Cancer Research Meeting Calendar  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuierer, M. M.
Right arrow Articles by Bosserhoff, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuierer, M. M.
Right arrow Articles by Bosserhoff, A.-K.
[Cancer Research 64, 5186-5192, August 1, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Reduction in Raf Kinase Inhibitor Protein Expression Is Associated with Increased Ras-Extracellular Signal-Regulated Kinase Signaling in Melanoma Cell Lines

Marion M. Schuierer1, Frauke Bataille1, Suzanne Hagan2, Walter Kolch2,3 and Anja-Katrin Bosserhoff1

1 Institute of Pathology, Medical School of the University of Regensburg, Regensburg, Germany; 2 Beatson Institute for Cancer Research, Cancer Research Campaign Beatson Laboratories, Bearsden, Glasgow, United Kingdom; and 3 Sir Henry Wellcome Functional Genomics Facility, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow, United Kingdom


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutations in the Raf signaling pathway are known to play a pivotal role in the progression of malignant melanoma. In this study, we provide evidence that the Raf-1 kinase inhibitory protein (RKIP) and its effects on Raf-1-mediated activation of mitogen-activated protein/extracellular signal-regulated kinase kinase are important for the metastatic potential of malignant melanoma. Screening nine melanoma cell lines at mRNA and protein levels, we detected significant down-regulation of RKIP expression in comparison with normal melanocytes. Loss of RKIP expression in transformed cells in vivo was confirmed in immunohistochemical analyses demonstrating reduction of RKIP expression already in primary melanoma and even stronger down-regulation or complete loss in melanoma metastases. Stable transfection of the melanoma cell line Mel Im with an RKIP expression plasmid blocked the Raf kinase pathway, resulting in down-regulation of extracellular signal-regulated kinase 1/2 and activator protein 1 activity. In very good agreement with the in vivo finding that down-regulation of RKIP expression is most obvious in melanoma metastasis, overexpression of RKIP in the highly invasive Mel Im cell line leads to a significant inhibition of invasiveness in vitro. Taken together, our results suggest that loss of RKIP in malignant melanoma contributes to enhanced invasiveness of transformed cells and therefore to progression of the disease.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Ras/Raf-1/mitogen-activated protein/extracellular signal-regulated kinase kinase (MEK)/extracellular signal-regulated kinase (ERK) pathway is a highly conserved signaling cascade that regulates multiple biological processes, including mitogenesis and differentiation (1 , 2) . Many different growth factor receptors are able to activate the small G protein Ras, which as a consequence binds the Raf-1 kinase and thereby recruits Raf-1 to the inner surface of the cell membrane. After its activation, Raf-1 phosphorylates and activates the mitogen-activated protein kinase kinase, MEK, which in turn phosphorylates and activates the mitogen-activated protein kinase, ERK. Phosphorylated ERK is able to translocate into the nucleus and regulate gene expression via activation of various transcription factors (3 , 4) .

It has been shown that the Ras signaling pathway is constitutively active in a great number of malignant melanomas (5) . Recently, it was shown that mutations primarily occur in the BRCA2-associated factor (BRAF) gene (6 , 7) . Indeed, Pollock et al. (7) observed mutations in the BRAF gene not only in samples of malignant melanoma, but also in nevi, suggesting that the BRAF mutation is an early but not sufficient event in malignant melanocyte transformation. Other molecules that regulate the Ras pathway are expected to play important roles in the control of this signaling cascade.

One inhibitory molecule that down-regulates the effects of the Ras/Raf/MEK/ERK signaling pathway is the Raf kinase inhibitor protein (RKIP). RKIP directly interacts with Raf-1 and MEK. It dissipates the Raf-1/MEK interaction, thereby preventing the activation of MEK by Raf-1 and downstream signal transduction (8 , 9) . Interestingly, RKIP was found to be a member of the phosphatidylethanolamine-binding protein family, a ubiquitously expressed and evolutionarily conserved group of proteins (10) .

The aim of this study was to analyze the role of RKIP in malignant melanoma. RKIP expression has recently been shown to be down-regulated in metastatic prostate cancers, and the loss of RKIP levels was suggested to promote the metastatic potential of prostate cancer cells (11) . Therefore, we were interested to investigate the role of RKIP in malignant melanoma, a cancer notorious for its capacious potential to metastasize.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Culture Conditions.
The melanoma cell lines Mel Im, Mel Ei, Mel Wei, Mel Ho, Mel Juso, Mel Ju, SK Mel 28, HMB2, and HTZ19d have been described in detail previously (12 , 13) . The cell lines Mel Ei, Mel Wei, Mel Ho, and Mel Juso were derived from a primary cutaneous melanoma, and Mel Im, Mel Ju, SK Mel 28, HMB2, and HTZ19d were derived from metastases of malignant melanomas. For tissue culture, the cells were maintained in DMEM supplemented with penicillin (400 units/ml), streptomycin (50 µg/ml), L-glutamine (300 µg/ml), and 10% FCS (Sigma, Deisenhofen, Germany) and split 1:5 every 3 days.

Human primary melanocytes derived from normal skin were cultivated in melanocyte medium MGM-3 (Life Technologies, Eggenstein, Germany) in a humidified atmosphere of 5% CO2 at 37°C. Cells were used at passages 6–10 and not later than 3 days after passaging. Cells were detached for propagation or assay with 0.05% trypsin and 0.04% EDTA in PBS.

For demethylation assays the cells were treated for 24 or 48 h with 5-azacytidine (Sigma) at a final concentration of 10 µM (14 , 15) .

Stable Transfection of Melanoma Cells with RKIP Expression Plasmid.
A panel of Mel Im cell clones showing overexpression of RKIP was established by stable transfection with RKIP-sense expression plasmid (RKIP full-length coding sequence cloned into pcDNA3.1 (Invitrogen NV, Leek, Holland)). Controls received pcDNA3.1 alone. Transfections were performed using the LipofectAMINE plus method (Life Technologies). One day after transfection, cells were placed into selection medium containing 1 mg/ml Geneticin (Sigma). After 25 days of selection, individual Geneticin-resistant colonies were subcloned. The amount of RKIP expression in these clones was determined by reverse transcription-PCR and Western blot analysis.

Assays for Cell Function.
Proliferation, migration, and invasion of the stably transfected, RKIP re-expressing melanoma cell clones were measured as described previously (16) .

Invasion assays were performed in Boyden chambers containing polycarbonate filters with an 8-µm pore size. In brief, filters were coated with a commercially available reconstituted basement membrane (Matrigel; Becton Dickinson, Heidelberg, Germany), and the lower compartment was filled with endothelial-cell-conditioned medium as chemoattractant. Mel Im cells and Mel Im RKIP cell clones were harvested by trypsinization, resuspended in DMEM without FCS at a density of 2 x 105 cells/ml, and placed in the upper compartment of the chambers. After incubation for 4 h at 37°C, the filters were removed. The cells adhering to the lower surface were fixed, stained, and counted. Fifteen random fields were counted at 200-fold magnification. Each sample was assayed in triplicate, and all experiments were repeated three times.

RNA Isolation and Reverse Transcription.
For reverse transcription-PCR total cellular RNA was isolated from cultured cells using the RNeasy kit (Qiagen, Hilden, Germany). The integrity of the RNA was controlled on 1% agarose/formaldehyde gel, and subsequently, cDNAs were generated by reverse transcriptase reactions. The reverse transcription reaction was performed in a 20-µl reaction volume containing 2 µg of total cellular RNA, 4 µl of 5x first-strand buffer (Life Technologies), 2 µl of 0.1 M DTT, 1 µl of dN6 primer (10 mM), 1 µl of dNTPs (10 mM), and diethyl pyrocarbonate water. The reaction mix was incubated for 10 min at 70°C. Then 1 µl of Superscript II reverse transcriptase (Life Technologies) was added, and RNAs were transcribed for 1 h at 37°C. Subsequently, reverse transcriptase was inactivated at 70°C for 10 min, and RNA was degraded by digestion with 1 µl of RNase A (10 mg/ml) at 37°C for 30 min. cDNAs were controlled by PCR amplification of ß-actin.

RKIP-RNA Mutational Analysis.
The complete coding region of RKIP was amplified by reverse transcription-PCR from cDNA using specific primers (RKIP108for, ATGCCGGTGGACCTCAGC; RKIP657rev, GCTGCTCGTACAGTTTGGGC), resulting in a 546-bp fragment. The PCR reaction was performed in a 50-µl reaction volume containing 5 µl of 10x Taq buffer, 1 µl of cDNA, 0.5 µl of each primer (0.2 µM), 0.5 µl of dNTPs (10 mM), 0.5 µl of Taq polymerase (5 units/µl), and 41 µl of water. The amplification reactions were performed by 35 repetitive cycles of denaturing for 1 min at 94°C, annealing for 1 min at 58°C, extension for 1 min at 72°C, and a final extension step at 72°C for 5 min. The PCR products were resolved on 1% agarose gels. For sequencing, the products were purified by polyethylene glycol precipitation to remove unincorporated primers and dNTPs. Both strands were sequenced for each PCR product from at least two independent PCR reactions. Sequences were compared with the gene data bank by means of BLAST search (National Center of Biotechnology Information).

Analysis of RKIP Expression by Quantitative PCR.
Quantitative real time-PCR was performed on a Lightcycler (Roche, Mannheim, Germany). Two µl of cDNA template, 1.6 µl of 25 mM MgCl2, 0.2 µM forward and reverse primers (RKIPfor455, CCTCCACCGCTATGTCTGGC; RKIP657rev, GCTGCTCGTACAGTTTGGGC), and 2 µl of SybrGreen LightCycler Mix in a total of 20 µl were applied to the following PCR program: 30 s 95°C (initial denaturation); 20°C/s temperature transition rate up to 95°C for 15 s, 64°C for 3 s, 72°C for 5 s; 85°C acquisition mode single; repeated for 40 times (amplification). The PCR product was evaluated by melting curve analysis following the manufacturer’s instructions and by checking the PCR products on 1.8% agarose gels. All quantitative PCR experiments were repeated six times.

Protein Analysis in Vitro (Western Blotting).
For protein isolation, 2 x 106 cells were washed in 1x PBS and lysed in 200 µl of radioimmunoprecipitation assay buffer (Roche). The protein concentration was determined using the BCA protein assay reagent (Pierce). Equal amounts of cellular protein were denatured at 70°C for 10 min after addition of Rotiload buffer (Roth, Karlsruhe, Germany) and subsequently separated on NuPage-SDS-gels (Invitrogen, Groningen, the Netherlands). Forty µg of total protein were loaded for Western blots with stably transfected cell lines, and 20 µg of total protein were used for Western blots with the diverse melanoma cell lines. After transferring the proteins onto polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA), the membranes were blocked in 3% BSA/PBS for 1 h and incubated with a 1:1500 dilution of primary polyclonal rabbit anti-RKIP antibody (9) overnight at 4°C. For detection of phospho-MEK (pMEK), polyclonal rabbit anti-pMEK antibody (Cell Signaling) in a dilution of 1:2000 was used; phospho-ERK (pERK) was detected with a monoclonal anti-phospho p42/44 antibody (Cell Signaling, Beverly, MA) in a 1:2000 dilution; and ERK levels were detected with an anti-p42/44 polyclonal rabbit antibody (1:1000). A 1:1500 dilution of anti-IgG-AP (Sigma) was used as secondary antibody. Staining was performed using 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium tablets (Sigma). All Western blot experiments were repeated at least four times, and pMEK Western blots were repeated two times.

Immunohistochemistry.
Paraffin-embedded tissue sections from patients with benign melanocytic nevi, malignant melanomas, and melanoma metastases were screened for RKIP protein expression by immunohistochemistry. The tissues were deparaffinated, rehydrated, and subsequently incubated with primary polyclonal rabbit RKIP antibody (1:1500) overnight at 4°C. The secondary antibody (biotin-labeled antirabbit; 1:1000; Immuno Research) was incubated for 30 min at room temperature, followed by incubation with streptavidin-POD (DAKO, Hamburg, Germany) for 30 min. Antibody binding was visualized using 3-amino-9-ethylcarbazol (AEC) solution (DAKO). Finally, the tissues were counterstained by hemalaun.

Transfection Experiments.
For transient transfections, 2 x 105 cells/well were seeded into 6-well plates and transiently transfected with 0.5 µg of pAP-1 luc plasmid (Stratagene, La Jolla, CA) using the LipofectAMINE Plus method (Life Technologies) according to the manufacturer’s instructions. Twenty-four h after transfection, the cells were lysed, and the luciferase activity in the lysate was measured. To normalize transfection efficiency, 0.2 µg of a pRL-TK plasmid (Promega, Mannheim, Germany) was cotransfected, and renilla luciferase activity was measured by a luminometric assay (Promega). All transfection experiments were repeated three times.

Statistical Analyses.
Student’s unpaired test was used to test differences in the expression. Two-tailed statistical tests are used throughout; P < 0.05 was considered to be statistically significant (*, P < 0.05; **, P < 0.01; and ***, P < 0.001). All statistical analyses were performed using the Prism 2.01 software (GraphPad Inc., San Diego, CA). All indicated error bars represent SD.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It is well established that the ERK is constitutively hyperactivated in the majority of malignant melanomas and may contribute to the pathogenesis of this tumor. In many cases, ERK hyperactivation can be explained by activating mutations occurring in upstream activators of ERK, such as Ras or Raf. Indeed, activating mutations in N-Ras or BRAF are found in up to 15 or 66% of melanomas, respectively (3) . However, ERK hyperactivation is still observed in melanomas that do not harbor activating mutations (5) , suggesting that constitutive ERK activation can be achieved by different means. One possibility is the inactivation of inhibitor proteins, such as RKIP. In this study, we therefore investigated the role of RKIP (a) in the dysregulation of ERK in malignant melanoma, and (b) in the progression of the disease.

Analysis for Mutations in RKIP RNA.
All nine human melanoma cell lines were evaluated for mutations in the RKIP mRNA and compared with normal human epidermal melanocytes (NHEM). The complete RKIP-coding region was amplified by reverse transcription-PCR. All cell lines examined expressed RKIP mRNA at the expected length, indicating that no deletions or mutational insertions had occurred (Fig. 1)Citation . As a control, the RKIP coding sequence was amplified with NHEM cDNA as template. The same cDNAs were used to amplify ß-actin as a control for the integrity of the cDNA.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Amplification of the complete coding region of RKIP mRNA by PCR. The RKIP-coding region was amplified by reverse transcription-PCR. All melanoma cells were shown to express full-length RKIP mRNA. Level of expression cannot be estimated from this experiment because the PCR was carried out to saturation to illustrate full-length mRNA expression and to obtain enough product for sequencing. ß-Actin amplification served as control to ascertain the integrity of the cDNA in all samples.

 
The PCR products were purified and subsequently sequenced using two different primers. The analysis of all sequenced PCR products did not reveal any sequence variation within the coding region of the RKIP gene locus (data not shown). Hence, RKIP does not seem to be mutated in melanomas, at least not in the small number of samples in this study.

Expression of RKIP in Melanoma Cell Lines.
The entire panel of nine human melanoma cell lines was further evaluated for levels of RKIP mRNA expression using quantitative reverse transcription-PCR and compared with melanocytes (NHEM). Obvious and reproducible down-regulation of RKIP expression was found in all melanoma cell lines compared with melanocytes with the exception of Mel Wei and SK Mel 28. Down-regulation in Mel Ho cells was shown repeatedly but was not statistically significant (Fig. 2Citation , {blacksquare}).



