Cancer Research SABCS  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kubo, T.
Right arrow Articles by Yoshikawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kubo, T.
Right arrow Articles by Yoshikawa, H.
[Cancer Research 64, 5172-5177, August 1, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Apoptotic Speck Protein-Like, a Highly Homologous Protein to Apoptotic Speck Protein in the Pyrin Domain, Is Silenced by DNA Methylation and Induces Apoptosis in Human Hepatocellular Carcinoma

Takahiko Kubo1, Junji Yamamoto2, Yuko Shikauchi1, Yasuharu Niwa1, Kenichi Matsubara3 and Hirohide Yoshikawa1

Departments of 1 Epigenetic Carcinogenesis and 2 Surgery, The Cancer Institute, Japanese Foundation for Cancer Research, Tokyo, Japan; and 3 DNA Chip Research, Inc., Kanagawa, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have identified a novel gene encoding a pyrin domain protein of 89 amino acids that is expressed in various tissues including liver, brain, and spleen. The protein is highly homologous to the pyrin domain of apoptosis-associated speck-like protein (ASC). Therefore, we termed it ASC-like (ASCL). We found that ASCL gene was densely and frequently (80%) methylated in hepatocellular carcinoma (HCC) cell lines. In contrast, normal liver samples did not show any significant methylation. This aberrant methylation correlated well with the suppression of RNA expression. Furthermore, a demethylating agent, 5-aza-2'-deoxycytidine, reactivated the ASCL expression in the methylation-silenced cells, indicating that ASCL is silenced by the associated DNA methylation. ASCL methylation was also found in primary HCC (4 of 17 samples), although the frequency was less than that in cell lines. In addition, we found that ASC was also methylated in primary samples (6 of the 17). Interestingly, either ASCL or ASC methylation was observed in 53% (9 of the 17) of primary HCC samples. Significantly, the restoration of ASCL in the methylation-silenced cells demonstrated growth suppression in colony formation assay. This growth suppression effect of ASCL was supported by apoptotic changes observed in ASCL-transfected cells in which annexin-V binding was positive and caspase-3 was activated. Based on the methylation-silencing and the growth suppression activity, we propose that ASCL plays a significant role in the development of HCC.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pyrin domain (also known as PAAD or DAPIN) is thought to be a member of death domain-fold superfamily including the death domain, death-effector domain, and caspase recruitment domain (CARD). Proteins with these domains are known to be involved in apoptotic or inflammatory pathways (1) . ASC, a member of the pyrin domain protein family, forms a speck-like aggregate under an apoptotic situation (2) . ASC has a CARD domain at the COOH terminus in addition to the pyrin domain and has been shown to activate procaspase-1 through the CARD-CARD interaction (3) . Thus, ASC functions in an inflammatory signaling. It has been reported that ASC, also referred as target of methylation-induced silencing (TMS1), was methylation-silenced in breast cancer and demonstrated growth suppression activity (4) . In addition, ASC bound to Bax with its pyrin domain and recruited it to mitochondria, resulting in cytochrome c release and activation of caspases (5) . These data suggest that ASC plays a crucial role in oncogenesis as well as in immunological reaction. We have isolated a NotI restriction fragment, termed spot 14 that has been found by restriction landmark genomic scanning (RLGS) analyses of human HCC (6, 7, 8) . We identified a novel gene from the analysis of spot 14. The gene product, we termed ASC-like (ASCL), consists of a pyrin domain, which is highly similar to that of ASC. We further analyzed expression, DNA methylation, and functional characteristics of ASCL in HCC.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissue Samples.
Human HCC cell lines Hep3B, HT17, and Li-7 were obtained from the cell resource center for Biomedical Research Institute of Development, Aging, and Cancer, Tohoku University. FLC4 (9) was a gift from Dr. Seishi Nagamori. HuH1, HuH4, and HuH7 were obtained from the Japanese Culture Collection. HuH2, PLC/PRF/5, and Kim1 were gifts from the Department of Pathology, The Cancer Institute, Japanese Foundation for Cancer Research. Primary HCC samples and adjacent normal liver tissues were resected from patients who provided informed consent for the use of the specimens at The Cancer Institute Hospital, Japanese Foundation for Cancer Research.

Northern Blot Analysis.
Northern blot analysis using 2.0 µg of polyadenylated RNA from human spleen, brain, liver, and placenta (BD Biosciences) was carried out essentially as described previously (10) . ASCL full-length cDNA was used for probing.

Methylation-Specific PCR (MSP) Analysis.
Bisulfite modification of genomic DNA was performed as described previously (11) . The methylation-specific primer sequences for ASCL were GATGCGTTTAAAGTTTTCGCGTAGC [nucleotides (nt) 181,283–181,307 in AC009088.6] and AAAACTAAACCATAAAAACGAAACGCG (nt 181,410–181,384). The unmethylation-specific primer sequences were GGGATGTGTTTAAAGTTTTTGTGTAGT (nt 181,281–181,307) and ACAAAACTAAACCATAAAAACAAAACACA (nt 181,412–181,384). The primers and conditions for ASC amplification were described by Conway et al. (4) .

Bisulfite Sequencing Analysis.
The CpG-rich region of ASCL gene (nt 181,051–181,457 in AC009088.6) was amplified from the bisulfite-treated DNA using the following primer set, AAAACGACAACTCCACCTACTA (forward) and TGAAGGAGGGGAATAGGAAGGTTT (reverse). The PCR products were cloned, and randomly selected eight clones for each sample were sequenced.

Reverse Transcription-PCR Analysis.
Total RNA of HCC cell lines was prepared using RNeasy Mini Kit (Qiagen), and a normal liver total RNA (Ambion) was obtained from Ambion. cDNA was generated by reverse transcription of 3 µg of total RNA using Superscript Preamplification System (Invitrogen). The primer sequences for ASCL amplification were AAGAAGTTCAAGATGAAGCTG [nt 126–146 in ZD54H05 (AF086332)] and GTCCCCGAGGTGGAGACACT (nt 432–451). For the reactivation study, RNA from cells treated with 1 µM 5-aza-2'-deoxycytidine for 4 days was used. For ASC analysis, the primers and the condition for amplification were described by Conway et al. (4) .

Construction of Expression Vectors.
A full-length ASCL cDNA was isolated from human liver RNA (BD Biosciences) by PCR with the primer set (AGCCATGGGAACGAAGCGCGA and TCACAGGCGTTGCATTACTC) and inserted into pcDNA3.1/HisC vector (Invitrogen). ASC cDNA was amplified by reverse transcription-PCR with primers GGCCGGGGATCCTGGAGCCAT and GAAGGAGCCTCAGCTCCGCT and inserted into a modified pcDNA3.1 vector in which the Xpress-tag was replaced by the Hemagglutinin-tag.

Colony Formation Assay.
Cells were transfected with ASCL expression or backbone plasmid as described previously (12) and selected with 1 mg/ml of G418 for 4 weeks.

Apoptosis Assays.
To detect apoptotic cells, annexin-V-Cy3 apoptosis detection kit (MBL) was used. Transfected cells were incubated with a solution containing Cy3 labeled annexin-V and washed with the binding buffer to remove unbound annexin-V. The cells were fixed with 2% paraformaldehyde, permeabilized with 0.1% Triton X-100, incubated with anti-Xpress antibody (Invitrogen), and subsequently incubated with FITC-labeled secondary antibody (Jackson Immunoresearch). The cells were mounted in a medium containing 4',6-diamidino-2-phenylindole (Vector Laboratories) and visualized using a confocal microscopy. Western blot analysis was carried out as described previously (12) . Anti-caspase-3 and ß-actin antibodies were obtained from Santa Cruz Biotechnology and Sigma, respectively.

Immunofluorescence Analysis.
Transfected cells were fixed with 3% paraformaldehyde and permeabilized with 0.1% Triton X-100. Mouse anti-Xpress (Invitrogen) and rabbit anti-HA (Santa Cruz Biotechnology, Inc.) antibodies were used to detect Xpress-tagged ASCL and HA-tagged ASC, respectively. The cells were incubated with Cy3 or FITC-labeled secondary antibody (Jackson Immunoresearch), stained with 4',6-diamidino-2-phenylindole, and visualized using a confocal microscopy. For the analysis of speck-positive cells or multinucleated cells, a total of 200 cells expressing ASCL or/and ASC were monitored.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of ASCL.
We cloned a NotI restriction fragment from spot 14 whose aberration incidence was 27% in the RLGS analyses of HCC (6, 7, 8) . BLAST search revealed that a cDNA clone, ZD54H05 (GenBank accession no. AF086332), was located in the CpG-rich region containing the NotI site (Fig. 1A)Citation . Consistent with the length of cDNA sequence (556 bp), Northern blot analysis showed a single transcript of approximately 0.5 kb in length (Fig. 1B)Citation . This RNA expression was detected in liver, spleen, and brain, but not in placenta. The cDNA sequence contains an open reading frame and an in-frame stop codon at the 5' position to the open reading frame (data not shown). Therefore, we concluded that ZD54H05 contains the full-length transcript that encodes a protein of 89 amino acids. By comparing the cDNA with a genomic sequence, we found that the full-length transcript is composed of two exons and the coding region lies only in the first exon. We also found that the protein is similar to the pyrin domain of ASC. Thus, we termed the new protein ASCL. These two proteins are 64% identical and 84% similar in the pyrin domain (Fig. 1C)Citation . Although ASCL is composed only of the pyrin domain, ASC contains an additional CARD domain (Fig. 1D)Citation . Interestingly, ASCL was located only 13 kb away from ASC in chromosome 16.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Schematic representation of the ASCL gene. A, structure of the ASCL gene. The top line is from the genomic sequence (GenBank accession no. AC009088). The boxes are the exons of ASCL, and the coding region is indicated as the black box. The NotI site that we identified from the RLGS analysis is located approximately 1 kb downstream from the ASCL exon 2. CpG sequences are shown as bars in the middle box. The entire ASCL gene and the NotI site are within a CpG-rich region composed of two contiguous CpG islands with only a 100-bp gap. The arrowheads represent primer sets used for reverse transcription-PCR and MSP. B, expression of the ASCL gene in various tissues. Northern blot of polyadenylated RNA from normal tissues was hybridized with the ASCL-specific probe. An approximately 0.5-kb band was detected. The ß-actin probe was used as a standard. C, amino acid sequence of ASCL and the alignment with the pyrin domain (PYD) of ASC. ASCL is composed of 89 amino acids that are similar to the pyrin domain of ASC. * and : indicate positions where ASCL and ASC have identical and similar residues, respectively. D, domain structures of ASCL and ASC. ASCL is composed only of a pyrin domain (PYD), whereas ASC is of a pyrin and a CARD domains. E, methylation silencing of ASCL in HCC. Ten HCC and a nontumorous liver samples were analyzed by MSP using primers designed around the translation start site. Visible bands in M Lanes are methylated 130-bp DNA products with methylation-specific primers, and those in U Lanes are unmethylated 134-bp DNA products with unmethylation-specific primers. F, bisulfite sequencing analysis of ASCL. The translation start site is indicated as 0. Methylation status of 39 CpG sites in the genomic region from –58 through 348 was investigated in two HCC cell lines (HuH2 and Li-7) and two nontumorous liver samples. Eight individual clones were sequenced for each sample. {bullet} and {circ}, methylation and unmethylation, respectively. Position of the MSP primers was also indicated. G, reverse transcription-PCR of HCC cell lines. Total RNA samples from 10 HCC cell lines and a normal liver were analyzed by reverse transcription-PCR with ASCL-specific primers. The amplified products were 328 bp in length (top panel). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification verified the consistency of the reverse transcription-PCR (bottom panel). H, reactivation by a methylation inhibitor. Three methylated cell lines (HuH2, Li-7, and Hep3B) were treated with or without 5-aza-2'-deoxycytidine (5Aza-dC), and ASCL expression was analyzed by the reverse transcription-PCR. I, MSP of primary HCC samples. Methylation of ASCL was analyzed in 17 primary HCC samples by MSP. Six samples were paired (tumor/nontumor). In 11 residual samples, only tumor was examined. C, tumor sample; N, its nontumorous counterpart. Lane 18 is a positive control for methylated DNA. Four samples (3, 14, 15, and 17) showed aberrant methylation.

 
ASCL Methylation and Expression Silencing in HCC Cell Lines.
We analyzed the methylation of ASCL by MSP. Among 10 HCC cell lines, 8 (HuH1, HuH2, HuH4, Li-7, Hep3B, HT17, Kim1, and FLC4) were methylated (Fig. 1E)Citation . In contrast, a normal liver sample was not. All of the methylated cell lines except Hep3B showed full methylation. Fine methylation mapping by bisulfite DNA sequencing revealed that HuH2 and Li-7 were almost completely methylated at the 39 CpG sites, but the nontumorous livers showed unmethylation in general (Fig. 1F)Citation . These results indicate that ASCL gene is frequently and densely methylated in HCC. We next examined ASCL expression in the HCC cell lines. The unmethylated cell lines (HuH7 and PLC/PRF/5) and a normal liver showed ASCL expression. In contrast, methylated cell lines failed to show it (Fig. 1G)Citation . Lack of ASCL expression was well correlated with ASCL methylation. To confirm methylation-silencing of ASCL, we used a methylation inhibitor, 5-aza-2'-deoxycytidine, and found reactivation of ASCL in all of the three HCC cell lines examined (Fig. 1H)Citation . The partially methylated Hep3B also showed the reactivation. These findings indicate that suppression of ASCL expression is associated with aberrant methylation in the CpG island. In primary HCC samples, the MSP analysis showed aberrant methylation in 4 of 17 tumor samples (23.5%), whereas no methylation was detected in all of the nontumorous liver samples examined (Fig. 1I)Citation .

Growth Suppression by ASCL.
We performed colony formation assay to examine the effect of ASCL overexpression on cell growth. We used HuH2 cells with methylation-silenced ASCL and found that ASCL drastically suppressed growth compared with the control (Fig. 2A)Citation . The growth suppression was also detected in Li-7 cells (data not shown). In the transient transfection, ASCL-expressing cells demonstrated the binding of annexin-V and condensed nuclei (Fig. 2B)Citation . In addition, ASCL overexpression resulted in a cleavage of procaspase-3 (Fig. 2C)Citation , and this activation of caspase-3 was blocked when the cells were incubated with a general caspase inhibitor, Z-VAD-FMK. These findings support that ASCL has growth suppression activity.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Growth suppression by ASCL. A, colony formation assay. Methylation-silenced cells (HuH2) were transfected with either the ASCL expression vector or the backbone vector and selected for 4 weeks with G418. B, apoptosis by ASCL. ASCL methylation-silenced cells were transiently transfected with the ASCL expression vector. a, ASCL expression was detected by immunostaining using an antibody against the tag and the FITC-labeled secondary antibody. b, apoptotic cells were visualized by the Cy3-labeled annexin-V. c, merged image of a and b. d, nuclei were stained with 4',6-diamidino-2-phenylindole. C, activation of caspase-3 by ASCL. HuH2 cells were transiently transfected with the ASCL expression vector or the backbone vector and incubated with or without a pan-caspase inhibitor, Z-VAD-FMK. Cell lysates were subjected to SDS-PAGE and immunobloted with indicated antibodies. Anti-caspase-3 immunoblotting showed the cleaved caspase-3 (Mr 20,000).

 
DNA Methylation and Expression Silencing of ASC in HCC.
ASCL and ASC are closely related in genomic orientation and highly homologous pyrin domains. Thus, we analyzed DNA methylation and expression of ASC in HCC. Among the 10 HCC cell lines, seven (HuH2, HuH4, HuH7, Li-7, PLC/PRF/5, Kim1, and FLC4) were methylated (Fig. 3A)Citation . In contrast, no methylation was detected in the residual three cell lines as well as the normal liver sample. The expression analysis demonstrated that fully methylated cell lines (HuH2, PLC/PRF/5, and FLC4) failed to show the expression (Fig. 3B)Citation , indicating that ASC is silenced in association with DNA methylation in these cell lines. ASC expression was detected in partially methylated cell lines, possibly because unmethylated allele was active. These results are consistent with the data in breast cancer cell lines (4) . In primary HCC, 6 of the 17 samples (35.3%) showed ASC methylation, whereas nontumorous liver samples did not (Fig. 3C)Citation .



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Methylation-silencing of ASC in HCC. A, MSP analysis of HCC cell lines. Ten HCC and a normal liver that were the same samples used in Fig. 1ECitation were analyzed by MSP. Visible bands in M Lanes are methylated 191-bp DNA products with methylation-specific primers, and those in U Lanes are unmethylated 196-bp DNA products with unmethylation-specific primers. B, reverse transcription-PCR of HCC cell lines. Ten HCC cell lines and a normal liver that were the same samples used in Fig. 1GCitation were analyzed by reverse transcription-PCR with the ASC-specific primers. The amplified ASC products were 411 bp in length. C, MSP of primary HCC samples. Methylation of ASC was analyzed in the 17 primary HCC samples that were the same samples used in Fig. 1ICitation . C, primary HCC sample; N, its nontumorous counterpart. Lane 18 is a positive control for methylated DNA. Six samples (6, 11, 12, 13, 16, and 17) showed aberrant methylation.

 
Immunocytological Characters of ASCL.
ASCL showed small speck-like staining in 30% of the expressing cells when transfected in HuH2 cells (Fig. 4A)Citation . These small specks were distributed in the nuclei and cytosol. Consistent with the character in HL60 and HeLa cells (2 , 13 , 14) , we observed that ASC formed a speck in cytosol of the transfected HuH2 cells (Fig. 4B)Citation . When ASCL was coexpressed with ASC, the large ASC-specific speck appeared in cytosol, and ASCL colocalized with ASC in the speck (Fig. 4C)Citation . Interestingly, the frequency of cells with ASC-specific specks was similar between transfection of ASC alone (18%) and cotransfection of ASC and ASCL (17%). We also found that multinucleated cells increased in either ASCL- or ASC-transfected cells (Fig. 4, D and E)Citation . The frequencies of multinucleated cells were 12, 5, and 1% in ASCL, ASC, and control vector transfections, respectively. Although the formations of specks and multinucleated cells were commonly observed in ASCL- and ASC-transfected cells, we found some differences between ASCL and ASC. The speck of ASC was usually only one/cell (2 , 13 , 14) , however, that of ASCL was many in a cell and smaller in size (Fig. 4, A and B)Citation . ASCL and ASC demonstrated different subcellular localization patterns when they distributed homogenously in the cells. In some cells, ASCL localized in both the nucleus and cytosol (Fig. 4F, a)Citation , whereas in other cells, it localized either in the nucleus (Fig. 4F, b)Citation or cytosol (Fig. 4F, c)Citation . In contrast, ASC did not show such movement and was found both in cytosol and nucleus (Fig. 4G)Citation . These findings imply that ASCL shares a similar function with ASC in one part and also plays a different role from ASC in another part.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Immunofluorescence analysis of ASCL and ASC. A, ASCL formed dozens of small specks in the ASCL-transfected cell. B, ASC formed a single large speck in each ASC-transfected cell. C, colocalization of ASCL with ASC. Cells were transiently cotransfected with the ASCL and ASC expression vectors. ASCL (red) colocalized with ASC (green) in the speck (yellow dot in merged image). Note that the transfected cell in the bottom panel is apoptotic with the condensed nucleus (blue). A multinucleated cell (green) by ASCL (D) or ASC (E) transfection. F, various subcellular distribution patterns of ASCL. ASCL (red) localized in both nucleus and cytosol (a), only in nucleus (b), and only in cytosol (c). G, ASC (green) distributed in both the nucleus and cytosol.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The RLGS analyses of genomic DNA in which methylation changes were monitored at NotI sites have been successful in isolating genes affected by DNA methylation (10 , 12) . In fact, a tumor suppressor gene, SOCS-1, that was found in the RLGS analyses was shown to be silenced by the associated DNA methylation in HCC. In the successive search for methylation-silenced genes in HCC, we have isolated a new gene that encodes a pyrin domain protein. The transcript is approximately 0.5 kb in length and is expressed in normal tissues including liver, brain, and spleen. We termed the gene ASCL, because the gene product shares high similarity with the pyrin domain of ASC. We analyzed methylation of ASCL by MSP and found that 8 of 10 HCC cell lines were aberrantly methylated. Bisulfite DNA sequencing analysis demonstrated that the 5' noncoding region and exon 1 were markedly hypermethylated in HCC, although no significant methylation was found in normal samples. Taken together, ASCL is densely and frequently methylated in HCC cell lines. Reverse transcription-PCR analysis showed that ASCL expression was undetectable in 8 of the 10 HCC cell lines. Significantly, ASCL methylation and the suppression of expression were tightly correlated. Furthermore, the expression was reactivated by the treatment with 5-aza-2'-deoxycytidine. These results indicate that ASCL is silenced by DNA methylation in HCC. In primary HCC, ASCL was methylated in 23.5% of samples, although the methylation was observed in 80% of cell lines. The discrepancy between cell lines and primary samples may be explained by a progression of methylation in cultured cells (15) . Nevertheless, ASCL was methylated in some primary samples, indicating that the ASCL-silencing is significant in cancer.

ASCL-transfected cells demonstrated reduced growth in colony formation assay, annexin-V binding, and caspase-3 activation. These results indicate that ASCL possesses growth suppression activity. Recently, the pyrin domain of ASC, but not the CARD domain, was reported to physically interact with caspase-8 (16) . In addition, a mutant ASC in the pyrin domain failed to induce apoptosis, although another mutant in the CARD domain could induce apoptosis. It was also reported that ASC bound to Bax with its pyrin domain and induced translocation of Bax to mitochondria, triggering activation of caspases (5) . These reports strongly suggest that a pyrin domain is critically involved in oncogenesis. Interestingly, ASCL suppressed growth of HuH2 cells lacking both ASCL and ASC, suggesting that ASCL is able to function without ASC at least in part. However, currently, the mechanism in which ASCL is involved in growth suppression is not known. Isolation of interacting proteins with ASCL is now under way to elucidate the precise functions of ASCL. We also analyzed DNA methylation of ASC. ASC was less frequently methylation-silenced than ASCL in HCC cell lines. Together with ASCL and ASC analyses, either of the genes was silenced in 9 of the 10 HCC cell lines. In primary HCC, ASCL was aberrantly methylated in 4 of the 17 samples (23.5%), and ASC was in 6 of the 17 samples (35.3%). Nine of the 17 samples (52.9%) were methylated in either ASCL or ASC. Because either ASCL or ASC is methylated in most HCC cell lines and in one-half of the primary samples, loss of the pyrin domain protein seems to be significant in acquiring growth advantage not only in transformed cells, but also in primary cancer. Two cell lines (HuH2 and FLC4) and one primary sample (sample 17) were hypermethylated in both ASCL and ASC. The concomitant hypermethylation may have a profound effect on cell growth because both p15 and p16 were methylated in pediatric T-precursor ALL and Burkitt’s lymphoma (17) . Immunofluorescence analysis showed some similarities between ASCL and ASC. ASC is well known to form a speck in cytosol (2 , 13) , and ASCL also can form small speck-like granules. In addition, both ASCL and ASC individually increased multinucleated cells. Interestingly, ASCL and ASC colocalized in ASC-specific speck when coexpressed. However, there are some different characters between ASCL and ASC. ASC-specific speck is large and only one per cell, but that of ASCL is smaller and many in a cell. Furthermore, ASCL showed various subcellular distribution patterns, whereas ASC either formed a speck in cytosol or distributed throughout a cell. These findings may come from the molecular similarity and the difference between ASCL and ASC. In fact, ASCL shares high similarity with the pyrin domain of ASC, however, ASC contains an additional CARD domain. During the preparation of this manuscript, POP1/ASC2, which is the protein identical to ASCL, was reported as a modulator of ASC-mediated nuclear factor {kappa}B and procaspase-1 activations (18) . Although ASCL seems to be involved in inflammatory pathways, it is particularly interesting that the pyrin domain protein, ASCL, was methylation-silenced and exhibited growth suppression activity in HCC. Additional studies are awaited to elucidate detailed functions of ASCL in oncogenesis. In conclusion, we cloned ASCL based on the RLGS analyses and identified the silencing by DNA methylation in HCC. We revealed that ASCL has growth suppression activity, and we further suggest that ASCL is able to function without ASC. Thus, the methylation silencing of ASCL sheds light on the roles of pyrin domain proteins in oncogenesis.


    ACKNOWLEDGMENTS
 
We thank Drs. Tomoyuki Kitagwa and Seishi Nagamori for providing cell lines.


    FOOTNOTES
 
Grant support: Grant-in-Aid for Scientific Research (S) from Japan Society for the Promotion of Science.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Hirohide Yoshikawa, Department of Epigenetic Carcinogenesis, The Cancer Institute, Japanese Foundation for Cancer Research, 1-37-1 Kami-Ikebukuro, Toshima-ku, Tokyo 170-8455, Japan; Phone: 81-3-5394-3880; Fax: 81-3-5394-3816; E-mail: hirohide.yoshikawa{at}jfcr.or.jp

Received 10/22/03. Revised 5/ 1/04. Accepted 5/26/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fairbrother WJ, Gordon NC, Humke EW, et al The PYRIN domain: a member of the death domain-fold superfamily. Protein Sci, 10: 1911-8, 2001.[CrossRef][Medline]
  2. Masumoto J, Taniguchi S, Ayukawa K, et al ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia HL-60 cells. J Biol Chem, 274: 33835-8, 1999.[Abstract/Free Full Text]
  3. Srinivasula SM, Poyet JL, Razmara M, et al The PYRIN-CARD protein ASC is an activating adaptor for caspase-1. J Biol Chem, 277: 21119-22, 2002.[Abstract/Free Full Text]
  4. Conway KE, McConnell BB, Bowring CE, Donald CD, Warren ST, Vertino PM TMS1, a novel proapoptotic caspase recruitment domain protein, is a target of methylation-induced gene silencing in human breast cancers. Cancer Res, 60: 6236-42, 2000.[Abstract/Free Full Text]
  5. Ohtsuka T, Ryu H, Minamishima YA, et al ASC is a Bax adaptor and regulates the p53-Bax mitochondrial apoptosis pathway. Nat Cell Biol, 6: 121-8, 2004.[CrossRef][Medline]
  6. Nagai H, Ponglikitmongkol M, Mita E, et al Aberration of genomic DNA in association with human hepatocellular carcinomas detected by 2-dimensional gel analysis. Cancer Res, 54: 1545-50, 1994.[Abstract/Free Full Text]
  7. Yoshikawa H, de la Monte S, Nagai H, Wands JR, Matsubara K, Fujiyama A Chromosomal assignment of human genomic NotI restriction fragments in a two-dimensional electrophoresis profile. Genomics, 31: 28-35, 1996.[CrossRef][Medline]
  8. Yoshikawa H, Nagai H, Oh KS, et al Chromosome assignment of aberrant NotI restriction DNA fragments in primary hepatocellular carcinoma. Gene, 197: 129-35, 1997.[CrossRef][Medline]
  9. Nagamori S, Hasumura S, Matsuura T, Aizaki H, Kawada M Developments in bioartificial liver research: concepts, performance, and applications. J Gastroenterol, 35: 493-503, 2000.[CrossRef][Medline]
  10. Yoshikawa H, Fujiyama A, Nakai K, Inazawa J, Matsubara K Detection and isolation of a novel human gene located on Xp11.2-p11.4 that escapes X-inactivation using a two-dimensional DNA mapping method. Genomics, 49: 237-46, 1998.[CrossRef][Medline]
  11. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA, 93: 9821-6, 1996.[Abstract/Free Full Text]
  12. Yoshikawa H, Matsubara K, Qian GS, et al SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat Genet, 28: 29-35, 2001.[CrossRef][Medline]
  13. McConnell BB, Vertino PM Activation of a caspase-9-mediated apoptotic pathway by subcellular redistribution of the novel caspase recruitment domain protein TMS1. Cancer Res, 60: 6243-7, 2000.[Medline]
  14. Richards N, Schaner P, Diaz A, et al Interaction between pyrin and the apoptotic speck protein (ASC) modulates ASC-induced apoptosis. J Biol Chem, 276: 39320-9, 2001.[Abstract/Free Full Text]
  15. Smiraglia DJ, Rush LJ, Fruhwald MC, et al Excessive CpG island hypermethylation in cancer cell lines versus primary human malignancies. Hum Mol Genet, 10: 1413-9, 2001.[Abstract/Free Full Text]
  16. Masumoto J, Dowds TA, Schaner P, et al ASC is an activating adaptor for NF-{kappa} B and caspase-8-dependent apoptosis. Biochem Biophys Res Commun, 303: 69-73, 2003.[CrossRef][Medline]
  17. Herman JG, Civin CI, Issa JP, Collector MI, Sharkis SJ, Baylin SB Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies. Cancer Res, 57: 837-41, 1997.[Abstract/Free Full Text]
  18. Stehlik C, Krajewska M, Welsh K, Krajewski S, Godzik A, Reed JC The PAAD/PYRIN-only protein POP1/ASC2 is a modulator of ASC-mediated nuclear-factor-{kappa} B and pro-caspase-1 regulation. Biochem J, 373: 101-13, 2003.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
Y. Shikauchi, A. Saiura, T. Kubo, Y. Niwa, J. Yamamoto, Y. Murase, and H. Yoshikawa
SALL3 Interacts with DNMT3A and Shows the Ability To Inhibit CpG Island Methylation in Hepatocellular Carcinoma
Mol. Cell. Biol., April 1, 2009; 29(7): 1944 - 1958.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kubo, T.
Right arrow Articles by Yoshikawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kubo, T.
Right arrow Articles by Yoshikawa, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online