Cancer Research Audrey Hepburn  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomkova, K.
Right arrow Articles by Zaika, A. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomkova, K.
Right arrow Articles by Zaika, A. I.
[Cancer Research 64, 6390-6393, September 15, 2004]
© 2004 American Association for Cancer Research


Advances in Brief

p73 Isoforms Can Induce T-Cell Factor–Dependent Transcription in Gastrointestinal Cells

Katarina Tomkova, Abbes Belkhiri, Wael El-Rifai and Alexander I. Zaika

Digestive Health Center of Excellence, University of Virginia Health System, Charlottesville, Virginia


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
A new p53 family member, p73, and its isoform {Delta}Np73 are increasingly recognized in cancer research as important players in tumorigenesis, as well as in chemotherapeutic drug sensitivity. Despite substantial structural similarities to p53, accumulating evidence suggests that p53 and p73 may play different roles in human tumorigenesis. In this study, we have investigated the role of p73 and {Delta}Np73 in upper gastrointestinal tumorigenesis. Our results indicate that p73 and {Delta}Np73 are frequently overexpressed in >60% of primary adenocarcinomas of the stomach and esophagus. We have demonstrated that this overexpression can lead to the suppression of p73 transcriptional and apoptotic activity in gastrointestinal cells. Moreover, it induces ß-catenin up-regulation and T-cell factor/lymphocyte enhancement factor–dependent transcription. Wild-type p53, but not mutant p53, can inhibit this effect. Our results demonstrate a novel mechanism for activation of ß-catenin in gastrointestinal tumors and support the concept that overexpression of p73 isoforms can play an important role in tumorigenesis.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Upper gastrointestinal carcinomas (UGCs), adenocarcinomas of the stomach and the esophagus, are the second most common cause of cancer death worldwide, with 1,288,000 new cases reported in the year 2000. Moreover, proximal tumors such as gastroesophageal junction and esophageal adenocarcinomas have the most rapidly rising incidence of all visceral malignancies in the United States and industrialized Western world, for reasons that are unclear (1) .

A number of defects in regulatory molecules and cell signaling pathways have been demonstrated to occur in upper gastrointestinal tumors. ß-Catenin, a pivotal constituent of the Wnt signaling pathway, is considered to be one such critical molecule. Under normal conditions, ß-catenin is a structural component of cell-cell adhesive interactions, and it can also function as a transcription factor. On transcriptional activation, ß-catenin translocates to the nucleus, where, together with T-cell factor (TCF)/lymphocyte enhancement factor transcriptional cofactors, it induces the expression of a number of target genes involved in the regulation of cellular proliferation. In cancer cells, ß-catenin is typically activated through mutations in APC (a regulator of ß-catenin protein stability) or in ß-catenin itself. Although several studies have reported abnormal expression and localization of ß-catenin in UGCs (for review, see ref. 2 ), mutations in the ß-catenin and APC genes are relatively rare in these tumors, suggesting that there are other mechanisms of ß-catenin activation (2) .

The p73 transcription factor was recently identified as a member of the p53 tumor suppressor family. Ectopically overexpressed p73 largely mimics p53 activities, including transactivation of an overlapping set of target genes, induction of cell cycle arrest, and apoptosis. In contrast to p53, the p73 gene gives rise to multiple proteins with functionally different properties. The properties of p73{alpha} and p73ß, the most studied of all p73 isoforms, are similar to those of p53 when overexpressed. On the other hand, a recently discovered oncogenic isoform of p73, termed {Delta}Np73, can interfere with p53 function (3 , 4) .