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. RKIP expression in melanoma cell lines compared with NHEM. The amount of RKIP mRNA expression was carefully quantified by real-time PCR. All melanoma cell lines except Mel Wei and SK Mel 28 showed a significant reduction in RKIP expression compared with NHEM ({blacksquare}; P < 0.05). Treatment with the demethylating agent 5-azacytidine failed to induce significant overexpression of RKIP mRNA in any of the melanoma cell lines ().

 
Because this reduction in mRNA expression could not be explained by loss or mutation of the RKIP gene in the melanoma cell lines, we hypothesized that promoter hypermethylation could have silenced gene expression. To test this hypothesis, all cell lines were exposed to the demethylating agent 5-azacytidine, and RKIP mRNA expression was quantified by reverse transcription-PCR. Our results clearly show that 5-azacytidine treatment did not significantly induce RKIP expression. Therefore, we conclude that promoter hypermethylation is not the cause of down-regulation of RKIP mRNA expression in the melanoma cell lines in comparison with NHEM (Fig. 2Citation ,

).

These results clearly indicate that promoter hypermethylation is not responsible for down-regulation of RKIP in melanoma cell lines, but they implicate a transcriptional control of RKIP expression in the different melanoma cell lines.

RKIP Protein Expression in Melanoma Cell Lines.
Next, the nine different melanoma cell lines were screened for RKIP protein expression by Western blotting using an anti-RKIP antibody (Fig. 3A)Citation . Consistent with the reduced amount of mRNA expression, only weak levels of RKIP protein were detected in all of the melanoma cell lines except of Mel Wei compared with NHEM. For Mel Ho cells, down-regulation was obvious and reproducible and almost reached significance (P = 0.0518). Relative to ß-actin as loading control, densitometric quantification of RKIP levels revealed significant down-regulation in the melanoma cell lines in comparison with RKIP protein levels in NHEM. The results are consistent with the data obtained from the quantitative reverse transcription-PCR except for SK Mel 28 cells, which feature a similar expression of RKIP mRNA but express significantly less RKIP protein compared with NHEM. These data suggest that RKIP expression is primarily regulated at the transcriptional level, although posttranscriptional mechanisms seem to be used by some cells such as SK Mel 28.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Western blot analyses of RKIP and pERK1/2 protein expression in melanoma cell lines. A, in eight of nine melanoma cell lines, the expression of RKIP was reduced in comparison with NHEM; in seven cell lines, this reduction was shown to be significant (P < 0.05). As loading control, the blot was reprobed with an anti-ß-actin antibody. B, pMEK1/2 levels and pERK1/2 levels in relation to ERK1/2 protein levels revealed higher activity of ERK1/2 in all melanoma cell lines, although significantly increased pERK1/2 levels were only detected in four of nine cell lines (P < 0.05). The blots shown in A and B are representative examples. The experiments were repeated four times, and the blots were quantified by laser densitometry. The compiled quantification results of four independent experiments are represented in the graphs. The levels of pERK are normalized to the levels of total ERK in each cell line. Error bars indicate SD.

 
Activation of MEK in the melanoma cell lines was shown by probing Western blots with a phospho-specific anti-MEK antibody, and activation of ERK1/2 in the melanoma cell lines was analyzed by probing Western blots with a phospho-specific anti-ERK antibody. We observed a consistently stronger activity of MEK1/2 and ERK1/2 in all nine cell lines in comparison with NHEM (Fig. 3B)Citation , although significantly higher pERK1/2 levels could only be shown in four of nine cell lines.

Analysis of RKIP Protein Expression in Vivo.
To examine RKIP expression in vivo, 15 tissue samples from patients with benign melanocytic nevi, primary malignant melanomas, and metastatic malignant melanomas were immunostained with RKIP antibody. Representative sections are presented in Fig. 4Citation . The intensity of RKIP-positive cells was reduced in primary malignant melanomas compared with nevi. In metastatic lesions, an additional reduction of expression was seen with cells revealing only very weak staining or no RKIP staining at all.



View larger version (175K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Immunostaining of RKIP in human melanocytic tumors. Tissue sections were immunostained with RKIP antibody and developed in red so that the RKIP stain could be distinguished from the brown melanin pigment. Slides were counterstained with hemalaun and photographed at x200 magnification except A, which was photographed at x100 and E at x50. Scale bars indicate 100 µm. A, section of normal skin. Epidermis and endothelia of blood vessels and capillaries are positively stained for RKIP expression. B, strong cytoplasmatic RKIP staining in benign melanocytic nevi (marked by black arrows). C and D, focally positive (black arrows) and negative RKIP staining (arrowhead) in primary cutaneous melanomas. E and F, negative or weak staining pattern in metastases from cutaneous melanomas. Small round cells underneath the metastatic infiltrate represent resident lymphocytes of the lymph node (white arrows).

 
In summary, these data show an inverse correlation between RKIP protein expression and tumor progression as the amount of RKIP protein staining decreased from benign melanocytic nevi to primary melanomas and even further from primary melanomas to metastatic melanomas in vivo.

Functional Relevance of Loss of RKIP Expression.
To analyze the functional role of RKIP in melanoma cells, we overexpressed RKIP in the melanoma cell line Mel Im by stable transfection with an RKIP expression construct. Successful overexpression of RKIP in the cell clones (Mel Im RKIP1 and 4) was shown by quantitative reverse transcription-PCR (Fig. 5A)Citation and Western blotting (Fig. 5, B and C)Citation , whereas no changes of RKIP expression were seen in two control-transfected cell clones (Mel Im pcDNA 5 and 7).



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Functional relevance of RKIP expression in malignant melanoma. A, quantitative reverse transcription-PCR of RKIP mRNA expression in stably transfected cell clones shows a significant increase of RKIP expression in comparison with untransfected (Mel Im) or control transfected (Mel Im pcDNA 5 and 7) cell clones. B, Western blot analysis of the Mel Im cell clones stably transfected with an RKIP expression plasmid. The cell clones (Mel Im RKIP 1 and 4) showed overexpression of RKIP protein, whereas RKIP expression in the control-transfected cell clones (Mel Im pcDNA 5 and 7) stayed unchanged. NHEM and Mel Im RKIP1 and Mel Im RKIP4 cells express significantly higher levels of RKIP than Mel Im cells (**, P < 0.01, and *, P < 0.05, respectively). pMEK1/2 and pERK1/2 levels are down-regulated in RKIP-expressing cells in comparison with controls. ERK1/2 expression is not altered. C, ERK1/2 and pERK1/2 (pERK) Western blots of the stably transfected RKIP cell clones and NHEM showed significantly reduced ERK activity in comparison with Mel Im (P < 0.05). D, activation of AP-1 as a target of the Ras signaling cascade was shown to be significantly down-regulated in RKIP-expressing cell lines (Mel Im RKIP1 and 4) in comparison with mock-transfected Mel Im cells and control cell lines (Mel Im pcDNA5 and 7; P < 0.05).

 
Analyzing the activity of MEK in control and RKIP-expressing cell clones we observed reduced levels of pMEK in the RKIP-expressing cell clones. Examination of the ERK1/2 and pERK1/2 levels by Western blotting in control- and RKIP-transfected cells revealed a significant down-regulation of ERK activity in the RKIP-expressing cell clones in comparison with Mel Im cells (Fig. 5B)Citation . Additionally, we tested the activation of an activator protein 1 (AP-1) reporter construct in control and RKIP stably transfected cell lines using luciferase reporter gene assays. We observed a strongly reduced activity of the AP-1 reporter in RKIP-overexpressing cell lines in comparison with control cell lines (Fig. 5DCitation ; Mel Im pcDNA5, 0.7-fold ± 0.39; Mel Im pcDNA7, 1.0 ± 0.02; Mel Im RKIP1, 0.1 ± 0.0; Mel Im RKIP4, 0.3 ± 0.05).

To study the functional relevance of RKIP expression, two different assays were performed. Proliferation assays revealed no changes in proliferation comparing the RKIP-expressing cell clones to the controls and untransfected Mel Im cells. The respective doubling times were: Mel Im, 1.69 ± 0.027 days; Mel Im pcDNA5, 1.78 ± 0.039 days; Mel Im pcDNA7, 1.61 ± 0.045 days; Mel Im RKIP1, 1.82 ± 0.059 days; Mel Im RKIP4, 1.49 ± 0.12 days. Interestingly however, invasion assays using the Boyden Chamber system showed a strong reduction of invasive potential in the RKIP re-expressing cell clones (Fig. 6)Citation . Mel Im and control Mel Im pcDNA5 and 7 clones did not show significant changes in invasiveness, whereas RKIP-transfected cell clones Mel Im RKIP1 and Mel Im RKIP4 displayed significantly reduced invasiveness in comparison with the controls.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Invasion assay. Analysis of the cell clones overexpressing RKIP revealed a strong reduction of their invasive potential in comparison with Mel Im cells, as shown in Boyden Chamber assays. Assays were done in triplicate. ***, P < 0.001.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Ras/Raf/MEK/ERK signaling cascade is known to be an important pathway that regulates various cellular responses to extracellular signals. It has been shown before that mutations of several different proteins of this cascade can lead to malignant transformation of melanocytes: activating mutations in the small G protein Ras are found in 25% of all cancers and in 9–15% of melanomas (6 , 17, 18, 19) . Mutations of BRAF have been observed in 60–66% of malignant melanomas by Davies et al. (6) . Notably, however, in subsequent studies, similar mutations were detected in 82% of nevi (7) , which typically do not feature constitutive ERK, suggesting that mutations in BRAF are not sufficient to cause constitutive activation of the Ras/Raf/MEK/ERK signaling pathway.

Dong et al. (20) suggest that mutations in the BRAF gene correlate with progression rather than initiation of human melanoma. In fact, activation of ERK is low in atypical nevi but becomes readily detectable in radial growth melanoma and more progressed tumors (21) . Further activating mutations in the ERK pathway are known for MEK (22 , 23) . Although MEK mutations have not yet been found in tumors, activated MEK mutants induce cellular transformation and invasiveness in NIH 3T3 cells and in a rodent tumor model (24 , 25) . An influence of MEK mutations in transformation of melanocytes has also been suggested by Govindarajan et al. (26) , who showed that the expression of activated MEK mutants in immortalized melanocytes conveys them with the ability to form tumors in mice.

In this study, we have investigated the role of RKIP in progression of malignant melanoma. Fu et al. (11) have analyzed the expression of RKIP in prostate cancer and found that RKIP is expressed in primary prostate tumors but down-regulated in metastases. They further showed that the overexpression of RKIP in a metastatic prostate cancer cell line did not affect its growth rate in vitro but reduced its metastatic potential in an orthotopic mouse model. However, no previous studies on RKIP regulation in other cancers, including malignant melanomas, have been reported thus far.

Our study revealed no loss of the RKIP genomic region in any of the nine analyzed melanoma cell lines as reverse transcription-PCR of different regions spanning the entire RKIP-coding sequence revealed products at the expected lengths. Sequencing revealed no mutations in the coding region of RKIP in any of the analyzed cell lines. Additionally, alterations of the genomic region of RKIP on human chromosome 12q23 and its adjacent areas have not been reported thus far for any cancer entities, contributing to our hypothesis that not chromosomal changes but other alterations lead to dysregulation of RKIP.

Quantification of mRNA expression by real-time PCR showed a marked down-regulation of RKIP expression in seven of nine analyzed melanoma cell lines. Additional experiments revealed that this down-regulation was not due to promoter hypermethylation, because it could not be reversed after demethylation by treatment of the cells with 5-azacytidine. In Mel Wei and SK Mel 28 cells, we did not see down-regulation of RKIP expression but still increased levels of activated ERK1/2. Therefore, we speculate that these cell lines might harbor an activating mutation in the Ras signaling cascade downstream of Raf. For this reason, we are currently investigating the mutational status of MEK in these cell lines, because it has been reported that constitutive activation of MEK is able to induce malignant transformation of melanocytes (26) . Importantly, in a mouse model of melanoma, a pharmacological MEK inhibitor could interfere with the formation of lung metastases and even cause regression of established metastases (27) .

By immunostaining of melanocytic tumors, an obvious down-regulation of RKIP expression was found that correlated with malignant tumor progression. In nevi, almost all samples showed strong RKIP expression, whereas RKIP expression was diminished or completely lost in primary malignant melanoma and in metastases.

Stably transfected, RKIP-overexpressing Mel Im cells exhibited decreased MEK 1/2 and ERK1/2 activity and decreased AP-1 reporter gene activity compared with control cells. These data confirm the original function of RKIP as an inhibitor of Raf/MEK/ERK-mediated signaling (8 , 9) .

Analyzing the functional relevance of RKIP, we tested the effect of RKIP overexpression on tumor cell migration and invasion. Here, we could clearly show that melanoma cells overexpressing RKIP revealed strong reduction in their invasive potential. Comparable results were obtained by Fu et al. (11) in prostate cancer cell lines, in which loss of RKIP expression has been reported and was correlated to the metastatic potential in a rodent tumor model. Additionally, we could show that RKIP has no influence in vitro on melanoma cell proliferation, a finding that was also reported for prostate cancer cell lines (11) .

Taken together, our results suggest that the reduction of RKIP levels in malignant melanoma contributes to the constitutive activation of the Ras signaling cascade and is conducive to the metastatic potential of melanoma cells.


    ACKNOWLEDGMENTS
 
We are indebted to Dr. J. Johnson (University of Munich, Germany) for providing melanoma cell lines, to Sibylla Lodermeier for excellent technical assistance, and to Dr. Benjamin Stoelcker for help with the densitometrical quantifications.


    FOOTNOTES
 
Grant support: Deutsche Forschungsgemeinschaft (A. Bosserhoff), the Deutsche Krebshilfe (A. Bosserhoff), and the Association for International Cancer Research (W. Kolch).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Anja-Katrin Bosserhoff, Institute of Pathology, University of Regensburg, Franz-Josef-Strauss-Allee 11, D-93053 Regensburg, Germany. Phone: 49-941-944-6705; Fax: 49-941-944-6602; E-mail: anja.bosserhoff{at}klinik.uni-regensburg.de

Received 12/10/03. Revised 5/13/04. Accepted 6/ 1/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. O’Neill E, Kolch W Conferring specificity on the ubiquitous Raf/MEK signalling pathway. Br J Cancer, 90: 283-8, 2004.[CrossRef][Medline]
  2. Nottage M, Siu LL Rationale for Ras and raf-kinase as a target for cancer therapeutics. Curr Pharm, : 2231-42, 2002.
  3. Smalley KS A pivotal role for ERK in the oncogenic behaviour of malignant melanoma?. Int J Cancer, 104: 527-32, 2003.[CrossRef][Medline]
  4. Chang F, Steelman LS, Lee JT, et al Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia, 17: 1263-93, 2003.[CrossRef][Medline]
  5. Satyamoorthy K, Li G, Gerrero MR, et al Constitutive mitogen-activated protein kinase activation in melanoma is mediated by both BRAF mutations and autocrine growth factor stimulation. Cancer Res, 63: 756-9, 2003.[Abstract/Free Full Text]
  6. Davies H, Bignell GR, Cox C, et al Mutations of the BRAF gene in human cancer. Nature, 417: 949-54, 2002.[CrossRef][Medline]
  7. Pollock PM, Harper UL, Hansen KS, et al High frequency of BRAF mutations in nevi. Nat Genet, 33: 19-20, 2003.[CrossRef][Medline]
  8. Yeung K, Janosch P, McFerran B, et al Mechanism of suppression of the Raf/MEK/extracellular signal-regulated kinase pathway by the raf kinase inhibitor protein. Mol Cell Biol, 20: 3079-85, 2000.[Abstract/Free Full Text]
  9. Yeung K, Seitz T, Li S, et al Suppression of Raf-1 kinase activity and MAP kinase signalling by RKIP. Nature, 401: 173-7, 1999.[CrossRef][Medline]
  10. Serre L, Pereira de J, Zelwer C, Bureaud N, Schoentgen F, Benedetti H Crystal structures of YBHB and YBCL from Escherichia coli, two bacterial homologues to a Raf kinase inhibitor protein. J Mol Biol, 310: 617-34, 2001.[CrossRef][Medline]
  11. Fu Z, Smith PC, Zhang L, et al T. Effects of raf kinase inhibitor protein expression on suppression of prostate cancer metastasis. J Natl Cancer Inst (Bethesda), 95: 878-89, 2003.[Abstract/Free Full Text]
  12. Jacob K, Wach F, Holzapfel U, et al In vitro modulation of human melanoma cell invasion and proliferation by all-trans-retinoic acid. Melanoma Res, 8: 211-9, 1998.[CrossRef][Medline]
  13. Blesch A, Bosserhoff AK, Apfel R, et al Cloning of a novel malignant melanoma-derived growth-regulatory protein, MIA. Cancer Res, 54: 5695-701, 1994.[Abstract/Free Full Text]
  14. Poser I, Dominguez D, de Herreros AG, Varnai A, Buettner R, Bosserhoff AK Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor Snail. J Biol Chem, 276: 24661-6, 2001.[Abstract/Free Full Text]
  15. Behrmann I, Wallner S, Komyod W, et al Characterization of methylthioadenosin phosphorylase (MTAP) expression in malignant melanoma. Am J Pathol, 163: 683-90, 2003.[Abstract/Free Full Text]
  16. Dobrowolski R, Hein R, Buettner R, Bosserhoff AK Loss of p14ARF expression in melanoma. Arch Dermatol Res, 293: 545-51, 2002.[Medline]
  17. Carr J, Mackie RM Point mutations in the N-ras oncogene in malignant melanoma and congenital naevi. Br J Dermatol, 131: 72-7, 1994.[CrossRef][Medline]
  18. van Elsas A, Zerp S, van der Flier S, et al Analysis of N-ras mutations in human cutaneous melanoma: tumor heterogeneity detected by polymerase chain reaction/single-stranded conformation polymorphism analysis. Recent Results Cancer Res, 139: 57-67, 1995.[Medline]
  19. Tsao H, Zhang X, Fowlkes K, Haluska FG Relative reciprocity of NRAS and PTEN/MMAC1 alterations in cutaneous melanoma cell lines. Cancer Res, 60: 1800-4, 2000.[Abstract/Free Full Text]
  20. Dong J, Phelps RG, Qiao R, et al A. BRAF oncogenic mutations correlate with progression rather than initiation of human melanoma. Cancer Res, 63: 3883-5, 2003.[Abstract/Free Full Text]
  21. Cohen C, Zavala-Pompa A, Sequeira JH, et al Mitogen-activated protein kinase activation is an early event in melanoma progression. Clin Cancer Res, 8: 3728-33, 2002.[Abstract/Free Full Text]
  22. Cowley S, Paterson H, Kemp P, Marshall CJ Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell, 77: 841-52, 1994.[CrossRef][Medline]
  23. Mansour SJ, Matten WT, Hermann AS, et al Transformation of mammalian cells by constitutively active MAP kinase kinase. Science, 265: 966-70, 1994.[Abstract/Free Full Text]
  24. Welch DR, Sakamaki T, Pioquinto R, et al Transfection of constitutively active mitogen-activated protein/extracellular signal-regulated kinase kinase confers tumorigenic and metastatic potentials to NIH3T3 cells. Cancer Res, 60: 1552-6, 2000.[Abstract/Free Full Text]
  25. Ward Y, Wang W, Woodhouse E, Linnoila I, Liotta L, Kelly K Signal pathways which promote invasion and metastasis: critical and distinct contributions of extracellular signal-regulated kinase and Ral-specific guanine exchange factor pathways. Mol Cell Biol, 21: 5958-69, 2001.[Abstract/Free Full Text]
  26. Govindarajan B, Bai X, Cohen C, et al Malignant transformation of melanocytes to melanoma by constitutive activation of mitogen-activated protein kinase kinase (MAPKK) signaling. J Biol Chem, 278: 9790-5, 2003.[Abstract/Free Full Text]
  27. Collisson EA, De A, Suzuki H, Gambhir SS, Kolodney MS Treatment of metastatic melanoma with an orally available inhibitor of the Ras-Raf-MAPK cascade. Cancer Res, 63: 5669-73, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
R. M. Klein and A. E. Aplin
Rnd3 Regulation of the Actin Cytoskeleton Promotes Melanoma Migration and Invasive Outgrowth in Three Dimensions
Cancer Res., March 15, 2009; 69(6): 2224 - 2233.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. E. Granovsky, M. C. Clark, D. McElheny, G. Heil, J. Hong, X. Liu, Y. Kim, G. Joachimiak, A. Joachimiak, S. Koide, et al.
Raf Kinase Inhibitory Protein Function Is Regulated via a Flexible Pocket and Novel Phosphorylation-Dependent Mechanism
Mol. Cell. Biol., March 1, 2009; 29(5): 1306 - 1320.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S.-Y. Shin, O. Rath, S.-M. Choo, F. Fee, B. McFerran, W. Kolch, and K.-H. Cho
Positive- and negative-feedback regulations coordinate the dynamic behavior of the Ras-Raf-MEK-ERK signal transduction pathway
J. Cell Sci., February 1, 2009; 122(3): 425 - 435.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
H. Z. Li, Y. Wang, Y. Gao, J. Shao, X. L. Zhao, W. M. Deng, Y. X. Liu, J. Yang, and Z. Yao
Effects of Raf Kinase Inhibitor Protein Expression on Metastasis and Progression of Human Epithelial Ovarian Cancer
Mol. Cancer Res., June 1, 2008; 6(6): 917 - 928.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Chatterjee, E. Sabo, R. Tavares, and M. B. Resnick
Inverse Association between Raf Kinase Inhibitory Protein and Signal Transducers and Activators of Transcription 3 Expression in Gastric Adenocarcinoma Patients: Implications for Clinical Outcome
Clin. Cancer Res., May 15, 2008; 14(10): 2994 - 3001.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. L. Fougner, J. Bollerslev, F. Latif, J. K. Hald, T. Lund, J. Ramm-Pettersen, and J. P. Berg
Low Levels of Raf Kinase Inhibitory Protein in Growth Hormone-Secreting Pituitary Adenomas Correlate with Poor Response to Octreotide Treatment
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1211 - 1216.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
F Al-Mulla, S Hagan, W Al-Ali, S P Jacob, A I Behbehani, M S Bitar, A Dallol, and W Kolch
Raf kinase inhibitor protein: mechanism of loss of expression and association with genomic instability
J. Clin. Pathol., April 1, 2008; 61(4): 524 - 529.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Zlobec, K. Baker, P. Minoo, J. R. Jass, L. Terracciano, and A. Lugli
Node-Negative Colorectal Cancer at High Risk of Distant Metastasis Identified by Combined Analysis of Lymph Node Status, Vascular Invasion, and Raf-1 Kinase Inhibitor Protein Expression
Clin. Cancer Res., January 1, 2008; 14(1): 143 - 148.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Al-Mulla, S. Hagan, A. I. Behbehani, M. S. Bitar, S. S. George, J. J. Going, J. J. C. Garcia, L. Scott, N. Fyfe, G. I. Murray, et al.
Raf Kinase Inhibitor Protein Expression in a Survival Analysis of Colorectal Cancer Patients
J. Clin. Oncol., December 20, 2006; 24(36): 5672 - 5679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Calipel, F. Mouriaux, A.-L. Glotin, F. Malecaze, A.-M. Faussat, and F. Mascarelli
Extracellular Signal-regulated Kinase-dependent Proliferation Is Mediated through the Protein Kinase A/B-Raf Pathway in Human Uveal Melanoma Cells
J. Biol. Chem., April 7, 2006; 281(14): 9238 - 9250.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. J. Panka, M. B. Atkins, and J. W. Mier
Targeting the mitogen-activated protein kinase pathway in the treatment of malignant melanoma.
Clin. Cancer Res., April 1, 2006; 12(7): 2371s - 2375s.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Panka, W. Wang, M. B. Atkins, and J. W. Mier
The Raf Inhibitor BAY 43-9006 (Sorafenib) Induces Caspase-Independent Apoptosis in Melanoma Cells
Cancer Res., February 1, 2006; 66(3): 1611 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Hagan, F. Al-Mulla, E. Mallon, K. Oien, R. Ferrier, B. Gusterson, J. J. Curto Garcia, and W. Kolch
Reduction of Raf-1 Kinase Inhibitor Protein Expression Correlates with Breast Cancer Metastasis
Clin. Cancer Res., October 15, 2005; 11(20): 7392 - 7397.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Illmer, C. Thiede, A. Fredersdorf, S. Stadler, A. Neubauer, G. Ehninger, and M. Schaich
Activation of the RAS Pathway Is Predictive for a Chemosensitive Phenotype of Acute Myelogenous Leukemia Blasts
Clin. Cancer Res., May 1, 2005; 11(9): 3217 - 3224.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. R. Jazirehi, S. Huerta-Yepez, G. Cheng, and B. Bonavida
Rituximab (Chimeric Anti-CD20 Monoclonal Antibody) Inhibits the Constitutive Nuclear Factor-{kappa}B Signaling Pathway in Non-Hodgkin's Lymphoma B-Cell Lines: Role in Sensitization to Chemotherapeutic Drug-induced Apoptosis
Cancer Res., January 1, 2005; 65(1): 264 - 276.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuierer, M. M.
Right arrow Articles by Bosserhoff, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuierer, M. M.
Right arrow Articles by Bosserhoff, A.-K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online