| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Departments of 1 Molecular and Integrative Physiology and 2 Surgery, University of Michigan, Ann Arbor, Michigan
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
1020% of patients are candidates for surgery at the time of diagnosis, and of this group, only
20% of patients who undergo a curative operation are alive after 5 years (2)
. Pancreatic cancer tends to rapidly invade surrounding structures and undergo early metastatic spreading. In addition, pancreatic cancer is highly resistant to chemotherapy and radiation therapy, even though some new anticancer drugs and combinations of drugs with radiotherapy have been recently introduced for treatment of this disease (3)
. Therefore, elucidation of the molecular basis of the aggressive nature of pancreatic cancer and identification of novel targets for therapeutic intervention in this disease are urgently needed. Pancreatic cancer is pathologically characterized as nests of neoplastic cells within an abundant fibrotic stroma. These tumors are observed as a lower density area on contrast-enhanced computed tomography scan, which suggests that they have a reduced blood oxygen supply compared with normal tissue (4) . Direct evidence that pancreatic cancer cells exist within a hypoxic environment has come from measurements of O2 tension that are significantly decreased in pancreatic cancer when compared with adjacent normal pancreas (5) . The ability of cancer cells to adapt to hypoxic environment is increasingly recognized as an important mechanism promoting tumor growth (6) . In general, it is thought that tumor cells become resistant to hypoxia during the progression of the disease by alterations in a variety of cellular mechanisms (7 , 8) .
In the current study, we analyzed the levels and role of a hypoxia-inducible pro-apoptotic molecule, Bcl-2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3), in pancreatic cancer. BNIP3 was originally isolated through its interaction with anti-apoptotic proteins such as adenovirus E1B 19K and cellular Bcl-2 (9) . BNIP3 belongs to the Bcl-2 family and the Bcl-2 homology domain-3-only subfamily (10) . BNIP3 expression is increased under hypoxic conditions by the actions of the transcription factor, hypoxia-inducible factor 1 (HIF-1; Refs. 11, 12, 13 ). Forced expression of BNIP3 has been shown to lead to cell death in cardiac myocytes and other cultured cell lines (14 , 15) . Thus, BNIP3 is considered to be a key regulator of hypoxia-induced cell death.
We observed that BNIP3 expression was decreased in pancreatic cancer compared with normal pancreas. This was not due to a general decrease in hypoxia gene induction in pancreatic cancer, because we observed increased levels of hypoxia-responsive genes including glucose transporter-1 (GLUT1) and insulin-like growth factor-binding protein 3 (IGFBP3). BNIP3 expression was also absent and could not be induced by hypoxic treatment in several pancreatic cancer cell lines. As an explanation for the low levels of BNIP3 expression, we explored the possibility that the gene might be hypermethylated. We found that the BNIP3 promoter was located within a CpG island in which numerous CpG dinucleotides were methylated in almost all pancreatic cancer cell lines and tumor samples but not in normal pancreas. Moreover, pharmacological inhibition of methylation restored expression and hypoxia induction of BNIP3 in pancreatic cancer cell lines. We were also able to restore hypoxia-induced BNIP3 expression by transfection with a construct containing the BNIP3 cDNA regulated by 754 bp of the BNIP3 promoter. Restoration of hypoxia-inducible BNIP3 expression increased the sensitivity of pancreatic cancer cells to hypoxia-induced cell death. Taken together, these data suggest that down-regulation of the hypoxia-inducible gene BNIP3 by methylation is an important adaptive response, allowing pancreatic cancer cell growth in a hypoxic environment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Pancreatic cancer cell lines BxPC-3, Mia PaCa-2, HPAC, MPanc-96, AsPC-1, PSN-1, and PANC-1 were obtained from the American Type Culture Collection (Manassas, VA) or Japanese Cancer Research Resources Bank (Tokyo, Japan). These cells were cultured in high-glucose DMEM (Invitrogen) with 10% FCS, 100 units/ml penicillin, and 100 µg/ml streptomycin in a humidified incubator with an atmosphere of 5% CO2 and 95% air.
Reverse Transcription-PCR.
