Cancer Research SABCS  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, Z. F.
Right arrow Articles by Fan, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, Z. F.
Right arrow Articles by Fan, S. T.
[Cancer Research 64, 5496-5503, August 1, 2004]
© 2004 American Association for Cancer Research


Regular Articles

The Potential Role of Hypoxia Inducible Factor 1{alpha} in Tumor Progression after Hypoxia and Chemotherapy in Hepatocellular Carcinoma

Zhen Fan Yang, Ronnie T. Poon, Jensen To, David W. Ho and Sheung Tat Fan

Centre for the Study of Liver Disease and Department of Surgery, The University of Hong Kong, Pokfulam, Hong Kong, China


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study investigates the possible molecular basis leading to failure in a treatment that is composed of hypoxia and chemotherapy in a rat orthotopic hepatoma model. Hypoxia was induced by hepatic artery ligation, whereas chemotherapeutic effect was achieved by intraportal injection of cisplatin. High-dose sodium salicylate was administered to achieve transcriptional blockade. Significant prolongation of animal survival was observed in the groups receiving hepatic artery ligation with cisplatin or sodium salicylate. Massive tumor cell necrosis and apoptosis were found in the ligation and all of the combined treatment groups. Up-regulation of hypoxia inducible factor 1{alpha} (HIF-1{alpha}) and vascular endothelial growth factor (VEGF) at both mRNA and protein levels were detected in the groups receiving ligation and ligation with cisplatin, whereas a decreased level of von Hippel-Lindau tumor suppressor protein was identified in the group receiving ligation with cisplatin. Sodium salicylate enhanced expression of von Hippel-Lindau tumor suppressor protein but down-regulated HIF-1{alpha} and VEGF levels after ligation with or without cisplatin. An increased number of activated hepatic stellate cells in the tumors were observed in the ligation and ligation with cisplatin groups, whereas they were greatly reduced by sodium salicylate. In vitro study revealed that under hypoxic condition, both cisplatin and sodium salicylate could remarkably augment P53 and caspase 3 levels. Cisplatin stimulated HIF-1{alpha} up-regulation, whereas sodium salicylate suppressed HIF-1{alpha} expression. In conclusion, tumor progression after hypoxia and chemotherapy might be related to up-regulation of HIF-1{alpha} and subsequent VEGF production, and transcriptional blockade by sodium salicylate could enhance the therapeutic efficacy of hypoxia and chemotherapy.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Induction of tumor hypoxia combined with chemotherapy by transcatheter arterial chemoembolization has been widely used in treating unresectable hepatocellular carcinoma (HCC; Refs. 1, 2, 3 ). Oxygen depletion arrests tumor cell proliferation and leads to apoptosis and necrosis (4, 5, 6) , and chemocytotoxicity of drugs, such as cisplatin, can "kill" tumor cells in HCC (7 , 8) . However, tumor response rate is unsatisfactory, and only a small population of patients benefit from this treatment protocol (1 , 9) . The mechanism that accounts for treatment failure is not clear.

Several genes may be activated under hypoxic condition, such as vascular endothelial growth factor (VEGF; Refs. 10 , 11 ), erythropoietin (12) , and glycolytic enzymes (13) , which are transcriptionally regulated by hypoxia inducible factor 1{alpha} (HIF-1{alpha}). As a key player in tumorigenesis and angiogenesis, HIF-1{alpha} overexpression is associated with an increased mortality and treatment failure in various cancers (14, 15, 16) . In addition, HIF-1{alpha} can regulate multidrug resistance gene (17) , and blocking the activity of HIF-1{alpha} can enhance the therapeutic efficacy of cancer immunotherapy (18) . However, the role of HIF-1{alpha} in HCC, especially its behavior after hypoxia and chemotherapy, is poorly understood.

Difficulties in obtaining clinical HCC samples after transcatheter arterial chemoembolization limit the opportunity to study genomic and molecular changes after the treatment, thus hindering the design of additional therapeutic strategies to enhance its efficacy. To solve the problem, we evaluated the molecular changes after tumor hypoxia and chemotherapy in a rat orthotopic hepatoma model by ligation of hepatic artery and injection of cisplatin into the portal vein and investigated the pattern of HIF-1{alpha} and its related gene alterations before and after treatment. In addition, a potential approach of blocking the activity of HIF-1{alpha} under hypoxia and chemotherapy by transcriptional inhibitor sodium salicylate was also studied.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Orthotopic Hepatoma Model in Rat Liver.
Male Buffalo rats, weighing 250–300 g, were purchased from Charles River Labs (Wilmington, MA). McA RH7777 rat hepatoma cell lines were purchased from the American Type Culture Collection (Manassas, VA). Cells were maintained as monolayer culture in DMEM with 10% fetal bovine serum and 1% penicillin (Life Technologies Inc., Carlsbad, CA) at 37°C in a humidified atmosphere of 5% CO2 in air. A total of 1 x 106 cells were resuspended in 0.5 ml 1x PBS and injected through the right portal vein (the left portal vein was blocked with a bulldog clamp). Ten days after cell injection, multiple nodules were found in the right lobe with the size ranging from 1 x 2 mm2 to 2 x 3 mm2.

A pilot study was performed to evaluate tumor hypoxia after hepatic artery ligation by using pimonidazole as a reference marker of tumor hypoxia (19 , 20) . By flow cytometry, we detected a >2-fold increase in the number of hypoxic cells that were isolated from tumor tissue on day 2 after hepatic artery ligation, compared with sham operation without hepatic artery ligation (data not shown), suggesting that hepatic artery ligation could enhance hypoxia in the tumor tissue.

Experimental Groups.
Ten days after tumor inoculation, the animals were randomly assigned to the following seven groups and underwent laparotomy: (a) sham operation (NT; n = 6); (b) cisplatin (Amersham and Upjohn, Buckinghamshire, United Kingdom) 3 mg/kg right portal vein injection (cis-; n = 6); (c) sodium salicylate 200 mg/kg right portal vein injection (Santa Cruz Biotechnology Inc., Santa Cruz, CA; S; n = 6); (d) hepatic artery (main branch) ligation (L; n = 6); (e) hepatic artery ligation combined with cisplatin 3 mg/kg right portal vein injection (L+cis-; cisplatin was injected immediately after hepatic artery ligation; n = 6); (f) hepatic artery ligation combined with sodium salicylate 200 mg/kg right portal vein injection (L+S; n = 6); and (g) hepatic artery ligation combined with cisplatin and sodium salicylate intraportal injection (L+cis-+S; n = 6). Another 3 animals in each group were killed respectively on day 0 or day 2 after the second laparotomy for tissue collection (including tumor and adjacent nontumorous tissues). Plasma samples (obtained from 0.5 ml of whole blood) were collected on days 0, 2, and 7 after treatment (three samples for each time point in each group). The time period between the day of tumor inoculation and the day of the death of the animal was recorded as survival time.

Histological Studies.
When the animals were killed, half of the tissues were fixed in 10% buffered formalin and embedded in paraffin, whereas another half of the tissues were snap-frozen in liquid nitrogen. The paraffin-embedded tissue was cut into 5 µm-thick sections for histological studies by H&E staining and immunohistochemical staining of smooth muscle actin (sma). All of the antibodies and reagents for immunohistochemistry were purchased from Dako Corporation (Carpinteria, CA). The paraffin sections were also used to detect apoptotic cells by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (Roche, Basel, Switzerland). Five fields were randomly chosen in each slide, and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling-positive cells were counted using the Metamorph software (Universal Imaging Corporation, Downingtown, PA) under the magnification of x200.

Reverse Transcription-PCR, Western Blotting, and ELISA.
Total RNA was extracted from the snap-frozen tissue using RNeasy Mini kit (Qiagen Inc., Valencia, CA). Reverse transcription-PCR was used to detect HIF-1{alpha} and VEGF mRNA levels. Primer sequences for rat HIF-1{alpha} were sense, 5' GATCAGCCAGCAAGTCCTTC 3' and antisense, 5' GGAGCTGTGAATGTGCTGTG 3'. Primer sequences for rat VEGF were designed according to Liu et al. (21) . The protein levels of HIF-1{alpha} and VEGF were determined by standard Western blotting protocol using 12% SDS-PAGE gel. Antibodies were purchased from Calbiochem (San Diego, CA; monoclonal mouse antirat HIF-1{alpha} antibody), Stressgen Biotechnologies (Victoria, British Columbia, Canada; monoclonal mouse antirat heat shock protein 90; Hsp 90), Santa Cruz Biotechnology Inc. (Santa Cruz, CA; monoclonal mouse antirat VEGF and polyclonal goat antirat von Hippel-Lindau tumor suppressor protein; pVHL), and Dako Corporation (monoclonal mouse antirat sma). The plasma levels of VEGF were detected by ELISA (ELISA kit; R&D Systems Inc., Minneapolis, MN).

Liver Function Tests.
Liver biochemistry, including plasma levels of total bilirubin, alanine aminotransferase, and aspartate aminotransferase, was tested in the clinical biochemistry laboratory.

In Vitro Study.
McA RH7777 rat hepatoma cell lines were cultured as described previously. When cells were 80–90% confluent, the following reagents were added to the culture medium, respectively, and incubated for 24 h: 5 µM cisplatin, 400 µM desferrioxamine (DFX, Sigma-Aldrich, St. Louis, MO; to mimic hypoxic condition), 5 mM sodium salicylate, cisplatin combined with sodium salicylate, DFX with cisplatin, DFX with sodium salicylate, and DFX with both cisplatin and sodium salicylate. The cells were harvested to detect the levels of HIF-1{alpha}, P53 (Santa Cruz Biotechnology), Bcl-xL (Zymed Laboratories Inc., South San Francisco, CA), and caspase 3 (Upstate, Waltham, MA) by Western blotting analysis.

Statistical Analysis.
Animal survival was analyzed by log-rank test using the GraphPad Prism software (GraphPad Software Inc., San Diego, CA). Comparisons of liver function parameters, plasma levels of VEGF, and the number of apoptotic cells between different treatment groups were performed using One-way ANOVA. P < 0.05 was considered statistically significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hepatic Artery Ligation Combined with Cisplatin or Sodium Salicylate Intraportal Injection Could Significantly Prolong Animal Survival.
When no treatment was given, all of the animals died within 30 days (median, 20.5 days). Cisplatin (cis-), sodium salicylate (S), or hepatic artery ligation (L) alone could not prolong animal survival. However, when hepatic artery ligation was combined with cisplatin (L+cis-) or sodium salicylate (L+S), significant prolongation of animal survival was achieved (median survival, 29.5 and 47 days; P = 0.01 and P = 0.005, respectively, compared with sham operation). Interestingly, when hepatic artery ligation was combined with both cisplatin and sodium salicylate (L+cis-+S), there was a trend toward prolongation of survival (median survival, 40 days), but the difference (compared with sham operation) was not statistically significant (P = 0.08; Fig. 1Citation ).



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Survival curve of different treatment groups. There was no significant difference between the sham operation (NT) group and groups receiving cisplatin (cis-), sodium salicylate (S), and hepatic artery ligation (L) alone. Significant prolongation of animal survival was observed in groups receiving hepatic artery ligation with cisplatin (L+cis-) and hepatic artery ligation with sodium salicylate (L+S). *, P < 0.05, compared with sham operation. {blacksquare}, group a (NT); {bullet}, group b (cis-); {blacktriangleup}, group c (S); {diamondsuit}, group d (L); {circ}, group e (L + cis-); {triangleup}, group f (L + S); {square}, group g (L + cis- + S).

 
Massive Tumor Cell Necrosis and Apoptosis Were Induced by Hepatic Artery Ligation and Combination Treatment.
Two days after the second laparotomy, some areas of necrosis were found on the surface of the right lobe in groups e (L+cis-), f (L+S), and g (L+cis-+S). Microscopically, scattered areas of tumor necrosis were observed in groups b (cis-) and c (S), whereas extensive tumor cell necrosis was found in groups d (L), e (L+cis-), f (L+S), and g (L+cis-+S; Fig. 2Citation ). By terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining, a significantly increased number of apoptotic cells were detected in the non-necrotic areas of all of the treatment groups compared with sham operation (Figs. 3, A and B)Citation .



View larger version (137K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Histological studies of tumor tissues on day 2 after treatment. Scattered areas of necrosis were found in the groups receiving cisplatin (cis-) and sodium salicylate (S) only treatment, whereas massive necrosis was detected in the groups receiving hepatic artery ligation (L), hepatic artery ligation with cisplatin (L+cis-), hepatic artery ligation with sodium salicylate (L+S), and hepatic artery ligation with cisplatin and sodium salicylate (L+cis-+S). Magnification, x100.

 


View larger version (95K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Detection of apoptotic cells in tumor tissue by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. A, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining. Arrows pointed to apoptotic nuclei. Magnification, x200. B, the graph demonstrated that all of the treatments could induce an increased number of apoptotic cells in tumor tissue. *, P < 0.01, compared with sham operation. Representative of three animals in each group. NT, sham operation group; cis-, groups receiving cisplatin; S, groups receiving sodium salicylate; L, groups receiving hepatic artery ligation.

 
Hepatic Artery Ligation and Ligation Combined with Cisplatin Stimulated Both HIF-1{alpha} and VEGF Up-Regulation.
Forty-eight h after treatment, remarkable up-regulation of HIF-1{alpha} and VEGF mRNA and protein levels in tumor were detected in both groups d (L) and e (L+cis-), especially in group e. However, when hepatic artery ligation was combined with sodium salicylate or both cisplatin and sodium salicylate, the expression of HIF-1{alpha} and VEGF was decreased significantly (Fig. 4)Citation . Two days after treatment, a significant increase of plasma VEGF was detected in group e (L+cis-) compared with sham operation, whereas the elevation was greatly reduced in group f (L+S). Seven days after treatment, even higher levels of VEGF in plasma were determined in groups d and e, whereas significantly reduced levels of plasma VEGF were detected in groups f (L+S) and g (L+cis-+S; Fig. 5Citation ).



View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Determination of (A) hypoxia-inducible factor 1{alpha} (HIF-1{alpha}) and vascular endothelial growth factor (VEGF) mRNA (by reverse transcription-PCR) and (B) protein (by Western blotting) levels in tumor tissue. Remarkably, increased expression of HIF-1{alpha} and VEGF was detected at both mRNA and protein levels in the groups receiving hepatic artery ligation (L) and hepatic artery ligation combined with cisplatin (L+cis-). Representative of three animals in each group.

 


View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Detection of soluble vascular endothelial growth factor (VEGF) levels in plasma by ELISA. A remarkably elevated plasma level of VEGF was measured in the group receiving hepatic artery ligation combined with cisplatin (L+cis-), whereas administration of sodium salicylate with hepatic artery ligation (L+S) greatly reduced the plasma level of VEGF. *, P < 0.05, compared sham operation; #, P < 0.05, compared with hepatic artery ligation; {diamondsuit}, P < 0.05, compared with hepatic artery ligation combined with cisplatin; otherwise no significant difference between groups; bars, ±SD.

 
Levels of pVHL and Hsp 90 in Tumor Were Decreased by Hepatic Artery Ligation Combined with Cisplatin.
pVHL and Hsp 90 are two important molecules in the ubiquitination and proteasomal degradation of HIF-1{alpha} (22, 23, 24, 25) . Western blotting was performed to compare the levels of these two proteins among different treatment groups. The use of cisplatin or hepatic artery ligation alone did not obviously affect the expression of pVHL and Hsp 90 in tumor tissue on day 2 after treatment compared with the sham operation. Interestingly, when hepatic artery ligation was combined with cisplatin, the pVHL and Hsp 90 levels were down-regulated dramatically in the pVHL level. However, the level of pVHL could be augmented by sodium salicylate under both normoxic and hypoxic conditions. In contrast, sodium salicylate did not affect the level of Hsp 90 (Fig. 6)Citation .



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Determination of von Hippel-Lindau tumor suppressor protein (pVHL) and heat shock protein 90 (Hsp 90) protein levels in tumor tissue by Western blotting. The approaches of hepatic artery ligation (L) and hepatic artery ligation with cisplatin (L+cis-) dramatically reduced the level of pVHL in tumor tissue, whereas sodium salicylate (S) enhanced the expression of pVHL. Hepatic artery ligation with cisplatin also decreased the level of Hsp 90. Representative of three animals in each group.

 
Hepatic Artery Ligation Stimulated Hepatic Stellate Cell Activation.
To explore the types of cells that might contribute to the angiogenesis and tumor progression after hypoxia and chemotherapy, immunohistochemical staining was performed using sma as a marker to identify hepatic stellate cells in tumor tissue. A significantly increased number of sma-positive cells was detected in tumor tissues in groups d (L) and e (L+cis-) 2 days after treatment, whereas these sma-positive cells could be greatly reduced by addition of sodium salicylate or both cisplatin and sodium salicylate to hepatic artery ligation (Fig. 7A)Citation . When the sma protein levels were quantified by Western blotting, a similar picture could be detected (Fig. 7B)Citation .



View larger version (115K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Identification of hepatic stellate cells (labeled by smooth muscle actin; sma) in tumor tissue by (A) immunohistochemical staining and (B) Western blotting. The number of sma-positive cells were greatly increased in the groups receiving hepatic artery ligation (L) and hepatic artery ligation with cisplatin (L+cis-), whereas sodium salicylate (L+S and L+cis-+S) administration diminished the expression of sma.

 
Effects of Various Treatment Regimens on Nontumorous Tissue and Liver Function.
The expression of HIF-1{alpha}, VEGF, pVHL, and Hsp 90 in adjacent nontumorous tissue was evaluated by Western blotting, and liver biochemistry was also tested. Despite a slight increase of HIF-1{alpha} and VEGF expression in nontumorous tissue of groups d (L) and e (L+cis-), there was no obvious difference in pVHL and Hsp 90 protein levels between different treatment groups (Fig. 8)Citation . Liver biochemistry tests demonstrated that hepatic artery ligation and all of the three combination treatments increased the plasma levels of both alanine aminotransferase and aspartate aminotransferase on days 2 and 7 after treatment, whereas they did not affect plasma total bilirubin levels (Fig. 9)Citation .



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Effects of different regimens on the expression of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}), vascular endothelial growth factor (VEGF), von Hippel-Lindau tumor suppressor protein (pVHL), and heat shock protein 90 (Hsp 90) in nontumorous tissue by Western blotting. No obvious difference was detected between different treatment groups.

 


View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Determination of liver biochemistry in different treatment groups. Sodium salicylate (S) and all of the combined treatments (L+cis-, L+S, and L+cis-+S) significantly elevated the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels in plasma on both days 2 and 7 after treatment. *, P < 0.05, compared with sham operation; otherwise no significant difference between groups; bars, ±SD.

 
Cisplatin and Sodium Salicylate Had Similar Effects on the Apoptotic Pathway but Different Effects on Survival Pathway.
To explore the possible mechanism of cisplatin and sodium salicylate under hypoxic condition, hepatoma cells were cultured with different combinations of treatment. Cisplatin and sodium salicylate alone could induce P53, Bcl-xL, and caspase 3 up-regulation, and these effects were additionally enhanced when DFX was added. However, when cisplatin was combined with DFX, a significant up-regulation of HIF-1{alpha} was detected, whereas the expression of HIF-1{alpha} was eliminated when sodium salicylate was cocultured with DFX (Fig. 10)Citation .



View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 10. In vitro study demonstrated that under hypoxic condition (induced by desferrioxamine; DFX), both cisplatin (cis-) and sodium salicylate (S) could significantly enhance P53 and caspase 3 expression in McA RH7777 cell lines, with a slight augmentation in Bcl-xL level. Both cisplatin and DFX induced remarkable increased expression of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}), whereas the up-regulation was blocked by sodium salicylate. Representative of three independent experiments.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we introduced hypoxia (hepatic artery ligation) and intraportal chemotherapy (cisplatin) in a rat orthotopic hepatoma model to mimic clinical transcatheter arterial chemoembolization treatment and investigated the behavior of HIF-1{alpha} and its related genes. Ackerman et al. (26) showed that small hepatic tumors were preferentially supplied by portal vein, whereas large tumors were supplied by the hepatic artery. In this study, we inoculated multiple tumor nodules to mimic an advanced HCC stage, and theoretically the tumor was predominantly supplied by hepatic artery. By using pimonidazole as a marker of tumor hypoxia (19 , 20) , we demonstrated that hepatic artery ligation could enhance hypoxia in the tumor tissue. Because of the difficulty in introducing chemotherapy transarterially in a rat model, we gave cisplatin by portal vein injection. In fact, before the availability of transarterial chemoembolization, hepatic artery ligation and intraportal injection of cytotoxic drugs had been used in the management of HCC (27) .

In our study, significant prolongation of animal survival could be achieved by hepatic artery ligation combined with cisplatin. However, conflicting results have been reported about the efficacy of cisplatin under hypoxic condition (28 , 29) . The molecular basis concerning sensitivity of tumor cells to chemotherapy under hypoxia remains largely unclear. The status of tumor cells might play a crucial role. As shown in our data, although the antiapoptotic gene Bcl-xL was activated by hypoxia, the final outcome of hypoxia combined with cisplatin was still a significantly up-regulated proapoptotic molecule, caspase 3, which led to tumor cell apoptosis, indicating that the balance between "death" and "survival" signals determined the "fate" of tumor cells.

To our knowledge, this is the first study that evaluates the possible molecular mechanism of tumor progression after combined hypoxia and chemotherapy treatment of HCC. Our study demonstrated that HIF-1{alpha} and VEGF could be activated by hepatic artery ligation and ligation combined with cisplatin, indicating that angiogenesis and tumor progression might occur after hypoxia and chemotherapy, thus reversing the therapeutic effects. Blocking the transcriptional activation of HIF-1{alpha} under hypoxic condition by high-dose sodium salicylate could enhance the efficacy of hepatic artery ligation, leading to prolongation of animal survival.

An interesting finding in the present study was the expression pattern of pVHL in different treatment groups. The combination of hepatic artery ligation with cisplatin diminished the level of pVHL, indicating that the predominant up-regulation of HIF-1{alpha} in this group might be related to the drastic decrease of pVHL. In contrast, sodium salicylate increased the expression of pVHL, providing another evidence of the inhibitory effects of this drug on HIF-1{alpha} expression in addition to transcriptional blockade. Although some studies also reported the enhancement effects of nonsteroidal anti-inflammatory drugs on pVHL expression (30) , the mechanism was still not clear. On the other hand, administration of sodium salicylate did not obviously affect the level of Hsp 90, suggesting that the repression effects of sodium salicylate on HIF-1{alpha} were independent of Hsp 90.

Tumor cells might induce other types of cell activation for remodeling and migrating during tumor growth. One of the cell types that could be activated by tumor cells was the hepatic stellate cells that infiltrated the tumor (31 , 32) . Besides the ability to synthesize VEGF, a recent study revealed that hepatic stellate cells were also involved in the formation of new blood vessels in tumor tissue under hypoxic condition (33) . In the present study, we also found an increased number of sma (a marker of activated hepatic stellate cells) -positive cells in groups receiving hepatic artery ligation and ligation combined with cisplatin treatment, suggesting that hepatic stellate cells might be an important target to control hypoxia-induced tumor growth in the liver. Interestingly, administration of sodium salicylate under hypoxic condition remarkably inhibited the activation of hepatic stellate cells. One possible reason is that the activation of hepatic stellate cells involves cyclooxygenase 2 (34) , whereas sodium salicylate is a potent cyclooxygenase 2 inhibitor (35 , 36) .

In this study, the influence of all of the treatment regimens on normal tissue and liver function was also investigated. Although we could detect an increased expression of HIF-1{alpha} and VEGF in the adjacent nontumorous tissue after hepatic artery ligation, the levels were much lower than those in tumor tissue, suggesting that tumor cells responded more aggressively to hypoxic condition. Liver biochemistry results revealed that hepatic artery ligation and all of the combination treatments resulted in elevation of plasma levels of aminotransferases. However, the damaging effects on liver function appeared to be well tolerated, because all of the animals (except some animals in the three-combination treatment group) could recover from the second laparotomy.

The difference of therapeutic efficacy between cisplatin and sodium salicylate under hypoxic condition indicated that they might function differently on cell death. However, the only difference revealed by the in vitro study was their effects on HIF-1{alpha} expression, which is involved in the cell survival pathway, whereas they functioned similarly on the cell death pathway by predominant up-regulation of proapoptotic molecules P53 and caspase 3 and a slight enhancement of antiapoptotic molecule Bcl-xL indicating that blocking of the tumor cell survival pathway after hypoxia and chemotherapy might play a more important role in achieving therapeutic purposes. This is crucial in the clinical settings, because not all of the tumor cells can be "killed" by the transcatheter arterial chemoembolization treatment, and the residual tumor cells may progress more aggressively through activation of the survival pathway.

In conclusion, this study revealed that: (a) after hypoxia and chemotherapy, tumor progression and angiogenesis might occur, probably through HIF-1{alpha}-dependent activation of proangiogenic factors and cells; and (b) suppressing the activity of HIF-1{alpha} by high-dose sodium salicylate could block the angiogenic processes, thus improving animal survival.


    FOOTNOTES
 
Grant support: Distinguished Research Achievement Award and Sun Chieh Yeh Research Foundation for Hepatobiliary and Pancreatic Surgery of the University of Hong Kong.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Z.F. Yang and R.T. Poon contributed equally to this work.

Requests for reprints: Ronnie Tung-Ping Poon, Department of Surgery, University of Hong Kong Medical Centre, Queen Mary Hospital, 102 Pokfulam Road, Hong Kong, China. Phone: 852-2855-3635; Fax: 852-2817-5475; E-mail: poontp{at}hkucc.hku.hk

Received 10/24/03. Revised 5/28/04. Accepted 6/ 3/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lo CM, Ngan H, Tso WK, et al Randomized controlled trial of transarterial lipiodol chemoembolization for unresectable hepatocellular carcinoma. Hepatology, 35: 1164-71, 2002.[CrossRef][Medline]
  2. Ando E, Tanaka M, Yamashita F, et al Hepatic arterial infusion chemotherapy for advanced hepatocellular carcinoma with portal vein tumor thrombosis: analysis of 48 cases. Cancer, 95: 588-95, 2002.[CrossRef][Medline]
  3. Llovet JM, Bruix J. Systematic review of randomized trials for unresectable hepatocellular carcinoma: chemoembolization improves survival. Hepatology, 37: 429-42, 2003.[CrossRef][Medline]
  4. Achison M, Hupp TR. Hypoxia attenuates the p53 response to cellular damage. Oncogene, 22: 3431-40, 2003.[CrossRef][Medline]
  5. Harris AL. Hypoxia – a key regulatory factor in tumour growth. Nat Rev Cancer, 2: 38-47, 2002.[CrossRef][Medline]
  6. Carmeliet P, Dor Y, Herbert JM, et al Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 394: 485-90, 1998.[CrossRef][Medline]
  7. Leung TW, Yu S, Johnson PJ, et al Phase II study of the efficacy and safety of cisplatin-epinephrine injectable gel administered to patients with unresectable hepatocellular carcinoma. J Clin Oncol, 21: 652-8, 2003.[Abstract/Free Full Text]
  8. Sangro B, Rios R, Bilbao I, et al Efficacy and toxicity of intra-arterial cisplatin and etoposide for advanced hepatocellular carcinoma. Oncology, 62: 293-8, 2002.[CrossRef][Medline]
  9. O’Suilleabhain CB, Poon RT, Yong JL, Ooi GC, Tso WK, Fan ST. Factors predictive of 5-year survival after transarterial chemoembolization for inoperable hepatocellular carcinoma. Br J Surg, 90: 325-31, 2003.[CrossRef][Medline]
  10. Levy AP, Levy NS, Wegner S, Goldberg MA. Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J Biol Chem, 270: 13333-40, 1995.[Abstract/Free Full Text]
  11. Levy AP, Levy NS, Goldberg MA. Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J Biol Chem, 271: 2746-53, 1996.[Abstract/Free Full Text]
  12. Jelkmann W, Hellwig-Burgel T. Biology of erythropoietin. Adv Exp Med Biol, 502: 169-87, 2001.[Medline]
  13. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 86: 353-64, 1996.[CrossRef][Medline]
  14. Semenza GL. HIF-1 and tumor progression: pathophysiology and therapeutics. Trends Mol Med, 8: S67 2002.
  15. Höckel M, Vaupel P. Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects. J Natl Cancer Inst, 93: 266-76, 2001.[Abstract/Free Full Text]
  16. Unruh A, Ressel A, Mohamed HG, et al The hypoxia-inducible factor-1 alpha is a negative factor for tumor therapy. Oncogene, 22: 3213-20, 2003.[CrossRef][Medline]
  17. Comerford KM, Wallace TJ, Karhausen J, Louis NA, Montalto MC, Colgan SP. Hypoxia-inducible factor-1-dependent regulation of the multidrug resistance (MDR1) gene. Cancer Res, 62: 3387-94, 2002.[Abstract/Free Full Text]
  18. Sun X, Kanwar JR, Leung E, Lehnert K, Wang D, Krissansen GW. Gene transfer of antisense hypoxia inducible factor-1 alpha enhances the therapeutic efficacy of cancer immunotherapy. Gene Ther, 8: 638-45, 2001.[CrossRef][Medline]
  19. Olive PL, Durand RE, Raleigh JA, Luo C, Aquino-Parsons C. Comparison between the comet assay and pimonidazole binding for measuring tumour hypoxia. Br J Cancer, 83: 1525-31, 2000.[CrossRef][Medline]
  20. Vordermark D, Brown JM. Evaluation of hypoxia-inducible factor-1alpha (HIF-1alpha) as an intrinsic marker of tumor hypoxia in U87 MG human glioblastoma: in vitro and xenograft studies. Int J Radiat Oncol Biol Phys, 56: 1184-93, 2003.[CrossRef][Medline]
  21. Liu MY, Poellinger L, Walker CL. Up-regulation of hypoxia-inducible factor 2alpha in renal cell carcinoma associated with loss of Tsc-2 tumor suppressor gene. Cancer Res, 63: 2675-80, 2003.[Abstract/Free Full Text]
  22. Krek W. VHL takes HIF’s breath away. Nat Cell Biol, 2: E121-3, 2000.[CrossRef][Medline]
  23. Maxwell PH, Wiesener MS, Chang GW, et al The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature, 399: 271-5, 1999.[CrossRef][Medline]
  24. Minet E, Mottet D, Michel G, et al Hypoxia-induced activation of HIF-1: role of HIF-1alpha-Hsp 90 interaction. FEBS Lett, 460: 251-6, 1999.[CrossRef][Medline]
  25. Isaacs JS, Jung YJ, Mimnaugh EG, Martinez A, Cuttitta F, Neckers LM. Hsp 90 regulates a von Hippel Lindau-independent hypoxia-inducible factor-1 alpha-degradative pathway. J Biol Chem, 277: 29936-44, 2002.[Abstract/Free Full Text]
  26. Ackerman NB, Lien WM, Kondi ES, Silverman NA. The blood supply of experimental liver metastases. I. The distribution of hepatic artery and portal vein blood to "small" and "large" tumors. Surgery, 66: 1067-72, 1969.[Medline]
  27. Nagasue N, Inokuchi K, Kobayashi M, Ogawa Y, Iwaki A. Hepatic dearterialization for nonrespectable primary and secondary tumors of the liver. Cancer, 38: 2593-603, 1976.[CrossRef][Medline]
  28. Koch S, Mayer F, Honecker F, Schittenhelm M, Bokemeyer C. Efficacy of cytotoxic agents used in the treatment of testicular germ cell tumours under normoxic and hypoxic conditions in vitro. Br J Cancer, 89: 2133-9, 2003.[CrossRef][Medline]
  29. von Pawel J, von Roemeling R, Gatzemeier U, et al Tirapazamine plus cisplatin versus cisplatin in advanced non-small-cell lung cancer: A report of the international CATAPULT I study group. Cisplatin and Tirapazamine in Subjects with Advanced Previously Untreated Non-Small-Cell Lung Tumors. J Clin Oncol, 18: 1351-9, 2000.[Abstract/Free Full Text]
  30. Jones MK, Szabo IL, Kawanaka H, Husain SS, Tarnawski AS. von Hippel Lindau tumor suppressor and HIF-1alpha: new targets of NSAIDs inhibition of hypoxia-induced angiogenesis. FASEB J, 16: 264-6, 2002.[Abstract/Free Full Text]
  31. Olaso E, Santisteban A, Bidaurrazaga J, Gressner AM, Rosenbaum J, Vidal-Vanaclocha F. Tumor-dependent activation of rodent hepatic stellate cells during experimental melanoma metastasis. Hepatology, 26: 634-42, 1997.[CrossRef][Medline]
  32. Faouzi S, Lepreux S, Bedin C, et al Activation of cultured rat hepatic stellate cells by tumoral hepatocytes. Lab Investig, 79: 485-93, 1999.[Medline]
  33. Olaso E, Salado C, Egilegor E, et al Proangiogenic role of tumor-activated hepatic stellate cells in experimental melanoma metastasis. Hepatology, 37: 674-85, 2003.[CrossRef][Medline]
  34. Gallois C, Habib A, Tao J, et al Role of NF-kappaB in the antiproliferative effect of endothelin-1 and tumor necrosis factor-alpha in human hepatic stellate cells. Involvement of cyclooxygenase-2. J Biol Chem, 273: 23183-90, 1998.[Abstract/Free Full Text]
  35. Cieslik K, Zhu Y, Wu KK. Salicylate suppresses macrophage nitric-oxide synthase-2 and cyclo-oxygenase-2 expression by inhibiting CCAAT/enhancer-binding protein-beta binding via a common signaling pathway. J Biol Chem, 277: 49304-10, 2002.[Abstract/Free Full Text]
  36. Amann R, Peskar BA. Anti-inflammatory effects of aspirin and sodium salicylate. Eur Pharmacol, 447: 1-9, 2002.



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
C. K. Lau, Z. F. Yang, D. W. Ho, M. N. Ng, G. C.T. Yeoh, R. T.P. Poon, and S. T. Fan
An Akt/Hypoxia-Inducible Factor-1{alpha}/Platelet-Derived Growth Factor-BB Autocrine Loop Mediates Hypoxia-Induced Chemoresistance in Liver Cancer Cells and Tumorigenic Hepatic Progenitor Cells
Clin. Cancer Res., May 15, 2009; 15(10): 3462 - 3471.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Amann, U. Maegdefrau, A. Hartmann, A. Agaimy, J. Marienhagen, T. S. Weiss, O. Stoeltzing, C. Warnecke, J. Scholmerich, P. J. Oefner, et al.
GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
Am. J. Pathol., April 1, 2009; 174(4): 1544 - 1552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Roentgenol.Home page
R. J. Viola, J. M. Provenzale, F. Li, C.-Y. Li, H. Yuan, J. Tashjian, and M. W. Dewhirst
In Vivo Bioluminescence Imaging Monitoring of Hypoxia-Inducible Factor 1{alpha}, a Promoter That Protects Cells, in Response to Chemotherapy
Am. J. Roentgenol., December 1, 2008; 191(6): 1779 - 1784.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Weidemann, W. M. Bernhardt, B. Klanke, C. Daniel, B. Buchholz, V. Campean, K. Amann, C. Warnecke, M. S. Wiesener, K.-U. Eckardt, et al.
HIF Activation Protects From Acute Kidney Injury
J. Am. Soc. Nephrol., March 1, 2008; 19(3): 486 - 494.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
T. W. Young, F. C. Mei, D. G. Rosen, G. Yang, N. Li, J. Liu, and X. Cheng
Up-regulation of Tumor Susceptibility Gene 101 Protein in Ovarian Carcinomas Revealed by Proteomics Analyses
Mol. Cell. Proteomics, February 1, 2007; 6(2): 294 - 304.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Z. F. Yang, R. T.P. Poon, Y. Liu, C. K. Lau, D. W. Ho, K. H. Tam, C. T. Lam, and S. T. Fan
High doses of tyrosine kinase inhibitor PTK787 enhance the efficacy of ischemic hypoxia for the treatment of hepatocellular carcinoma: dual effects on cancer cell and angiogenesis.
Mol. Cancer Ther., September 1, 2006; 5(9): 2261 - 2270.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. O. Ibrahim, T. Hahn, C. Franke, D. P. Stiehl, R. Wirthner, R. H. Wenger, and D. M. Katschinski
Induction of the Hypoxia-Inducible Factor System by Low Levels of Heat Shock Protein 90 Inhibitors
Cancer Res., December 1, 2005; 65(23): 11094 - 11100.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T. Tanaka, I. Kojima, T. Ohse, R. Inagi, T. Miyata, J. R. Ingelfinger, T. Fujita, and M. Nangaku
Hypoxia-inducible factor modulates tubular cell survival in cisplatin nephrotoxicity
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1123 - F1133.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, Z. F.
Right arrow Articles by Fan, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, Z. F.
Right arrow Articles by Fan, S. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online