The role of the p73 gene in human tumorigenesis is not well understood. Here we show that p73 and {Delta}Np73 are specifically overexpressed in UGCs, which leads to suppression of p73 transcriptional and apoptotic activity, as well as to increased ß-catenin protein levels and activation of TCF-dependent transcription.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Culture, Vectors, and Transfections.
The gastric cancer cell lines AGS and Kato III (American Type Culture Collection, Manassas, VA) were maintained in Ham’s F-12 and RPMI 1640 media (Invitrogen, Carlsbad, CA), respectively, supplemented with 10% fetal bovine serum. Expression plasmids for human p73{alpha}, p73ß, and {Delta}Np73{alpha} have been described previously (3) . PG13-luc, a p53 (p73) reporter plasmid, and a dominant-negative TCF construct were kindly provided by Dr. Bert Vogelstein at the Johns Hopkins University School of Medicine, Baltimore, MD. The luciferase reporters pTOP and pFOP were purchased from Upstate Biotechnology (Waltham, MA). Cells were transfected using LipofectAMINE 2000 (Invitrogen) or FuGENE 6 (Roche, Indianapolis, IN) reagents.

Tissue Preparation and Real-Time Reverse Transcription-Polymerase Chain Reaction Analysis.
For quantitative real-time real-time reverse transcription-polymerase chain reaction (RT-PCR), 24 primary gastric, gastroesophageal junctional, and esophageal adenocarcinomas and 10 normal gastric epithelial samples were collected from patients at the University of Virginia according to a protocol approved by the Institutional Review Board. All tumors were dissected from frozen tissue specimens and had at least 75% tumor cell content, with the least possible amount of contaminating necrotic, inflammatory, and stromal cells. The normal gastric mucosal epithelial tissues were examined carefully, and they were devoid of any inflammatory or necrotic contaminating cells. Real-time RT-PCR analysis was conducted as described previously (5) , with the following specific primers: for p73, GGGCACCACGTTTGAGCACC (sense) and GATTGAACTGGGCCATGACAGATG (antisense); and for {Delta}Np73, TGTACGTCGGTGACCCCGCACG (sense) and TCGGTGTTGGAGGGGATGACA (antisense). Results were normalized to ß-amyloid precursor protein, which had minimal variation in all normal and neoplastic UGC samples.

Luciferase and Apoptosis Assays.
Luciferase activity was determined using a Dual-Luciferase Reporter Assay kit (Promega, Madison, WI). Results were normalized for Renilla luciferase activity, and cell death was measured as described previously (3) . Briefly, AGS cells were seeded into 8-well chamber slides and transfected with 600 ng of the indicated expression plasmids per well using FuGENE 6 reagent. After 24 hours, apoptosis was measured using the terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) method with the In Situ Cell Death Detection Kit (Roche). Expression was determined by indirect immunofluorescence with a p73-specific antibody in duplicate wells. Transfection efficiency was reproducibly ~40% of cells, similar among all constructs, and evenly distributed throughout the wells. TUNEL-positive cells (15 random fields, >500 cells) were counted, and the percentage of apoptosis in transfected cells was determined.

Cell Lysis, Antibodies, and Western Blotting.
AGS cells were transfected with 1 µg of p73 expression plasmid together with 2 µg of either {Delta}Np73{alpha} expression plasmid or empty vector. Total cell lysates were prepared 24 hours after transfection and subjected to immunoblot analysis. Gel loading was normalized for equal loading with a monoclonal antibody against actin (C-2; Santa Cruz Biotechnology, Santa Cruz, CA). p73 antibodies were mouse monoclonal ER15 and GC15 (Oncogene Research Products, San Diego, CA) or rabbit polyclonal anti-{Delta}Np73 (Imgenex, San Diego, CA). Antibodies against HDM2 (IF2) and p21/Waf1 were obtained from Oncogene Research Products, and antibodies against ß-catenin were obtained from Affiniti Research Products (Devon, United Kingdom).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Frequent Overexpression of p73 Isoforms in Upper Gastrointestinal Adenocarcinomas.
The p73 gene has two promoters (P1 and P2), which regulate the expression of p73 and {Delta}Np73, respectively (Fig. 1A)Citation . {Delta}Np73 has previously been shown to lack the transactivation domain at the NH2 terminus and has dominant-negative properties (3 , 6) . To examine the expression of p73 and {Delta}Np73 mRNA, we used real-time RT-PCR with sequence-specific primers that specifically amplify either full-length p73 or all known transcripts encoding {Delta}Np73.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Frequent overexpression of p73 and {Delta}Np73 transcripts in upper gastrointestinal adenocarcinomas. A, structure of the human p73 gene and p73 isoforms. In a manner similar to that of p53, the p73 gene encodes a transactivation domain (TA), DNA-binding domain (DBD), and oligomerization domain (OD). However, it also contains two promoters and an additional sterile {alpha}-motif domain (SAM). Positions of the real-time RT-PCR primers are indicated (bottom arrows). B, relative expression levels of p73 mRNA in primary gastric and gastroesophageal adenocarcinomas. C, relative up-regulation of {Delta}Np73 transcripts in primary tumors. Dashed line represents an arbitrary cutoff, delineating tumors with 5-fold or higher relative expression.

 
Our analysis of p73 gene expression demonstrated frequent overexpression of p73 and {Delta}Np73 transcripts in analyzed UGCs compared with levels in the normal gastric mucosa (Fig. 1B and C)Citation . Indeed, in 18 of the 24 cancers (75%), p73 was specifically up-regulated between 5- and 1176-fold (Fig. 1B)Citation , whereas {Delta}Np73 was overexpressed between 5- and 239-fold in 15 of these 24 analyzed cases (62%; Fig. 1CCitation ). We defined the overexpression as an arbitrary cutoff, delineating tumors with 5-fold or higher mRNA up-regulation compared with the average normal level. This cutoff is illustrated as dashed lines in Fig. 1B and CCitation .

As a control, we examined the expression level of 10 normal mucosal biopsies from the esophagus and stomach. In normal tissues, the expression levels of p73 and {Delta}Np73 were low and did not vary significantly between samples. Notably, in the majority of UGC cases in which overexpression of p73 was observed, {Delta}Np73 was also found to be up-regulated [in 15 of 18 UGC cases (83%)]. The relatively small number of tumor cases did not provide the necessary statistical power to evaluate the prognostic significance of p73 expression.

{Delta}Np73 Suppresses Transcriptional and Apoptotic Activities of p73 Isoforms in Gastrointestinal Cells.
We used the p73 luciferase reporter construct PG13-luc, which contains 13 p53 (p73)-binding sites within its promoter, to demonstrate that {Delta}Np73 affects p73 transcriptional activity in UGCs. AGS (a gastric cancer line harboring wild-type p53 and p73) cells were transfected with p73{alpha} and p73ß plasmids alone or together with {Delta}Np73{alpha}, along with this reporter. Our results demonstrated strong inhibition of p73 transcriptional activity by {Delta}Np73 (Fig. 2A)Citation . In addition, {Delta}Np73 suppressed the induction of the p73 (p53)-inducible proteins p21/Waf1 and HDM2 by the p73{alpha} and p73ß isoforms in AGS cells (Fig. 2BCitation , compare Lanes 2 and 3–5). Transfection of AGS cells with {Delta}Np73{alpha} alone did not affect the expression of these target genes (data not shown).



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. {Delta}Np73 efficiently inhibits the transcriptional and apoptotic activities of p73{alpha} and p73ß in gastrointestinal cells. A, {Delta}Np73{alpha}-mediated suppression of the p73-responsive luciferase reporter PG13-luc in AGS gastric cancer cells. Results are the average ± SD of three independent experiments. B, {Delta}Np73{alpha} suppresses the p73-induced transactivation of HDM2 and p21/Waf1. Cells in the vector lane are transfected with empty plasmid only (i.e., pcDNA3). C, {Delta}Np73{alpha} inhibits apoptosis induced by p73{alpha} and p73ß in AGS cells.

 
Moreover, {Delta}Np73 inhibited apoptosis induced by p73{alpha} and p73ß isoforms. AGS cells were transfected with empty vector, p73{alpha} or p73ß alone, or cotransfected with {Delta}Np73. Cells expressing p73ß and, to a lesser extent, p73{alpha} underwent marked apoptosis 24 hours after transfection (72% and 32%, respectively). By contrast, cells cotransfected with {Delta}Np73 were protected from p73-induced apoptosis, reducing it to levels that were comparable with those of the vector control (Fig. 2C)Citation . Thus, {Delta}Np73 inhibits the transcriptional activity and apoptotic function of p73{alpha} and p73ß in gastric cancer cells.

Activation of T-Cell Factor–Dependent Transcription by p73 Isoforms in Gastrointestinal Cell Lines.
To investigate additional biological effects of p73 and {Delta}Np73 coexpression, we performed a reporter analysis using the TCF-responsive luciferase construct pTOP in the Kato III and AGS cell lines. p73{alpha} and p73ß were both able to activate the TCF reporter. Surprisingly, in contrast to the inhibition of p73 by {Delta}Np73 observed with the p53 (p73) reporter PG13-luc (Fig. 2A)Citation , cotransfection of {Delta}Np73{alpha} with p73{alpha} or p73ß resulted in even higher activation of the pTOP reporter than p73 alone in Kato III cells (Fig. 3A)Citation . Furthermore, the level of TCF reporter up-regulation induced by p73/{Delta}Np73 cotransfection was comparable with ß-catenin/TCF4–induced activation, which we used as a positive control. A similar TCF response was also seen in AGS cells (data not shown).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. p73 in cooperation with {Delta}Np73{alpha} can activate a TCF luciferase reporter in gastrointestinal cancer cell lines. A, p73{alpha} and p73ß up-regulate pTOP, a TCF luciferase reporter, in Kato III cells. B, p73 fails to activate the pFOP luciferase reporter containing mutant TCF binding sites. Results are the average ± SD of three independent experiments.

 
To determine whether direct interaction of p73 with the reporter is necessary for its activation, we used point mutants of p73{alpha} and p73ß, which carry a mutation (R292H) in the DNA-binding domain (7) . These mutants were unable to activate the TCF reporter, suggesting that an intact p73 DNA-binding domain is important for the activation of TCF reporter (Fig. 3A)Citation .

Despite the substantial structural homology between the p73 and p53 tumor suppressors, p53 fails to activate the TCF reporter. Moreover, when p73 was cotransfected with p53, activation of the TCF reporter was inhibited. In contrast, a DNA-binding domain mutant of p53 (R175H) enhanced the p73 effect, suggesting that transcriptional activity of p53 may be essential for this inhibition (Fig. 3A)Citation .

To further evaluate the specificity of this interaction, we used the pFOP luciferase reporter, which has mutated TCF binding sites. Neither p73{alpha} nor p73ß was able to increase the activity of this reporter, implying that the activation mechanism is dependent on binding of these isoforms to the TCF elements in the reporter (Fig. 3B)Citation .

It has been demonstrated previously (8) that a dominant-negative form of TCF4, which lacks the ß-catenin–binding domain, can suppress pTOP reporter activation induced by ß-catenin. As shown in Fig. 4ACitation , dominant-negative TCF4 also inhibits pTOP reporter activation induced by p73 isoforms.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. p73 in cooperation with {Delta}Np73 can increase the endogenous level of the ß-catenin protein in the AGS gastric cancer cell line. A, a dominant-negative TCF4 mutant can inhibit the TCF luciferase reporter activation induced by p73 isoforms in AGS cells. B, Western blotting for ß-catenin protein after transfection with p73 isoforms in AGS cells. Actin served as a loading control.

 
Subsequently, we determined the effects of p73{alpha}, p73ß, and {Delta}Np73{alpha} on endogenous ß-catenin protein in AGS cells. ß-Catenin protein level was increased as a result of cotransfection of p73 isoforms (Fig. 4B)Citation . p73{alpha} and {Delta}Np73{alpha} cotransfection resulted in a greater increase in ß-catenin than p73ß and {Delta}Np73{alpha}. One possible explanation for the difference may be the different levels of cellular stress induced by p73{alpha} and p73ß. In particular, increased stress has previously been demonstrated to inhibit ß-catenin up-regulation (9) . The demonstration that p73ß induces greater apoptosis than p73{alpha} in AGS cells (Fig. 2C)Citation supports this hypothesis.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this study, we have demonstrated that p73 and {Delta}Np73 mRNAs are frequently up-regulated in UGCs. Notably, p73 and {Delta}Np73 were co–up-regulated in 83% of the studied cases. It has been shown previously (4) that the p73 gene is not mutated in gastric and esophageal carcinomas, indicating that in these tumors p73 is overexpressed without mutations. Using p73 reporter analysis, Western blotting, and TUNEL assay, we have demonstrated that {Delta}Np73 strongly inhibits "p53-like" transcriptional and apoptotic activity of p73 in gastrointestinal cells. Moreover, our data revealed a novel effect of the p73-{Delta}Np73 interaction that can lead to TCF-dependent transcriptional activation through the up-regulation of ß-catenin in gastrointestinal cells. However, we think additional mechanisms underlying the TCF transcriptional activation may be involved, and indeed, two of our experiments suggest this possibility. Firstly, a mutation in the p73 DNA-binding domain prevents activation of a TCF reporter, implying the importance of direct binding to DNA. Secondly, dominant-negative TCF4, a potent inhibitor of ß-catenin, does not completely suppress TCF activation induced by p73. Additional studies are required to further elucidate these mechanisms.

The effect of {Delta}Np73{alpha} alone on ß-catenin and TCF activity was minimal (Figs. 3ACitation and 4BCitation ). By contrast, the {Delta}Np73 homologue {Delta}Np63 (an NH2-terminally truncated p63 isoform) can up-regulate ß-catenin alone (10) . The reason for this difference is not completely clear; as demonstrated in this study, {Delta}Np73{alpha} rather cooperates with full-length p73 isoforms in this regard. The data obtained in this study suggest that under normal circumstances, p73 is capable of both inducing apoptosis and activating TCF activity. However, in the presence of {Delta}Np73, the apoptotic effects of p73 are inhibited, whereas the TCF activities are enhanced (compare Figs. 2Citation and 4Citation ). The presumption would be that p73 cannot reveal TCF-stimulating properties without suppression of its apoptotic ("p53-like") activity. This notion is consistent with our observation that mutant p53 has a similar effect on TCF activation as {Delta}Np73 (Fig. 3A)Citation . It has been demonstrated previously that, analogous to {Delta}Np73, tumor-derived p53 mutants can bind to and inactivate p73 apoptotic activity (11) . On the other hand, wild-type p53 counteracts the effect of p73 on TCF-dependent transcription.

p73 has considerable structural similarity to the p53 tumor suppressor. However, the role of p73 in tumorigenesis apparently differs from that of p53. In contrast to p53, which is frequently mutated, only 9 mutations of p73 have been found in a series of 1,400 studied tumors (4) . Moreover, p73 expression correlates with poor clinical outcome in hepatocellular carcinomas, colorectal carcinoma, and breast cancer [for review, see Benard et al. (4) ]. One of the key differences between p53 and p73 is the presence of multiple p73 isoforms derived from alternative promoter usage and splicing. The discovery of the NH2-terminally truncated p73 isoform {Delta}Np73 and its essential role in embryonic development of the nervous system as an inhibitor of p53 function confirmed this notion (12) . {Delta}Np73 can inactivate retinoblastoma protein and cooperate with oncogenic Ras in inducing mouse embryonic fibroblast-derived fibrosarcomas in vivo (13 , 14) . However, the role of the p73 gene in mammalian tumorigenesis may not be limited to activity of {Delta}Np73. Several studies, including ours, have demonstrated that full-length p73{alpha} and p73ß transcripts and proteins are also overexpressed in tumors. p73 protein expression has been demonstrated either by immunohistochemistry with NH2-terminally reactive antibodies or by Western blotting in primary cancers and cancer-derived cell lines (3 , 15, 16, 17, 18, 19) . Our novel findings that p73 isoforms can cooperate in the up-regulation of ß-catenin and TCF-dependent transcription may suggest an explanation of the phenomenon of overexpression of p73, a protein normally involved in apoptosis of cells, in gastrointestinal tumors.


    ACKNOWLEDGMENTS
 
We thank Drs. Ute Moll and Steven Powell for their assistance.


    FOOTNOTES
 
Grant support: University of Virginia Cancer Center grant P30-CA44579, National Institutes of Health grants CA106176 and CA93999, and Silvio O’Conte Digestive Diseases Research Core Center grant (P30 DK067629-01).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Alexander I. Zaika and Wael El-Rifai, The Digestive Health Center of Excellence, University of Virginia Health System, 300 Lane Road, MR4 Building, Charlottesville, VA 22908. E-mail: az2n{at}virginia.edu

Received 6/22/04. Revised 8/ 4/04. Accepted 8/ 6/04.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Locke GR, III, Talley NJ, Carpenter HA, et al Changes in the site- and histology-specific incidence of gastric cancer during a 50-year period. Gastroenterology, 1995;109:1750-6, [CrossRef][Medline]
  2. Polakis P. Wnt signaling and cancer. Genes Dev, 2000;14:1837-51, [Free Full Text]
  3. Zaika AI, Slade N, Erster SH, et al DeltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is up-regulated in human tumors. J Exp Med, 2002;196:765-80, [Abstract/Free Full Text]
  4. Benard J, Douc-Rasy S, Ahomadegbe JC. TP53 family members and human cancers. Hum Mutat, 2003;21:182-91, [CrossRef][Medline]
  5. Varis A, Zaika AI, Puolakkainen P, et al Coamplified and overexpressed genes at ERBB2 locus in gastric cancer. Int J Cancer, 2004;109:548-53, [CrossRef][Medline]
  6. Nakagawa T, Takahashi M, Ozaki T, et al Autoinhibitory regulation of p73 by Delta Np73 to modulate cell survival and death through a p73-specific target element within the Delta Np73 promoter. Mol Cell Biol, 2002;22:2575-85, [Abstract/Free Full Text]
  7. Jost CA, Marin MC, Kaelin WG, Jr. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature (Lond), 1997;389:191-4, [CrossRef][Medline]
  8. Korinek V, Barker N, Morin PJ, et al Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC–/– colon carcinoma. Science (Wash DC), 1997;275:1784-7, [Abstract/Free Full Text]
  9. Grotewold L, Ruther U. The Wnt antagonist Dickkopf-1 is regulated by Bmp signaling and c-Jun and modulates programmed cell death. EMBO J, 2002;21:966-75, [CrossRef][Medline]
  10. Patturajan M, Nomoto S, Sommer M, et al DeltaNp63 induces beta-catenin nuclear accumulation and signaling. Cancer Cell, 2002;1:369-79, [CrossRef][Medline]
  11. Gaiddon C, Lokshin M, Ahn J, Zhang T, Prives C. A subset of tumor-derived mutant forms of p53 down-regulate p63 and p73 through a direct interaction with the p53 core domain. Mol Cell Biol, 2001;21:1874-87, [Abstract/Free Full Text]
  12. Yang A, Walker N, Bronson R, et al p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature (Lond), 2000;404:99-103, [CrossRef][Medline]
  13. Petrenko O, Zaika AI, Moll UM. DeltaNp73 facilitates cell immortalization and cooperates with oncogenic Ras in cellular transformation in vivo. Mol Cell Biol, 2003;23:5540-55, [Abstract/Free Full Text]
  14. Stiewe T, Stanelle J, Theseling CC, et al Inactivation of retinoblastoma (RB) tumor suppressor by oncogenic isoforms of the p53 family member p73. J Biol Chem, 2003;278:14230-6, [Abstract/Free Full Text]
  15. Weber A, Langhanki L, Schutz A, et al Expression profiles of p53, p63, and p73 in benign salivary gland tumors. Virchows Arch, 2002;441:428-36, [CrossRef][Medline]
  16. Tannapfel A, Wasner M, Krause K, et al Expression of p73 and its relation to histopathology and prognosis in hepatocellular carcinoma. J Natl Cancer Inst (Bethesda), 1999;91:1154-8, [Abstract/Free Full Text]
  17. Guan M, Peng HX, Yu B, Lu Y. p73 overexpression and angiogenesis in human colorectal carcinoma. Jpn J Clin Oncol, 2003;33:215-20, [Abstract/Free Full Text]
  18. Korshunov A, Shishkina L, Golanov A. Immunohistochemical analysis of p16INK4a, p14ARF, p18INK4c, p21CIP1, p27KIP1 and p73 expression in 271 meningiomas correlation with tumor grade and clinical outcome. Int J Cancer, 2003;104:728-34, [CrossRef][Medline]
  19. Concin N, Becker K, Slade N, et al Transdominant deltaTAp73 isoforms are frequently up-regulated in ovarian cancer. Evidence for their role as epigenetic p53 inhibitors in vivo. Cancer Res, 2004;64:2449-60, [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
W. Lee, A. Belkhiri, A. C. Lockhart, N. Merchant, H. Glaeser, E. I. Harris, M. K. Washington, E. M. Brunt, A. Zaika, R. B. Kim, et al.
Overexpression of OATP1B3 Confers Apoptotic Resistance in Colon Cancer
Cancer Res., December 15, 2008; 68(24): 10315 - 10323.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. A. Dar, A. Belkhiri, J. Ecsedy, A. Zaika, and W. El-Rifai
Aurora Kinase A Inhibition Leads to p73-Dependent Apoptosis in p53-Deficient Cancer Cells
Cancer Res., November 1, 2008; 68(21): 8998 - 9004.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
W. H. Toh, E. Logette, L. Corcos, and K. Sabapathy
TAp73{beta} and DNp73{beta} activate the expression of the pro-survival caspase-2S
Nucleic Acids Res., August 1, 2008; 36(13): 4498 - 4509.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. S. Liu, K. Y.-K. Chan, A. N.-Y. Cheung, X.-Y. Liao, T.-W. Leung, and H. Y.-S. Ngan
Expression of {Delta}Np73 and TAp73{alpha} Independently Associated with Radiosensitivities and Prognoses in Cervical Squamous Cell Carcinoma.
Clin. Cancer Res., July 1, 2006; 12(13): 3922 - 3927.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
G. Dominguez, J. M. Garcia, C. Pena, J. Silva, V. Garcia, L. Martinez, C. Maximiano, M. E. Gomez, J. A. Rivera, C. Garcia-Andrade, et al.
{Delta}TAp73 Upregulation Correlates With Poor Prognosis in Human Tumors: Putative In Vivo Network Involving p73 Isoforms, p53, and E2F-1
J. Clin. Oncol., February 10, 2006; 24(5): 805 - 815.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Belkhiri, A. Zaika, N. Pidkovka, S. Knuutila, C. Moskaluk, and W. El-Rifai
Darpp-32: a Novel Antiapoptotic Gene in Upper Gastrointestinal Carcinomas
Cancer Res., August 1, 2005; 65(15): 6583 - 6592.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomkova, K.
Right arrow Articles by Zaika, A. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomkova, K.
Right arrow Articles by Zaika, A. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online