Total RNA extraction was performed from microdissected tissue samples or cultured cells using RNA easy kit (Qiagen, Valencia, CA) according to the manufacturers protocol, and purified RNA was quantitated and assessed for purity by UV spectrophotometry. cDNA was generated from 1 µg of RNA with avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI). The amplification of each specific RNA was performed in a 25-µl reaction mixture containing 2 µl of cDNA template, 1x PCR master mix, and 0.5 pmol of primers. The PCR primers used for detection of BNIP3 were: forward, 5'-GCCCACCTCGCTCGCAGACAC-3'; and reverse, 5'-CAATCCGATGGCCAGCAAATGAGA-3'. The amplified product was 585 bp, and the PCR conditions were as follows: one cycle of denaturing at 95°C for 10 min, followed by 24 cycles of 94°C for 30 s, 60°C for 50 s, and 72°C for 1 min before a final extension at 72°C for 10 min. The PCR products were loaded onto 2% agarose gels and visualized with ethidium bromide under UV light. As a control for cDNA synthesis, reverse transcription-PCR was also performed using primers specific for ß-actin gene (16)
.
Quantitative (Q)-Reverse Transcription-PCR.
Q-reverse transcription-PCR for BNIP3, GLUT1, IGFBP3, and ß-actin was carried out using an iCycler instrument (Bio-Rad, Hercules, CA) by adding 1x SYBR Green I to the same reaction mixture as standard reverse transcription-PCR described above. The PCR primers used for detection of IGFBP3 were: forward, 5'-CGAAGCGGCCGACCACTG-3'; and reverse, 5'-GGATCCACGCCCTTGTTTCA-3'; and the primers for GLUT1 were as described previously (17)
. The PCR conditions for BNIP3, GLUT1, IGFBP3, and ß-actin were as follows: one cycle of denaturing at 95°C for 10 min, followed by 40 cycles of 94°C for 30 s, 60°C for 50 s, and 72°C for 1 min. Each reaction included a negative control and serial 10-fold dilutions from 101 to 105 of cDNA of positive control, and the experiment was done in triplicate. These serial-diluted positive controls were used for standards to confirm the linearity between the amount of target cDNA in the sample and the intensity of fluorescent signal. For comparisons between samples, the mRNA expression of the target genes was normalized to ß-actin mRNA expression. Product specificity was controlled by melting curve analysis and migration on a 2% agarose gel.
Cell Protein Preparation, SDS-PAGE, and Western Blotting.
Cells grown in 100-mm dishes were washed twice with cold PBS, harvested in 0.5 ml of lysis buffer [25 mM Tris-buffered saline (pH 7.4), 50 mM NaCl, 2% NP40, 0.5% sodium deoxycholate, 0.2% SDS, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 250 µg/ml sodium vanadate for BNIP3 detection or 7 M urea, 10% glycerol, 10 mM Tris-buffered saline (pH 6.8), 1% SDS, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride,10 µg/ml aprotinin, 10 µg/ml leupeptin, and 250 µg/ml sodium vanadate for HIF-1
detection]. After removal of cell debris by centrifugation, the protein concentrations in cell lysates were determined by the Bradford assay. Lysates containing 30 µg of protein were added to loading buffer with 5% ß-mercaptoethanol and heated for 10 min at 100°C. Samples were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes by semidry blotting. Membranes were incubated in blocking buffer (1x Tris-buffered saline, 0.1% Tween-20, and 5% nonfat dry milk) for 1 h at room temperature and probed with anti-BNIP3 antibody (1000x diluted; Sigma, St. Louis, MO), anti-HIF-1
antibody (250x diluted; BD, Franklin Lakes, NJ), or anti-actin antibody (1000x diluted; Sigma) overnight at 4°C, followed by hybridization with a horseradish peroxidase-conjugated secondary antibody mouse IgG (1:3300) (Amersham Biosciences, Piscataway, NJ). Signals were detected by chemiluminescence using the ECL detection system (Amersham Biosciences).
Genomic DNA Isolation and Bisulfite Treatment of DNA.
Genomic DNAs were isolated from microdissected tissue samples and cultured cells using Wizard Genomic DNA purification kit (Promega) based on the manufacturers protocol. To differentiate methylated CpGs from unmethylated CpGs, 1 µg of genomic DNA was treated with sodium bisulfite at 50°C for 20 h using a CpGenome DNA Modification kit (Serologicals Corp., Norcross, GA) according to the instructions of the manufacturer and finally resuspended in 50 µl of 10 mM Tris (pH 8)-1 mM EDTA buffer. After this treatment, unmethylated cytosine is converted to uracil, whereas methylated cytosine remains cytosine.
Amplification, Cloning, and Sequencing of Bisulfite-Treated DNA.
By comparing the cDNA sequence of the BNIP3 gene (GenBank accession no. NM004052) against a genomic DNA sequence of chromosome 10q26.3 (GenBank accession no. AL162274), a transcription start site of BNIP3 gene was determined. A region from 38521-bp upstream of the transcription start site, which contains a CpG-rich fragment, was amplified from one-twentieth of the modified DNA by PCR using HotStartTaq DNA polymerase (Qiagen). PCR primers used in this reaction were designed to amplify the coding strand of bisulfite-treated DNA as follows: GTGGTAGTTAGTGTTTAGAGAG (sense) and ACTCACAAAAC AAAACRAAAC (antisense; where R = G or A). The PCR conditions were as follows: one cycle of denaturing at 95°C for 15 min, followed by 35 cycles of 94°C for 30 s, 60°C for 50 s, and 72°C for 1 min before a final extension at 72°C for 10 min. The PCR product was cloned into pGEM-T Easy Vector (Promega), and 10 clones for each sample were sequenced using T7 or SP6 primer at the Sequencing Core Facility of the University of Michigan. Cytosines in CpG dinucleotides that remained unconverted after bisulfite treatment were considered to be methylated.
Methylation-Specific PCR.
Methylation-specific PCR was performed according to the previously described principles (18)
. To detect the sequence differences between methylated and unmethylated DNA as a result of bisulfite treatment, each primer is designed to contain four or five CpG dinucleotides. Primer sequences for unmethylated reaction were 5'-TAGGATTTGTTTTGTGTATG-3' (sense) and 5'-ACCACATCACCCATTAACCACA-3' (antisense), and for methylated reaction were 5'-TAGGATTCGTTTCGCGTACG-3' (sense) and 5'-ACCGCGTCGCCCATTAACCGCG-3' (antisense; the bold nucleotides represent the putative methylation sites), and amplified products were 94 bp for both reactions. The PCR conditions were as follows: one cycle of denaturing at 95°C for 15 min, followed by 35 cycles of 94°C for 30 s, 64°C (for methylated reaction) or 58°C (for unmethylated reaction) for 50 s, and 72°C for 1 min before a final extension at 72°C for 10 min.
5-Aza-2' Deoxycytidine (5aza-dC) Treatment and Hypoxic Exposure.
The pancreatic cancer cell lines Mia Paca-2, HPAC, BxPC-3, and MPanc-96 were seeded at a density of 1
5 x 105 cells/100-mm dish in culture medium and allowed to attach over a 24-h period. 5aza-dC (Sigma) was then added to a final concentration of 1 µM, and the cells were allowed to grow for 6 days. The medium with or without 5aza-dC was changed every other day. At the end of the treatment, the medium was removed; and the RNA, DNA, and protein were extracted for reverse transcription-PCR, methylation analysis, and protein analysis. Hypoxic conditions were achieved with an anaerobic chamber (Sugiyamagen, Tokyo, Japan) and AneroPack for Cell Gas generating system (Mitsubishi Gas Chemical, Tokyo, Japan), which catalytically reduced oxygen levels to less than 1% within 30 min (19)
.
Subcloning of BNIP3 Gene and Plasmids.
Full-length cDNA for BNIP3 was amplified by PCR and subcloned into pcDNA 3.1 (+) vector (Invitrogen). The primer sets were as follows: 5'-GGATCCCGCCATGTCGCAGAACG-3' and 5'-AGGAACGCAGCATTTACAGAACAA-3'. Plasmids were recovered, purified, and sequenced.
Colony Formation Assay.
Cells were plated subconfluently in culture flasks for 24 h before transient transfection with either pcDNA3.1(+)-BNIP3 or pcDNA3.1(+)-empty vector using Lipofectin (Invitrogen) according to the manufacturers protocol. Transfected cells were trypsinized and plated on 10-cm dishes 24 h after transfection and cultured in the presence of G418 (1000 µg/ml). After 1014 days, colonies were fixed with methanol and stained with 0.1% crystal violet.
Cell Death Detection Assay.
Full-length BNIP3 cDNA was inserted into the pAdTrack-CMV vector, which contained dual independent cytomegalovirus promoters, one expressing BNIP3 and the other green fluorescence protein (GFP). Ad-Track-BNIP3 vector or Ad-Track-empty vector was transiently transfected into pancreatic cancer cells. At the indicated times after transfection, cells were washed with PBS twice, scraped, and lysed with PBS containing 0.2% Triton X-100. GFP intensity of cell lysates was measured by a spectrophotometer (Perkin-Elmer, Wellesley, MA) with excitation at 488 nm and emission at 510 nm. That the intensity of GFP of cell lysates linearly correlated with the number of GFP-positive cells was confirmed by direct cell counting (data not shown).
Construction of Human BNIP3 Reporter Plasmid.
Human BNIP3 5'-flanking sequence (GenBank accession no. AL162274) was amplified by PCR using genomic DNA isolated from human normal pancreas as the template. The PCR product was digested with BglII and NcoI and cloned into the pGL3-Basic vector (Promega). The primer sets were as follows: 5'-AGATCTCCCGGCGGGGCGGGCAAAGA-3' and 5'-CCATGGCGCCAGAGG-GCAACTGCG-3'. Plasmids were recovered, purified, and sequenced.
Luciferase Assays.
Cells were seeded in a 6-well plate and grown to 90% confluence. For each well, human BNIP3 reporter construct was cotransfected with ß-gal reporter vector into HEK293 or Mia Paca-2 cells. Cells were harvested, and reporter activity was measured using the Dual Luciferase Assay (Promega) according to the manufacturers instructions. Transfection efficiency was normalized on the basis of ß-galactosidase activity.
Statistical Analysis.
Data are presented as mean ± SE. Statistically significant differences were determined by unpaired t test and were defined as P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
Induction of Hypoxia-Inducible Genes in Pancreatic Cancer.
To determine whether the lack of BNIP3 induction in the majority of pancreatic cancer cell lines was due to a general inability to respond to hypoxia, we evaluated the effect of hypoxia on the transcription factor HIF-1
protein expression by Western blotting. HIF-1
is a major regulator of hypoxia-induced gene expression, and its targets include BNIP3. HIF-1
protein levels were significantly increased in pancreatic cancer cell lines after incubation under hypoxic conditions for 24 h (Fig. 2A)
. In addition, mRNA levels of two other genes that are known to be induced by hypoxia (20)
, GLUT1 and IGFBP3, were examined by Q-reverse transcription-PCR in 3 pancreatic cancer cell lines, 17 pancreatic tissues, 8 normal pancreas, and 9 pancreatic cancer. mRNA expressions of GLUT1 and IGFBP3 were obviously induced after hypoxic conditions in all three pancreatic cancer cell lines (Fig. 2B)
. They were also expressed at significantly higher levels in pancreatic cancer compared with normal pancreas: 8.6-fold (P < 0.05) and 7.9-fold (P < 0.01), respectively (Fig. 2C)
.
|
|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We observed that BNIP3 mRNA expression is markedly down-regulated in pancreatic cancer tissue and cancer cell lines compared with normal pancreas. The presence of BNIP3 mRNA in normal pancreas supports the previous report that several normal human tissues including pancreas, heart, and liver express BNIP3 mRNA (14 , 22) . In contrast to our observation of BNIP3 down-regulation in pancreatic cancer, in breast cancer tissues, BNIP3 is expressed at higher levels than normal breast tissue (12) . This indicates that down-regulation of BNIP3 expression is not a universal phenomenon that occurs during cancer development and progression but may be tissue specific.
Forced expression of BNIP3 killed 46 and 75% of transfected pancreatic cancer cells Mia PaCa-2 and PANC-1, respectively, within 24 h. This was not unexpected, because BNIP3 is a pro-apoptotic member of the BCL-2 family that has been shown to lead to cell death in a wide range of cultured cells (14 , 15 , 23) . BNIP3-mediated death has been reported to occur by a pathway independent of caspase activation and cytochrome c release that is characterized by early plasma membrane and mitochondrial damage, before the appearance of chromatin condensation or DNA fragmentation (24) . We did not investigate the mechanisms of cell killing by BNIP3 in the current study, but instead focused on the regulation of BNIP3 expression in pancreatic cancer.
BNIP3 belongs to the category of genes induced during hypoxia (11, 12, 13) . Cells display a variety of physiological responses through hypoxia-inducible genes when exposed to low oxygen concentrations. The majority of hypoxia-inducible genes contribute to maintaining cellular viability under limited oxygen availability (25) . For example, genes involved in angiogenesis, glucose up-take, and anaerobic metabolic pathways, as well as several growth factors are induced by hypoxia. Furthermore, these same pathways are often activated in cancer, suggesting that tumors take advantage of these responses to survive in the hypoxic environment that generally exists within tumors (6 , 8) . However, in response to hypoxia, normal cells may also diminish their proliferative rate, undergo cell cycle arrest, or even undergo apoptosis (26 , 27) . These growth inhibitory events can also be justified as a physiological adaptation to hypoxia. For example, cell cycle arrest might be important for cells to escape from harmful effects caused by hypoxia-induced genetic instability (28) . Furthermore, hypoxia-induced cell death might help maintain tissue homeostasis by removing cells that are irreversibly damaged during oxygen deprivation. However, hypoxia-related growth inhibitory mechanisms are often missing in cancer cells (7) , and our data suggest that this is the case for BNIP3 expression in pancreatic cancer.
BNIP3 induction by hypoxia is mediated by the transcription factor HIF-1 (11
, 12)
. HIF-1 is composed of two subunits, HIF-1
and HIF-1ß (29)
. HIF-1
is the oxygen-regulated component that determines HIF-1 activity (30)
. During hypoxia, accumulation of HIF-1
protein occurs because its constitutive proteolytic degradation through the ubiquitin proteosome pathway is inhibited (31
, 32)
. Increased levels of HIF-1 activity lead to the transactivation of a number of genes whose protein products play key roles in angiogenesis, vascular reactivity and remodeling, glucose and energy metabolism, and cell proliferation and survival (20)
. Thus, not surprisingly, expression of HIF-1
has been linked to increased tumorigenesis and tumor invasiveness (33
, 34)
. Importantly, HIF-1
has previously been demonstrated to be overexpressed in primary and metastatic human cancers including pancreatic cancer by immunohistochemistry (35)
. In the current study, we demonstrated that HIF-1
protein expression was significantly induced after hypoxic treatment in all pancreatic cancer cell lines examined. Likewise, we observed increased expression of the HIF-1-regulated genes GLUT1 and IGFBP3 (36
, 37) . These data suggest that the hypoxia-HIF-1 pathway is intact and that the BNIP3 pathway is disrupted at some point after HIF-1 activation in pancreatic cancer cells. Thus, when pancreatic cancer cells are exposed to hypoxia, they may exhibit increased invasiveness and promote neovascularization, anaerobic metabolism, and proliferation through HIF-1-mediated genes; whereas they may evade hypoxia-induced cell death at least in part by lacking BNIP3 induction.
By allowing pancreatic cancer cells to survive during prolonged exposure to hypoxic stress, BNIP3 silencing may contribute to the progression of pancreatic cancer. Tumor hypoxia is thought to be associated with a malignant phenotype of tumors. Hypoxia increases the mutation rate of tumor cells, promotes metastatic potential and dedifferentiation, and decreases sensitivity to chemotherapy and radiation therapy (38, 39, 40) . Moreover, it has been shown that the hypoxic status of tumors correlates with increased recurrence and a shorter survival (41, 42, 43) . Therefore, it is strongly suggested that BNIP3 silencing contributes to aggressive biological nature of pancreatic cancer
In our effort to elucidate the mechanisms by which BNIP3 expression is down-regulated in pancreatic cancer tissues and cell lines, we found that CpG dinucleotides in the CpG island of the BNIP3 promoter are densely methylated. Hypermethylation in CpG-rich regions is found in many tumors including pancreatic cancer, and this event is associated with the inactivation of cancer-related genes such as p16, E-cadherin, and hMLH1 (44 , 45) . In the current study, methylation of the BNIP3 gene occurred in nine of 10 pancreatic cancer cell lines and eight of 10 human pancreatic cancer tissues. Although the number of samples was relatively small, our findings suggest that BNIP3 methylation is a frequent event in pancreatic cancer. Of note, PSN-1 cells, which showed BNIP3 expression in normoxic culture conditions and prominent induction by hypoxia, displayed almost totally unmethylated BNIP3 gene by sequencing, whereas all five BNIP3-negative cells had methylated BNIP3 genes. That BNIP3 silencing was due to gene methylation was confirmed using a DNA methylation inhibitor. After DNA demethylation, BNIP3 expression was elevated under normoxic cell culture conditions, and BNIP3 induction by hypoxia was also restored. These results indicate that methylation of the BNIP3 gene plays a key role in down-regulation of BNIP3. This is the first report describing methylation of BNIP3 gene in cancer, although a recent microarray study suggested that BNIP3 expression is induced after treatment of pancreatic cancer cells with a DNA methylation inhibitor (46) .
Based on the known pro-apoptotic role of BNIP3 in other cells and our data that BNIP3 was silenced in pancreatic cancer cells, we hypothesized that restoration of BNIP3 expression would increase the sensitivity of the cancer cells to apoptosis. We initially considered restoring hypoxia-inducible BNIP3 expression by using the demethylating agent. However, treatment with this agent is known to affect a large number of methylated genes including those involved in cell survival. Therefore, to more specifically restore BNIP3 expression, we generated a vector containing a full length of BNIP3 cDNA down-stream of the BNIP3 promoter and transfected this construct into Mia PaCa-2 cells. Wild-type Mia PaCa-2 cells have a methylated BNIP3 gene and do not express BNIP3 under normoxic or hypoxic conditions. Transfection with the BNIP3 promoter construct restored hypoxia-inducible BNIP3 expression, and after hypoxia, a greater number of cells were killed compared with mock-transfected cells. These results indicate that the restoration of hypoxia-induced BNIP3 expression renders pancreatic cancer cells more susceptible to hypoxia-induced cell death. In another words, the loss of BNIP3 induction by hypoxia due to gene methylation allows pancreatic cancer cells to avoid hypoxia-induced cell death.
In summary, the frequent inactivation of BNIP3 in pancreatic cancer and its role as an inducer of apoptosis support the role of this molecule as a tumor suppressor. The observation that BNIP3 expression is silenced while other hypoxia-regulated genes are induced suggests that BNIP3 silencing contributes to the survival and progression of pancreatic cancer in a hypoxic environment. Taken together, these observations suggest that BNIP3 reactivation might be a novel target for treatment of this disease.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Craig Logsdon, Department of Molecular and Integrative Physiology, Box 0622, 7710 Medical Sciences Building II, University of Michigan, Ann Arbor, MI 48109-0622. Phone: (734) 763-2539; Fax: (734) 936-8813; E-mail: clogsdon{at}umich.edu
Received 1/12/04. Revised 4/ 5/04. Accepted 5/11/04.
| REFERENCES |
|---|
|
|
|---|
: a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res, 59: 533-7, 1999.
in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 394: 485-90, 1998.[CrossRef][Medline]
subunit. J Biol Chem, 271: 32253-9, 1996.
is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA, 95: 7987-92, 1998.
(HIF-1
) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions: its stabilization by hypoxia depends on redox-induced changes. J Biol Chem, 272: 22642-7, 1997.
reduces tumorigenicity of pancreatic cancer cells through the suppression of glucose metabolism. Am J Pathol, 162: 1283-91, 2003.
in common human cancers and their metastases. Cancer Res, 59: 5830-5, 1999.
. Genes Dev, 12: 149-62, 1998.
and insulin-like growth factor 2. Cancer Res, 59: 3915-8, 1999.This article has been cited by other articles:
![]() |
M. Band, A. Joel, A. Hernandez, and A. Avivi Hypoxia-induced BNIP3 expression and mitophagy: in vivo comparison of the rat and the hypoxia-tolerant mole rat, Spalax ehrenbergi FASEB J, July 1, 2009; 23(7): 2327 - 2335. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Oshima, T. Akiyama, A. Hikita, M. Iwasawa, Y. Nagase, M. Nakamura, H. Wakeyama, N. Kawamura, T. Ikeda, U.-i. Chung, et al. Pivotal Role of Bcl-2 Family Proteins in the Regulation of Chondrocyte Apoptosis J. Biol. Chem., September 26, 2008; 283(39): 26499 - 26508. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Heller, W. M. Schmidt, B. Ziegler, S. Holzer, L. Mullauer, M. Bilban, C. C. Zielinski, J. Drach, and S. Zochbauer-Muller Genome-Wide Transcriptional Response to 5-Aza-2'-Deoxycytidine and Trichostatin A in Multiple Myeloma Cells Cancer Res., January 1, 2008; 68(1): 44 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, Y. Wang, E. Kim, P. Beemiller, C.-Y. Wang, J. Swanson, M. You, and K.-L. Guan Bnip3 Mediates the Hypoxia-induced Inhibition on Mammalian Target of Rapamycin by Interacting with Rheb J. Biol. Chem., December 7, 2007; 282(49): 35803 - 35813. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tracy, B. C. Dibling, B. T. Spike, J. R. Knabb, P. Schumacker, and K. F. Macleod BNIP3 Is an RB/E2F Target Gene Required for Hypoxia-Induced Autophagy Mol. Cell. Biol., September 1, 2007; 27(17): 6229 - 6242. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Mahon, P. Baril, V. Bhakta, C. Chelala, K. Caulee, T. Harada, and N. R. Lemoine S100A4 Contributes to the Suppression of BNIP3 Expression, Chemoresistance, and Inhibition of Apoptosis in Pancreatic Cancer Cancer Res., July 15, 2007; 67(14): 6786 - 6795. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishiguro, S. Iida, H. Uetake, S. Morita, H. Makino, K. Kato, Y. Takagi, M. Enomoto, and K. Sugihara Effect of Combined Therapy With Low-Dose 5-Aza-2'-Deoxycytidine and Irinotecan on Colon Cancer Cell Line HCT-15 Ann. Surg. Oncol., May 1, 2007; 14(5): 1752 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Wojdacz and A. Dobrovic Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation Nucleic Acids Res., March 19, 2007; 35(6): e41 - e41. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kroemer, L. Galluzzi, and C. Brenner Mitochondrial Membrane Permeabilization in Cell Death Physiol Rev, January 1, 2007; 87(1): 99 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. An, O. Maeng, K.-H. Kang, J.-O. Lee, Y.-S. Kim, S.-G. Paik, and H. Lee Activation of Ras Up-regulates Pro-apoptotic BNIP3 in Nitric Oxide-induced Cell Death J. Biol. Chem., November 10, 2006; 281(45): 33939 - 33948. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bandyopadhyay, R. Zhan, Y. Wang, S. K. Pai, S. Hirota, S. Hosobe, Y. Takano, K. Saito, E. Furuta, M. Iiizumi, et al. Mechanism of Apoptosis Induced by the Inhibition of Fatty Acid Synthase in Breast Cancer Cells Cancer Res., June 1, 2006; 66(11): 5934 - 5940. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Manka, Z. Spicer, and D. E. Millhorn Bcl-2/Adenovirus E1B 19 kDa Interacting Protein-3 Knockdown Enables Growth of Breast Cancer Metastases in the Lung, Liver, and Bone Cancer Res., December 15, 2005; 65(24): 11689 - 11693. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Akada, T. Crnogorac-Jurcevic, S. Lattimore, P. Mahon, R. Lopes, M. Sunamura, S. Matsuno, and N. R. Lemoine Intrinsic Chemoresistance to Gemcitabine Is Associated with Decreased Expression of BNIP3 in Pancreatic Cancer Clin. Cancer Res., April 15, 2005; 11(8): 3094 - 3101. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |