| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Institute of Pathology, Medical School of the University of Regensburg, Regensburg, Germany; 2 Beatson Institute for Cancer Research, Cancer Research Campaign Beatson Laboratories, Bearsden, Glasgow, United Kingdom; and 3 Sir Henry Wellcome Functional Genomics Facility, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
It has been shown that the Ras signaling pathway is constitutively active in a great number of malignant melanomas (5) . Recently, it was shown that mutations primarily occur in the BRCA2-associated factor (BRAF) gene (6 , 7) . Indeed, Pollock et al. (7) observed mutations in the BRAF gene not only in samples of malignant melanoma, but also in nevi, suggesting that the BRAF mutation is an early but not sufficient event in malignant melanocyte transformation. Other molecules that regulate the Ras pathway are expected to play important roles in the control of this signaling cascade.
One inhibitory molecule that down-regulates the effects of the Ras/Raf/MEK/ERK signaling pathway is the Raf kinase inhibitor protein (RKIP). RKIP directly interacts with Raf-1 and MEK. It dissipates the Raf-1/MEK interaction, thereby preventing the activation of MEK by Raf-1 and downstream signal transduction (8 , 9) . Interestingly, RKIP was found to be a member of the phosphatidylethanolamine-binding protein family, a ubiquitously expressed and evolutionarily conserved group of proteins (10) .
The aim of this study was to analyze the role of RKIP in malignant melanoma. RKIP expression has recently been shown to be down-regulated in metastatic prostate cancers, and the loss of RKIP levels was suggested to promote the metastatic potential of prostate cancer cells (11) . Therefore, we were interested to investigate the role of RKIP in malignant melanoma, a cancer notorious for its capacious potential to metastasize.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Human primary melanocytes derived from normal skin were cultivated in melanocyte medium MGM-3 (Life Technologies, Eggenstein, Germany) in a humidified atmosphere of 5% CO2 at 37°C. Cells were used at passages 610 and not later than 3 days after passaging. Cells were detached for propagation or assay with 0.05% trypsin and 0.04% EDTA in PBS.
For demethylation assays the cells were treated for 24 or 48 h with 5-azacytidine (Sigma) at a final concentration of 10 µM (14 , 15) .
Stable Transfection of Melanoma Cells with RKIP Expression Plasmid.
A panel of Mel Im cell clones showing overexpression of RKIP was established by stable transfection with RKIP-sense expression plasmid (RKIP full-length coding sequence cloned into pcDNA3.1 (Invitrogen NV, Leek, Holland)). Controls received pcDNA3.1 alone. Transfections were performed using the LipofectAMINE plus method (Life Technologies). One day after transfection, cells were placed into selection medium containing 1 mg/ml Geneticin (Sigma). After 25 days of selection, individual Geneticin-resistant colonies were subcloned. The amount of RKIP expression in these clones was determined by reverse transcription-PCR and Western blot analysis.
Assays for Cell Function.
Proliferation, migration, and invasion of the stably transfected, RKIP re-expressing melanoma cell clones were measured as described previously (16)
.
Invasion assays were performed in Boyden chambers containing polycarbonate filters with an 8-µm pore size. In brief, filters were coated with a commercially available reconstituted basement membrane (Matrigel; Becton Dickinson, Heidelberg, Germany), and the lower compartment was filled with endothelial-cell-conditioned medium as chemoattractant. Mel Im cells and Mel Im RKIP cell clones were harvested by trypsinization, resuspended in DMEM without FCS at a density of 2 x 105 cells/ml, and placed in the upper compartment of the chambers. After incubation for 4 h at 37°C, the filters were removed. The cells adhering to the lower surface were fixed, stained, and counted. Fifteen random fields were counted at 200-fold magnification. Each sample was assayed in triplicate, and all experiments were repeated three times.
RNA Isolation and Reverse Transcription.
For reverse transcription-PCR total cellular RNA was isolated from cultured cells using the RNeasy kit (Qiagen, Hilden, Germany). The integrity of the RNA was controlled on 1% agarose/formaldehyde gel, and subsequently, cDNAs were generated by reverse transcriptase reactions. The reverse transcription reaction was performed in a 20-µl reaction volume containing 2 µg of total cellular RNA, 4 µl of 5x first-strand buffer (Life Technologies), 2 µl of 0.1 M DTT, 1 µl of dN6 primer (10 mM), 1 µl of dNTPs (10 mM), and diethyl pyrocarbonate water. The reaction mix was incubated for 10 min at 70°C. Then 1 µl of Superscript II reverse transcriptase (Life Technologies) was added, and RNAs were transcribed for 1 h at 37°C. Subsequently, reverse transcriptase was inactivated at 70°C for 10 min, and RNA was degraded by digestion with 1 µl of RNase A (10 mg/ml) at 37°C for 30 min. cDNAs were controlled by PCR amplification of ß-actin.
RKIP-RNA Mutational Analysis.
The complete coding region of RKIP was amplified by reverse transcription-PCR from cDNA using specific primers (RKIP108for, ATGCCGGTGGACCTCAGC; RKIP657rev, GCTGCTCGTACAGTTTGGGC), resulting in a 546-bp fragment. The PCR reaction was performed in a 50-µl reaction volume containing 5 µl of 10x Taq buffer, 1 µl of cDNA, 0.5 µl of each primer (0.2 µM), 0.5 µl of dNTPs (10 mM), 0.5 µl of Taq polymerase (5 units/µl), and 41 µl of water. The amplification reactions were performed by 35 repetitive cycles of denaturing for 1 min at 94°C, annealing for 1 min at 58°C, extension for 1 min at 72°C, and a final extension step at 72°C for 5 min. The PCR products were resolved on 1% agarose gels. For sequencing, the products were purified by polyethylene glycol precipitation to remove unincorporated primers and dNTPs. Both strands were sequenced for each PCR product from at least two independent PCR reactions. Sequences were compared with the gene data bank by means of BLAST search (National Center of Biotechnology Information).
Analysis of RKIP Expression by Quantitative PCR.
Quantitative real time-PCR was performed on a Lightcycler (Roche, Mannheim, Germany). Two µl of cDNA template, 1.6 µl of 25 mM MgCl2, 0.2 µM forward and reverse primers (RKIPfor455, CCTCCACCGCTATGTCTGGC; RKIP657rev, GCTGCTCGTACAGTTTGGGC), and 2 µl of SybrGreen LightCycler Mix in a total of 20 µl were applied to the following PCR program: 30 s 95°C (initial denaturation); 20°C/s temperature transition rate up to 95°C for 15 s, 64°C for 3 s, 72°C for 5 s; 85°C acquisition mode single; repeated for 40 times (amplification). The PCR product was evaluated by melting curve analysis following the manufacturers instructions and by checking the PCR products on 1.8% agarose gels. All quantitative PCR experiments were repeated six times.
Protein Analysis in Vitro (Western Blotting).
For protein isolation, 2 x 106 cells were washed in 1x PBS and lysed in 200 µl of radioimmunoprecipitation assay buffer (Roche). The protein concentration was determined using the BCA protein assay reagent (Pierce). Equal amounts of cellular protein were denatured at 70°C for 10 min after addition of Rotiload buffer (Roth, Karlsruhe, Germany) and subsequently separated on NuPage-SDS-gels (Invitrogen, Groningen, the Netherlands). Forty µg of total protein were loaded for Western blots with stably transfected cell lines, and 20 µg of total protein were used for Western blots with the diverse melanoma cell lines. After transferring the proteins onto polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA), the membranes were blocked in 3% BSA/PBS for 1 h and incubated with a 1:1500 dilution of primary polyclonal rabbit anti-RKIP antibody (9)
overnight at 4°C. For detection of phospho-MEK (pMEK), polyclonal rabbit anti-pMEK antibody (Cell Signaling) in a dilution of 1:2000 was used; phospho-ERK (pERK) was detected with a monoclonal anti-phospho p42/44 antibody (Cell Signaling, Beverly, MA) in a 1:2000 dilution; and ERK levels were detected with an anti-p42/44 polyclonal rabbit antibody (1:1000). A 1:1500 dilution of anti-IgG-AP (Sigma) was used as secondary antibody. Staining was performed using 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium tablets (Sigma). All Western blot experiments were repeated at least four times, and pMEK Western blots were repeated two times.
Immunohistochemistry.
Paraffin-embedded tissue sections from patients with benign melanocytic nevi, malignant melanomas, and melanoma metastases were screened for RKIP protein expression by immunohistochemistry. The tissues were deparaffinated, rehydrated, and subsequently incubated with primary polyclonal rabbit RKIP antibody (1:1500) overnight at 4°C. The secondary antibody (biotin-labeled antirabbit; 1:1000; Immuno Research) was incubated for 30 min at room temperature, followed by incubation with streptavidin-POD (DAKO, Hamburg, Germany) for 30 min. Antibody binding was visualized using 3-amino-9-ethylcarbazol (AEC) solution (DAKO). Finally, the tissues were counterstained by hemalaun.
Transfection Experiments.
For transient transfections, 2 x 105 cells/well were seeded into 6-well plates and transiently transfected with 0.5 µg of pAP-1 luc plasmid (Stratagene, La Jolla, CA) using the LipofectAMINE Plus method (Life Technologies) according to the manufacturers instructions. Twenty-four h after transfection, the cells were lysed, and the luciferase activity in the lysate was measured. To normalize transfection efficiency, 0.2 µg of a pRL-TK plasmid (Promega, Mannheim, Germany) was cotransfected, and renilla luciferase activity was measured by a luminometric assay (Promega). All transfection experiments were repeated three times.
Statistical Analyses.
Students unpaired test was used to test differences in the expression. Two-tailed statistical tests are used throughout; P < 0.05 was considered to be statistically significant (*, P < 0.05; **, P < 0.01; and ***, P < 0.001). All statistical analyses were performed using the Prism 2.01 software (GraphPad Inc., San Diego, CA). All indicated error bars represent SD.
| RESULTS |
|---|
|
|
|---|
Analysis for Mutations in RKIP RNA.
All nine human melanoma cell lines were evaluated for mutations in the RKIP mRNA and compared with normal human epidermal melanocytes (NHEM). The complete RKIP-coding region was amplified by reverse transcription-PCR. All cell lines examined expressed RKIP mRNA at the expected length, indicating that no deletions or mutational insertions had occurred (Fig. 1)
. As a control, the RKIP coding sequence was amplified with NHEM cDNA as template. The same cDNAs were used to amplify ß-actin as a control for the integrity of the cDNA.
|
Expression of RKIP in Melanoma Cell Lines.
The entire panel of nine human melanoma cell lines was further evaluated for levels of RKIP mRNA expression using quantitative reverse transcription-PCR and compared with melanocytes (NHEM). Obvious and reproducible down-regulation of RKIP expression was found in all melanoma cell lines compared with melanocytes with the exception of Mel Wei and SK Mel 28. Down-regulation in Mel Ho cells was shown repeatedly but was not statistically significant (Fig. 2
,
).
|
![]()
These results clearly indicate that promoter hypermethylation is not responsible for down-regulation of RKIP in melanoma cell lines, but they implicate a transcriptional control of RKIP expression in the different melanoma cell lines.
RKIP Protein Expression in Melanoma Cell Lines.
Next, the nine different melanoma cell lines were screened for RKIP protein expression by Western blotting using an anti-RKIP antibody (Fig. 3A)
. Consistent with the reduced amount of mRNA expression, only weak levels of RKIP protein were detected in all of the melanoma cell lines except of Mel Wei compared with NHEM. For Mel Ho cells, down-regulation was obvious and reproducible and almost reached significance (P = 0.0518). Relative to ß-actin as loading control, densitometric quantification of RKIP levels revealed significant down-regulation in the melanoma cell lines in comparison with RKIP protein levels in NHEM. The results are consistent with the data obtained from the quantitative reverse transcription-PCR except for SK Mel 28 cells, which feature a similar expression of RKIP mRNA but express significantly less RKIP protein compared with NHEM. These data suggest that RKIP expression is primarily regulated at the transcriptional level, although posttranscriptional mechanisms seem to be used by some cells such as SK Mel 28.
|
Analysis of RKIP Protein Expression in Vivo.
To examine RKIP expression in vivo, 15 tissue samples from patients with benign melanocytic nevi, primary malignant melanomas, and metastatic malignant melanomas were immunostained with RKIP antibody. Representative sections are presented in Fig. 4
. The intensity of RKIP-positive cells was reduced in primary malignant melanomas compared with nevi. In metastatic lesions, an additional reduction of expression was seen with cells revealing only very weak staining or no RKIP staining at all.
|
Functional Relevance of Loss of RKIP Expression.
To analyze the functional role of RKIP in melanoma cells, we overexpressed RKIP in the melanoma cell line Mel Im by stable transfection with an RKIP expression construct. Successful overexpression of RKIP in the cell clones (Mel Im RKIP1 and 4) was shown by quantitative reverse transcription-PCR (Fig. 5A)
and Western blotting (Fig. 5, B and C)
, whereas no changes of RKIP expression were seen in two control-transfected cell clones (Mel Im pcDNA 5 and 7).
|
To study the functional relevance of RKIP expression, two different assays were performed. Proliferation assays revealed no changes in proliferation comparing the RKIP-expressing cell clones to the controls and untransfected Mel Im cells. The respective doubling times were: Mel Im, 1.69 ± 0.027 days; Mel Im pcDNA5, 1.78 ± 0.039 days; Mel Im pcDNA7, 1.61 ± 0.045 days; Mel Im RKIP1, 1.82 ± 0.059 days; Mel Im RKIP4, 1.49 ± 0.12 days. Interestingly however, invasion assays using the Boyden Chamber system showed a strong reduction of invasive potential in the RKIP re-expressing cell clones (Fig. 6)
. Mel Im and control Mel Im pcDNA5 and 7 clones did not show significant changes in invasiveness, whereas RKIP-transfected cell clones Mel Im RKIP1 and Mel Im RKIP4 displayed significantly reduced invasiveness in comparison with the controls.
|
| DISCUSSION |
|---|
|
|
|---|
Dong et al. (20) suggest that mutations in the BRAF gene correlate with progression rather than initiation of human melanoma. In fact, activation of ERK is low in atypical nevi but becomes readily detectable in radial growth melanoma and more progressed tumors (21) . Further activating mutations in the ERK pathway are known for MEK (22 , 23) . Although MEK mutations have not yet been found in tumors, activated MEK mutants induce cellular transformation and invasiveness in NIH 3T3 cells and in a rodent tumor model (24 , 25) . An influence of MEK mutations in transformation of melanocytes has also been suggested by Govindarajan et al. (26) , who showed that the expression of activated MEK mutants in immortalized melanocytes conveys them with the ability to form tumors in mice.
In this study, we have investigated the role of RKIP in progression of malignant melanoma. Fu et al. (11) have analyzed the expression of RKIP in prostate cancer and found that RKIP is expressed in primary prostate tumors but down-regulated in metastases. They further showed that the overexpression of RKIP in a metastatic prostate cancer cell line did not affect its growth rate in vitro but reduced its metastatic potential in an orthotopic mouse model. However, no previous studies on RKIP regulation in other cancers, including malignant melanomas, have been reported thus far.
Our study revealed no loss of the RKIP genomic region in any of the nine analyzed melanoma cell lines as reverse transcription-PCR of different regions spanning the entire RKIP-coding sequence revealed products at the expected lengths. Sequencing revealed no mutations in the coding region of RKIP in any of the analyzed cell lines. Additionally, alterations of the genomic region of RKIP on human chromosome 12q23 and its adjacent areas have not been reported thus far for any cancer entities, contributing to our hypothesis that not chromosomal changes but other alterations lead to dysregulation of RKIP.
Quantification of mRNA expression by real-time PCR showed a marked down-regulation of RKIP expression in seven of nine analyzed melanoma cell lines. Additional experiments revealed that this down-regulation was not due to promoter hypermethylation, because it could not be reversed after demethylation by treatment of the cells with 5-azacytidine. In Mel Wei and SK Mel 28 cells, we did not see down-regulation of RKIP expression but still increased levels of activated ERK1/2. Therefore, we speculate that these cell lines might harbor an activating mutation in the Ras signaling cascade downstream of Raf. For this reason, we are currently investigating the mutational status of MEK in these cell lines, because it has been reported that constitutive activation of MEK is able to induce malignant transformation of melanocytes (26) . Importantly, in a mouse model of melanoma, a pharmacological MEK inhibitor could interfere with the formation of lung metastases and even cause regression of established metastases (27) .
By immunostaining of melanocytic tumors, an obvious down-regulation of RKIP expression was found that correlated with malignant tumor progression. In nevi, almost all samples showed strong RKIP expression, whereas RKIP expression was diminished or completely lost in primary malignant melanoma and in metastases.
Stably transfected, RKIP-overexpressing Mel Im cells exhibited decreased MEK 1/2 and ERK1/2 activity and decreased AP-1 reporter gene activity compared with control cells. These data confirm the original function of RKIP as an inhibitor of Raf/MEK/ERK-mediated signaling (8 , 9) .
Analyzing the functional relevance of RKIP, we tested the effect of RKIP overexpression on tumor cell migration and invasion. Here, we could clearly show that melanoma cells overexpressing RKIP revealed strong reduction in their invasive potential. Comparable results were obtained by Fu et al. (11) in prostate cancer cell lines, in which loss of RKIP expression has been reported and was correlated to the metastatic potential in a rodent tumor model. Additionally, we could show that RKIP has no influence in vitro on melanoma cell proliferation, a finding that was also reported for prostate cancer cell lines (11) .
Taken together, our results suggest that the reduction of RKIP levels in malignant melanoma contributes to the constitutive activation of the Ras signaling cascade and is conducive to the metastatic potential of melanoma cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Anja-Katrin Bosserhoff, Institute of Pathology, University of Regensburg, Franz-Josef-Strauss-Allee 11, D-93053 Regensburg, Germany. Phone: 49-941-944-6705; Fax: 49-941-944-6602; E-mail: anja.bosserhoff{at}klinik.uni-regensburg.de
Received 12/10/03. Revised 5/13/04. Accepted 6/ 1/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. M. Klein and A. E. Aplin Rnd3 Regulation of the Actin Cytoskeleton Promotes Melanoma Migration and Invasive Outgrowth in Three Dimensions Cancer Res., March 15, 2009; 69(6): 2224 - 2233. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Granovsky, M. C. Clark, D. McElheny, G. Heil, J. Hong, X. Liu, Y. Kim, G. Joachimiak, A. Joachimiak, S. Koide, et al. Raf Kinase Inhibitory Protein Function Is Regulated via a Flexible Pocket and Novel Phosphorylation-Dependent Mechanism Mol. Cell. Biol., March 1, 2009; 29(5): 1306 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Shin, O. Rath, S.-M. Choo, F. Fee, B. McFerran, W. Kolch, and K.-H. Cho Positive- and negative-feedback regulations coordinate the dynamic behavior of the Ras-Raf-MEK-ERK signal transduction pathway J. Cell Sci., February 1, 2009; 122(3): 425 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Z. Li, Y. Wang, Y. Gao, J. Shao, X. L. Zhao, W. M. Deng, Y. X. Liu, J. Yang, and Z. Yao Effects of Raf Kinase Inhibitor Protein Expression on Metastasis and Progression of Human Epithelial Ovarian Cancer Mol. Cancer Res., June 1, 2008; 6(6): 917 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chatterjee, E. Sabo, R. Tavares, and M. B. Resnick Inverse Association between Raf Kinase Inhibitory Protein and Signal Transducers and Activators of Transcription 3 Expression in Gastric Adenocarcinoma Patients: Implications for Clinical Outcome Clin. Cancer Res., May 15, 2008; 14(10): 2994 - 3001. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Fougner, J. Bollerslev, F. Latif, J. K. Hald, T. Lund, J. Ramm-Pettersen, and J. P. Berg Low Levels of Raf Kinase Inhibitory Protein in Growth Hormone-Secreting Pituitary Adenomas Correlate with Poor Response to Octreotide Treatment J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1211 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Al-Mulla, S Hagan, W Al-Ali, S P Jacob, A I Behbehani, M S Bitar, A Dallol, and W Kolch Raf kinase inhibitor protein: mechanism of loss of expression and association with genomic instability J. Clin. Pathol., April 1, 2008; 61(4): 524 - 529. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Zlobec, K. Baker, P. Minoo, J. R. Jass, L. Terracciano, and A. Lugli Node-Negative Colorectal Cancer at High Risk of Distant Metastasis Identified by Combined Analysis of Lymph Node Status, Vascular Invasion, and Raf-1 Kinase Inhibitor Protein Expression Clin. Cancer Res., January 1, 2008; 14(1): 143 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Al-Mulla, S. Hagan, A. I. Behbehani, M. S. Bitar, S. S. George, J. J. Going, J. J. C. Garcia, L. Scott, N. Fyfe, G. I. Murray, et al. Raf Kinase Inhibitor Protein Expression in a Survival Analysis of Colorectal Cancer Patients J. Clin. Oncol., December 20, 2006; 24(36): 5672 - 5679. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Calipel, F. Mouriaux, A.-L. Glotin, F. Malecaze, A.-M. Faussat, and F. Mascarelli Extracellular Signal-regulated Kinase-dependent Proliferation Is Mediated through the Protein Kinase A/B-Raf Pathway in Human Uveal Melanoma Cells J. Biol. Chem., April 7, 2006; 281(14): 9238 - 9250. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Panka, M. B. Atkins, and J. W. Mier Targeting the mitogen-activated protein kinase pathway in the treatment of malignant melanoma. Clin. Cancer Res., April 1, 2006; 12(7): 2371s - 2375s. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Panka, W. Wang, M. B. Atkins, and J. W. Mier The Raf Inhibitor BAY 43-9006 (Sorafenib) Induces Caspase-Independent Apoptosis in Melanoma Cells Cancer Res., February 1, 2006; 66(3): 1611 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hagan, F. Al-Mulla, E. Mallon, K. Oien, R. Ferrier, B. Gusterson, J. J. Curto Garcia, and W. Kolch Reduction of Raf-1 Kinase Inhibitor Protein Expression Correlates with Breast Cancer Metastasis Clin. Cancer Res., October 15, 2005; 11(20): 7392 - 7397. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Illmer, C. Thiede, A. Fredersdorf, S. Stadler, A. Neubauer, G. Ehninger, and M. Schaich Activation of the RAS Pathway Is Predictive for a Chemosensitive Phenotype of Acute Myelogenous Leukemia Blasts Clin. Cancer Res., May 1, 2005; 11(9): 3217 - 3224. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Jazirehi, S. Huerta-Yepez, G. Cheng, and B. Bonavida Rituximab (Chimeric Anti-CD20 Monoclonal Antibody) Inhibits the Constitutive Nuclear Factor-{kappa}B Signaling Pathway in Non-Hodgkin's Lymphoma B-Cell Lines: Role in Sensitization to Chemotherapeutic Drug-induced Apoptosis Cancer Res., January 1, 2005; 65(1): 264 - 276. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |