 µm in diameter were enumerated using an inverted microscope (Leica; DMIRB).
RNA Isolation and Northern Blot Analysis.
Total RNA was prepared using Trizol reagent (Life Technologies, Inc., Rockville, MD) according to the manufacturers protocol. RNA blots on Hybond nylon (Amersham, Oakville, Ontario, Canada) were probed with 32P-labeled 1.5 kb mouse COUP-TFII cDNA, 905-bp human GAPDH cDNA (Ambion Inc., Austin, TX), or full-length cDNA of human uPA or uPAR (provided by Dr. Shafaat A. Rabbani, The Royal Victoria Hospital, Montreal, Quebec, Canada). DNA probes were prepared by random primer extension (30)
. Relative amounts of the mRNA transcripts visualized by autoradiography were analyzed using NIH Image software and normalized to the internal GAPDH control.
Actin Filament Staining.
COUP-TFII-transfected and mock-transfected or control A549 cells were seeded on coverslips, washed twice with PBS, and fixed with 3% paraformaldehyde.
Cells were permeabilized with 0.25% Triton X-100. Actin was stained with rhodaminephalloidin for 30 min.
Focal Adhesion Kinase (FAK) Phosphorylation Analysis.
COUP-TFII-transfected and mock (vector) -transfected or control A549 cells were serum-starved for 24 h, washed twice with PBS, and collected as a single cell suspension in DMEM with or without 400 µg/ml G418 plus 0.25 mg/ml BSA. Cells were kept in suspension for 60 min at 37°C and then seeded on fibronectin-coated or noncoated culture plates. Cells were harvested as described (32)
, and the lysate was then centrifuged at 100,000 x g for 30 min at 4°C. The resulting supernatant represented the cytoplasmic fraction and was subjected to immunoprecipitation.
Immunoprecipitations.
Immunoprecipitation was performed as described (31)
. Ten µg of polyclonal rabbit anti-FAK antibodies (kindly provided by Dr. Jun-Lin Guan, Cornell University, Ithaca, NY) was added to the cytoplasmic fraction for 2 h at 4°C. Immune complexes were precipitated by incubation with protein A Sepharose beads for 60 min at 4°C. The beads were washed four times with the hypotonic buffer (31)
, resuspended in Laemmli SDS sample buffer (33)
, and boiled for 10 min. The eluted proteins were separated by electrophoresis on 8% SDS- polyacrylamide gels under reducing conditions.
Western Blot Analysis.
Proteins (30 µg) were separated by electrophoresis on 8% SDS-polyacrylamide gels and transferred onto nitrocellulose filters (Bio-Rad, Hercules, CA). The blots were incubated in TNT buffer [0.15 M NaCl (pH 7.5) containing 0.05% Tween 20 and 10 mM Tris] containing 5% skimmed milk and 2% BSA, or 3% skimmed milk (for FAK phosphorylation detection), and probed with MMP-2 antiserum or an anti-TIMP-2 antibody (Oncogene Research Products, Boston, MA). The blots were also probed with anti-FAK or anti-FAK phosphotyrosine (Tyr 397; Upstate, Lake Placid, NY) antibodies at a 1:1000 dilution. To visualize the bands, blots were incubated with horseradish peroxidase-conjugated antimouse or rabbit IgG antibodies, and detected by enhanced chemiluminescence (Amersham, Baie dUrfé, Quebec, Canada).
Gelatin and Casein Zymography.
COUP-TFII-transfected A549 cells and COUP-TFII-antisense-transfected H460SM cells, together with the control and mock-transfected cells, were incubated in serum-free medium at 37°C for 48 h. The conditioned medium was then collected, dialyzed, and concentrated by freeze-drying at 50°C. Proteins in concentrated conditioned medium (30 µg/sample) were diluted in nonreduced SDS sample buffer and separated by electrophoresis in 10% SDS-polyacrylamide gels copolymerized with 1 mg/ml of gelatin or casein (for MMP-2 or plasmin activity detection, respectively). Gels were washed with 2.5% Triton X-100 for 1 h and then twice in Tris-HCl (pH 8.0) for 15 min at room temperature. The gels were incubated with substrate buffer [50 mM Tris-HCl (pH 8.0) and 10 mM CaCl2] for 18 h at 37°C. The gels were then stained with Coomassie brilliant blue and destained until the clear bands of lysis appeared. To confirm the lytic bands, gels were treated with 20 mM EDTA (a metalloproteinase inhibitor) or 500 µg/ml amino-n-caproic acid (a plasmin inhibitor) in the substrate buffer for 18 h at 37°C.
Immunocytofluorometry.
A549 and H460SM cells were cultured in DMEM and RPMI 1640, respectively, without serum. The COUP-TFII-transfected A549 and COUP-TFII antisense-transfected H460SM cells were cultured in serum-free medium containing 400 µg/ml G418 for 24 h, dispersed, and seeded in 96-well plates (Falcon, Lincoln Park, NJ) at a density of 105 cells/well. The cells were washed three times with serum-free medium, incubated at 37°C for 30 min, and then incubated for 1 h on ice with 5 µg/ml of monoclonal antibody against huPAR (CD87; American Diagnostica Inc., Greenwich, CT). After extensive washing with cold medium, the cells were incubated with FITC-labeled goat antimouse IgG antibody (1:200) for 1 h on ice, washed, then fixed in PBS containing 1% paraformaldehyde. The labeled cells were analyzed by flow cytofluorometry using a FACScan System (BD Bioscience).
Statistics.
The two-tailed t test was used to analyze differences in the invasiveness and migration of tumor cells.
| RESULTS |
|---|
|
|
|---|
20 clones). COUP-TFII expression was higher in clone 1 than in T.P.3. (Fig. 1A)
|
20 colonies and clone 20 from a single clone) showed 5968% reduction in COUP-TFII mRNA expression compared with H460SM or mock T.P.5 (a mixture of
20 clones; Fig. 1B
To examine whether COUP-TFII expression correlates with the invasiveness of the cancer cell lines, we determined in vitro the cell invasiveness using reconstituted basement membrane (Matrigel) invasion assays. As shown in Fig. 2,A and B
, human lung cancer cell lines A549, H520, and H441 and a human breast carcinoma cell line (MDA-MB231), which do not express COUP-TFII (34)
, had poor invasive and migratory abilities. In contrast, human lung cancer cell lines NCI-H460, its highly invasive variant H460SM, H661, and HeLa cells exhibited higher levels of invasiveness (
2-, 14-, 13-, and 27-fold increases in invasiveness compared with A549, H520, H441, and MDA-MB231, respectively) and migratory ability (
7-, 16-, 14-, and 19-fold increases in migration compared with A549, H520, H441, and MDA-MB231, respectively; Fig. 2, A and B
) in agreement with their levels of COUP-TFII expression (34)
.
|
5- and 17-fold) relative to nontransfected and mock-transfected A549 cells (Fig. 2C)
To additionally confirm the role of COUP-TFII in lung cancer invasiveness, we transduced A549, H520, and H441 with purified TAT-HA-COUP-TFII and TAT-HA-Cre (as a control) fusion proteins. We also used a human breast carcinoma cell line (MDA-MB231) to represent another type of tumor cell to determine whether the effect of COUP-TFII was restricted to lung cancer. The HIV-1-derived TAT protein is used in this system to mediate cell entry of the fusion protein (35)
. Immunocytochemistry analysis was performed with an anti-HA antibody, and both fusion proteins were found in the nucleus (data not shown; Supplementary Fig. 1). We found a significant (P < 0.05) increase in the invasive and migratory ability of all of the tumor cells, A549, H520, H441, and MDA-MB231 (
5-, 22-, 18-, and 3-fold in invasion;
3-, 4-, 12-, and 2-fold in migration; Fig. 2, G and H
) transduced with the purified COUP-TFII protein, compared with controls (nontransduced or transduced with TAT-HA-Cre).
Anchorage-Independent Growth of Tumor Cells Correlates with COUP-TFII Expression.
To investigate the role of COUP-TFII in regulation of human lung cancer tumorigenicity, the clonogenicity of the cells was measured in semi-solid agarose plates. We found an increase of >100% in the size of the colonies formed by COUP-TFII-transfected A549 cells (Fig. 3, A and B)
. In agreement with this finding, we also detected an 89% reduction in the size of the colonies formed by COUP-TFII antisense-transfected H460SM cells (Fig. 3, C and D)
. For both cell types the number of colonies relative to control cells changed slightly (Fig. 3, B and D)
.
|
|
|
To determine whether antisense COUP-TFII transfection altered uPAR function in H460SM cells, we analyzed cell surface receptor huPAR expression and synthesis by Northern blotting and flow cytometry. Northern blot analysis on H460SM cells revealed a 33% or 66% reduction in the steady-state mRNA levels of huPAR in T.P.2 and clone 20 cells, respectively (Fig. 6A)
. The reduction in huPAR synthesis was additionally confirmed by immunocytofluorometry using a monoclonal antibody against huPAR (Fig. 6B)
. There was no difference in the number of the human uPAR in the COUP-TFII-transfected A549 cells using immunocytofluorometry (data not shown). We found a 1.5-fold increase in the steady-state level of huPA mRNA in T.P.3 and a
2.5-fold increase in clone 1 (Fig. 6C)
.
|
| DISCUSSION |
|---|
|
|
|---|
The increase in the anchorage-independent growth of COUP-TFII-transfected A549 cells coincided with a change in the distribution of actin filaments (36) . Interestingly, no difference was seen in the distribution of actin filaments in COUP-TFII antisense-transfected H460SM cells (data not shown). However, their morphology was altered, as they appeared as typical polygonal, rounded epithelial cells and lost the more elongated, mesenchymal appearance of the parental cells. This pattern of morphology has been observed when tumor cells are invasive and they start to invade through junctional margins by extending pseudopodia-like cytoplasmic processes (38) .
The changes observed in the actin filaments or the morphology of the cell prompted us to examine the phosphorylation of p125-FAK. Activation of FAK, overexpressed in several human cancers, induces survival, proliferation, and motility of cells in culture (32) . In our study, FAK phosphorylation of Tyr397 in COUP-TFII-transfected A549 cells was increased, mainly in cells grown on fibronectin-coated plates. It is conceivable that, after integrin-mediated cell adhesion (there is similar levels of integrin ß1 production in both COUP-TFII-transfected and nontransfected A549 cells; data not shown), FAK undergoes tyrosine phosphorylation that eventually leads to cytoskeletal disorganization. Whether distinct effector proteins (such as Rho GTPases) are involved in the reorganization of stress fibers in COUP-TFII-transfected cells is our future work.
The functional importance of FAK activation in human tumor growth in vivo has been elucidated to be dependent on uPAR-integrin ß1 association (39) . Also, binding of the uPA to its receptor (uPAR) is involved in the activation of MMP-2 (20) . The importance of tumor-associated proteases in invasion and metastasis has been demonstrated for a variety of solid malignant tumors (40) . Therefore, we examined changes in tumor-associated proteases in COUP-TFII-transfected cells. The increase in activity and production of MMP-2 in COUP-TFII-transfected A549 cells encouraged us to investigate whether non-MMP proteinases were involved in the activation of MMP-2. There is compelling evidence to indicate that cell migration and invasion depend on the coordinated enzymatic activities of metallo- and serine proteinases (40) . The mechanism of pro-MMP-2 activation has been described in association with the uPA-plasmin cascade, whereby uPA binds uPAR, leading to the conversion of plasminogen to plasmin (41) . The appearance of plasmin in the conditioned medium suggests that plasminogen/plasmin conversion can still occur on the surface of the cells, but the enzyme may be rapidly released (42) . Alternatively, it is possible that plasminogen activation occurs in the conditioned medium after it is released from the cell surface (43) . It should be noted that uPAR and the uPA/uPAR complex have also been identified as receptors for the ECM protein vitronectin (44) , whereas plasmin can mediate cell detachment from the ECM (45) . Changes in extracellular plasmin levels could be the result of changes in huPAR expression and plasminogen/plasmin conversion. We noticed a decrease in both the expression and synthesis of huPAR after transfection of H460SM cells with COUP-TFII antisense. Although the number of huPAR receptors in A549 cells is low, the high level of huPA expression in the COUP-TFII-transfected A549 cells may be involved in the regulation of factors downstream of the uPA/uPAR complex, leading to the elevated expression of plasmin (which, in turn, can activate MMP-2).
FAK is associated with integrin ß1 regardless of its state of activation, but only in the presence of high levels of uPAR is integrin ß1-associated FAK phosphorylated (39) . It is conceivable that a high level of uPA/uPAR complex on the cell surface clusters integrins and that ligand-induced conformational change increases the proximity between FAK molecules leading to their trans-phosphorylation (46) . Other reports also show that uPAR blocking can down-regulate the signaling pathway mediated by integrin and induce cancer dormancy in vivo (47) . On the basis of the results of our study, we propose that the regulation of huPA/huPAR expression by COUP-TFII promotes the association of uPA/uPAR complex with integrin ß1, leading to FAK phosphorylation as well as MMP-2 synthesis and activation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Note: Supplementary data for this article can be found at Cancer Research Online (http://cancerres.aacrjournals.org).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Jim Hu, Lung Biology Research Program, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, Canada M5G 1X8. Phone: (416) 813-6412; Fax: (416) 813-5771; E-mail: jhu{at}sickkids.on.ca
Received 4/29/03. Revised 5/ 4/04. Accepted 6/ 2/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
O. Gautschi, C. G. Tepper, P. R. Purnell, Y. Izumiya, C. P. Evans, T. P. Green, P. Y. Desprez, P. N. Lara, D. R. Gandara, P. C. Mack, et al. Regulation of Id1 Expression by Src: Implications for Targeting of the Bone Morphogenetic Protein Pathway in Cancer Cancer Res., April 1, 2008; 68(7): 2250 - 2258. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Riggs, N. S. Wickramasinghe, R. K. Cochrum, M. B. Watts, and C. M. Klinge Decreased Chicken Ovalbumin Upstream Promoter Transcription Factor II Expression in Tamoxifen-Resistant Breast Cancer Cells. Cancer Res., October 15, 2006; 66(20): 10188 - 10198. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hamik, B. Wang, and M. K. Jain Transcriptional Regulators of Angiogenesis Arterioscler. Thromb. Vasc. Biol., September 1, 2006; 26(9): 1936 - 1947. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |