This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, Y. Articles by Sato, H. Search for Related Content PubMed PubMed Citation Articles by Li, Y. Articles by Sato, H.

Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar

¹ Department of Molecular Virology and Oncology and ² Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Kanazawa, Ishikawa, Japan; and ³ Daiichi Fine Chemical Co. Ltd., Takaoka, Toyama, Japan

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The small leucine-rich proteoglycan lumican was identified from a human placenta cDNA library by the expression cloning method as a gene product that interacts with membrane-type matrix metalloproteinase-1 (MT1-MMP). Coexpression of MT1-MMP with lumican in HEK293T cells reduced the concentration of lumican secreted into culture medium, and this reduction was abolished by addition of the MMP inhibitor BB94. Lumican protein from bovine cornea and recombinant lumican core protein fused to glutathione S-transferase was shown to be cleaved at multiple sites by recombinant MT1-MMP. Transient expression of lumican in HEK293 cells induced expression of tumor suppressor gene product p21/Waf-1, which was abrogated by the coexpression of MT1-MMP concomitant with a reduction in lumican concentration in culture medium. Stable expression of lumican in HeLa cells induced expression of p21 and reduction of colony formation in soft agar, which were both abolished by the expression of MT1-MMP. HT1080 fibrosarcoma cells stably transfected with the lumican cDNA (HT1080/Lum), which express endogenous MT1-MMP, secreted moderate levels of lumican; however, treatment of HT1080/Lum cells with BB94 resulted in accumulation of lumican in culture medium. The expression levels of p21 in HT1080/Lum were proportional to the concentration of secreted lumican and showed reverse corelation with colony formation in soft agar. These results suggest that MT1-MMP abrogates lumican-mediated suppression of tumor cell colony formation in soft agar by degrading this proteoglycan, which down-regulates it through the induction of p21.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Lumican belongs to the family of small leucine-rich proteoglycans that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. Lumican is the major keratan sulfate proteoglycan of the corneal stroma, but it is also expressed in other extracellular matrices, such as skin, muscle, and cartilage (1, 2, 3, 4, 5, 6) . Gene-targeting studies indicate that lumican plays an important role in determining the structural phenotype of the mature collagen fibril in various tissues. Decorin is also a member of the small leucine-rich proteoglycan protein family, and the phenotypes of decorin-deficient mice were very similar to those of lumican-targeted mice (7 , 8) . Decorin is emerging as a powerful modulator of cell growth by affecting several key elements, including matrix assembly, growth factor binding, and receptor tyrosine kinase activity (3 , 9 , 10) . Suppression of decorin expression was found to be related to the induction of anchorage-independent growth caused by v-src in human fetal lung fibroblasts (11) . Lumican was also shown to reduce colony formation in soft agar or tumorigenicity in nude mice of rat fibroblast F204 cells transformed by K-ras or v-src oncogene (12) .

Matrix metalloproteinases (MMPs) are a family of Zn²⁺-dependent enzymes that are known to cleave extracellular matrix proteins in normal and pathological conditions (13) . Currently, 23 MMP genes have been identified in humans, and they can be subgrouped into soluble-type and membrane-type MMPs (MT-MMPs; refs. 13 , 14 ). MMPs are overexpressed in various human malignancies and have been thought to contribute to tumor invasion and metastasis by degrading extracellular matrix components (13) . Thus, the level of MMP expression correlates with the invasiveness or malignancy of tumors (15 , 16) . Particularly, MT1-MMP, MMP-2, MMP-7, and MMP-9 have been reported to be most closely associated with tumor invasion and metastasis. Although degradation of extracellular matrix is an important aspect of MMP biology, growing evidence has shown specific processing/activation or degradation of cell surface receptors and ligands. Fas ligand (17) , tumor necrosis factor (18) , the ectodomain of the fibroblast growth factor receptor-1 (19) , the heparin-binding epidermal growth factor (20) , and interleukin (IL)-8 (21) were reported to be released or activated by MMPs. MMPs also cleave and inactivate IL-1ß (22) , insulin-like growth factor binding proteins (23) , fibrinogen and factor XII (24) , the CC chemokine MCP-3 (25) , CXC chemokines stromal cell-derived factor 1 and ß (26 , 27) , metastasis suppressor gene product KiSS-1/metastin (28) , and heparan sulfate proteglycan syndecan-1 (29) .

Previously, we have developed an expression cloning method to screen genes, the products of which not only modulate pro-MMP-2 activation mediated by MT1-MMP but also serve as substrates of MT1-MMP (28, 29, 30, 31) . In this study, we have identified lumican as a substrate of MT1-MMP and showed that cleavage of lumican by MT1-MMP suppressed induction of p21/Waf-1 expression by lumican, which in turn enhanced colony formation of tumor cells in soft agar.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Proteins and Antibodies.
DMEM was from Sigma (St. Louis, MO). Primers were synthesized by Genset (Kyoto, Japan). A human placenta cDNA library constructed in the pEAK8 expression vector was obtained from EdgeBio Systems (Gaithersburg, MD). Lumican protein from bovine cornea was purchased from Sigma. Recombinant MT1-MMP, the inert mutant of MT1-MMP (MT1-E/A), and MT3-MMP catalytic domains tagged with the FLAG epitope at the COOH-terminus and purified MMP-2 protein were prepared as described previously (28 , 32 , 33) . Monoclonal antibodies against FLAG epitope and glutathione S-transferase (GST) were purchased from Sigma and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Recombinant TIMP-1 and TIMP-2 proteins and monoclonal antibody against MT1-MMP (113-5B7) were gifts from Daiichi Fine Chemical Co. Ltd. (Toyama, Japan).

Cell Culture.
Human embryonic kidney HEK293, HEK293T, HeLa, and fibrosarcoma HT1080 cells were obtained from American Type Culture Collection (Manassas, VA) and cultured in DMEM supplemented with 5% FCS.

Expression Cloning.
Expression cloning to identify genes, the products of which interact with MMP-2, MMP-9, or MT1-MMP, was done as described previously (30) .

Construction of an Expression Plasmid for Lumican Tagged with FLAG.
An expression plasmid for lumican tagged with the FLAG epitope at the COOH-terminus was constructed to detect lumican protein by anti-FLAG M2 antibody (Sigma). A lumican cDNA fragment, which has a BglII restriction site in place of the stop codon, was generated by PCR with lumican cDNA cloned in pEAK8 plasmid as a template and pEAK8 forward primer (TTCATTCTCAAGCCTCAGACAGTGG)/flanking reverse primer with an extra BglII site (underlined) starting at nucleotide 1098 of lumican gene (GenBank accession no. U21128; AGAGATCTATTAAGAGTGACTTCGTTAGCAA). The amplified fragment was digested with EcoRI and BglII and was inserted into the EcoRI and BglII sites of pSG-FLAG vector as described previously (30) .

Western Blotting.
For Western blot analysis, an expression plasmid for lumican (0.4 µg) was cotransfected with either MT1-MMP or control plasmid (1.6 µg) into 293T cells cultured in 35-mm diameter dishes with TransIT LT1 transfection reagent according to the manufacturer’s instructions (Mirus, Madison, WI). At 36 hours after transfection, culture medium was replaced with serum-free medium, and cells were incubated for an additional 24 hours. Cell lysates and proteins precipitated from conditioned medium with 10% trichloroacetic acid were analyzed by Western blotting with anti-FLAG M2 antibody as a first antibody and goat antimouse IgG antibody conjugated with Alexa Fluor 680 (Molecular Probes Inc., Eugene, OR) as a second antibody. The signal was monitored by LI-COR Odyssey IR imaging system (Lincoln, NE). Precision Plus Protein Standards were used as molecular weight standards (Bio-Rad, Hercules, CA).

HeLa and HT1080 cells stably expressing lumican (HT1080/Lum) were established by selecting cells transfected with lumican-FLAG cDNA cloned in pEAK8 vector in culture medium containing 0.5 µg/ml puromycin. HeLa cells stably expressing MT1-MMP were established by selecting cells transfected with MT1-MMP cDNA cloned in pIRES-hyg3 vector (Clontech, Palo Alto, CA) in culture medium containing 200 µg/ml hygromycin B.

Preparation of Recombinant Lumican-GST Protein.
Lumican cDNA fragment encoding amino acid 20 to 338 was generated by PCR with a flanking forward primer with an extra XhoI site (underlined) starting at nucleotide 139 (ACCTCGAGCAGTACTATGATTATGATTTTC) and the flanking reverse primer described above. The amplified DNA fragment was digested with XhoI and BglII and inserted into the XhoI and BglII sites of GST-CTC plasmid as described previously (28) . The BL20 Escherichia coli strain was transformed with these plasmids, and the protein expression was induced by 0.5 mmol/L isopropyl-ß-thiogalactopyranoside. Lumican GST-fusion protein enriched in the inclusion body of E. coli was dissolved in 8 M urea containing 1 mmol/L dithiothreitol and 1% SDS, renatured by dialyzing against TNC [50 mmol/L Tris-HCl, 150 mmol/L NaCl, 1 mmol/L CaCl₂ (pH 7.4)] buffer containing 0.3% Brij, and then purified by Sephadex G-100 column chromatography (Pharmacia, Uppsala, Sweden).

Determination of the Cleavage Site of Lumican Protein.
Recombinant lumican-GST fusion protein (5 µg) was incubated with recombinant MT1-MMP catalytic domain (500 ng) in 50 µL TNC buffer containing 0.3% Brij at 37°C for 3 hours, and the generated fragments were separated on 12% SDS-PAGE and blotted to polyvinylidene difluoride membrane (Milipore, Bedford, MA). The NH₂-terminal amino acid sequence of each fragment was determined with the Beckman Coulter LF300 amino acid sequencer.

Soft-agar Colony Formation Assay.
Low melting temperature agarose was purchased from FMC Bio Products (Rockland, ME). Cells (2 x 10³) were inoculated into 0.3% agarose in DMEM supplemented with 10% FCS, and colonies were scored after 2 weeks of incubation.

Pull-down Assay.
Culture supernatant from HT1080/Lum treated with BB94 (2 ml) was incubated with MT1-E/A protein (2 µg), immunoprecipitated with anti-MT1-MMP antibody 113-5B7 (5 µg) and protein-G Sepharose (Pharmacia), and then analyzed by Western blotting with anti-FLAG antibody conjugated with Alexa Fluor 680.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Screening of Human Placenta cDNA Library.
Aliquots of plasmid DNA from the human placenta cDNA library was cotransfected with MMP-2, MMP-9 and MT1-MMP cDNA into 293T cells, and cell lysates were analyzed by gelatin zymography. Transfection with MMP-2, MMP-9 and MT1-MMP cDNA into 293T cells generated a 92 kDa gelatinolytic band of latent pro-MMP-9, 68 kDa band of latent pro-MMP-2 and 64 kDa band of MMP-2 intermediate form. Transfection of one pool of cDNA partially suppressed processing of MMP-2 to the 64 kDa intermediate form (data not shown). Five cDNA clones of 30 clones isolated from this cDNA pool by a second screening suppressed MMP-2 processing to the intermediate form when cotransfected with MMP-2, MMP-9 and MT1-MMP. The size of all 5 active cDNA fragments was 1.7 kb, and the nucleotide sequence of the cDNA fragment was determined. Homology search analysis revealed that this cDNA encodes the small leucine-rich proteoglycan lumican (GenBank accession no. U21128).

Degradation of Lumican by MT-MMPs.
Suppression of MT1-MMP-mediated MMP-2 processing by the expression of lumican suggested a possible interaction between MT1-MMP and lumican. To analyze the interaction between MT1-MMP and lumican, lumican tagged with FLAG epitope at the COOH-terminus was coexpressed with MT1-MMP in 293T cells, and the secreted and cell-associated lumican was examined by Western blotting (Fig. 1A) . Lumican secreted into culture medium from 293T cells transfected with the lumican cDNA was detected as a broad band of about 63 kDa, whereas cell-associated lumican core protein was detected as a 40 kDa band. Coexpression of MT1-MMP reduced the concentrations of lumican present in the culture medium depending on the levels of coexpressed MT1-MMP, however, cell-associated lumican core protein levels were not altered by MT1-MMP expression. Treatment of cells with the MMP inhibitor BB94 blocked the MT1-MMP-mediated reduction of lumican in the culture medium. Expression of defective MT1-MMP (MT1-E/A) failed to reduce the level of extracellular lumican. Next, other members of the MT-MMP family were compared for their capacity to cleave lumican (Fig. 1B) . Among the 6 members, only MT1-MMP and MT3-MMP reduced concentration of lumican secreted into culture medium. To confirm the cleavage of native lumican by MT-MMP, lumican protein purified from bovine cornea was incubated with recombinant MT1-MMP protein, and was analyzed on SDS-PAGE (Fig. 2A) . Lumican protein detected as a smear band ranging from M_r 85,000 to M_r 120,000 disappeared after incubation with recombinant MT1-MMP. To identify the sites of lumican protein cleavage by MT1-MMP, recombinant lumican core protein fused to GST was incubated with recombinant MT1-MMP protein and was analyzed by Western blotting with anti-GST antibody (Fig. 2B) . Digestion of lumican-GST with MT1-MMP resulted in 4 major fragments, the NH₂-terminal sequence of which showed the cleavage of Y⁷⁰-L⁷¹, K⁸⁴-A⁸⁵, N²⁷⁵-L²⁷⁶, and Q²⁸⁵-L²⁸⁶ peptide bonds of lumican, respectively. Digestion of lumican-GST with MT3-MMP generated similar fragments (data not shown). MMP-2 also digested lumican-GST with comparable efficiency generating similar but not identical fragments as MT1-MMP (Fig. 2C) .

View larger version (28K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. Degradation of lumican by MT-MMPs. A. The expression plasmid for lumican tagged with FLAG epitope (Lum-FLAG) or empty pSG5 plasmid (–) was cotransfected (0.4 µg) with the indicated amount of MT1-MMP or E/A mutant plasmid (1.6 µg) into 293T cells cultured in 35-mm diameter dishes. Total plasmid DNA was adjusted to 2 µg/dish with pSG5 plasmid. At 36 hours after transfection, the culture medium was replaced with serum-free medium with or without 0.1 µmol/L BB94, and cells were incubated additionally for 24 hours. Culture supernatants and cell lysates were then analyzed by Western blotting with anti-FLAG M2 antibody as described under Materials and Methods (top and middle panels). Expression of MT1-MMP was examined by Western blotting of cell lysates using anti-MT1-MMP antibody (bottom panel). B. The expression plasmid for lumican tagged with FLAG epitope (0.4 µg) or empty pSG5 plasmid was cotransfected with 1.6 µg of control plasmid (Lane –) or expression plasmid for MT-MMP family members, as indicated by number into 293T cells cultured in 35-mm diameter dishes. Culture supernatants and cell lysates were analyzed as described above (top and middle panels, respectively). MT-MMPs, except for MT2-MMP, were tagged with FLAG epitope and were detected in cell lysates with anti-FLAG M2 antibody together with lumican core protein (middle panel). MT2-MMP was detected with anti-MT2-MMP monoclonal antibody 162-4E3, which cross-reacted with MT3-MMP (bottom panel).

View larger version (45K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. Cleavage of lumican protein by MT1-MMP. A. Lumican protein (6 µg) was incubated with or without recombinant MT1-MMP catalytic domain (0.6 µg) in 30 µL TNC buffer containing 0.3% Brij at 37°C for 3 hours, separated on 10% SDS-PAGE, and stained with Coomassie Brilliant Blue. B. Lumican-GST fusion protein (3 µg) was incubated with the indicated amount of recombinant MT1-MMP catalytic domain in the presence or absence of 0.1 µmol/L BB-94 as described above, separated on 10% SDS-PAGE, and analyzed by Western blotting with anti-GST antibody. C. Lumican-GST protein incubated with MMP-2 was analyzed as described above. D. Schematic representation of lumican protein and MT1-MMP cleavage sites are shown.

View larger version (29K): [in this window] [in a new window] [Download PPT slide]   Fig. 3. Induction of p21 by lumican is abolished by MT1-MMP. A. Expression plasmid for lumican tagged with FLAG epitope (Lum-FLAG) or empty pSG5 plasmid (–; 0.4 µg) was cotransfected with empty plasmid or expression plasmid for MT1-MMP or defective E/A mutant (1.6 µg) as indicated into HEK293 cells cultured in 35-mm diameter dishes. At 36 hours after transfection, culture medium was replaced with serum-free medium, and cells were incubated additionally for 24 hours in the presence or absence of 0.1 µmol/L BB94 as indicated. Then, culture supernatants and cell lysates were analyzed by Western blotting with anti-FLAG M2, anti-MT1-MMP, or anti-p21 antibody as described under Materials and Methods. Cell lysates from HEK293 cells transfected with expression plasmid for p21 was used as a control sample (Lane p21). B. HT1080 cells were incubated with or without recombinant lumican-GST fusion protein (rLum-GST; 100 µg/ml) in the presence or absence of 0.1 µmol/L BB94 for the indicated period, and cell lysates and culture supernatants were examined for p21 expression and lumican-GST concentration, respectively.

Lumican Reduces Colony Formation in Soft Agar.
HeLa cells were stably transfected with either lumican, MT1-MMP alone, or cotransfected with both genes, and expression of lumican and p21 and their colony formation in soft agar were examined (Fig. 4) . Transfection of lumican or MT1-MMP in HeLa cells did not substantially affect cell growth under normal conditions (data not shown). The level of p21 was low in HeLa cells and was enhanced by the expression of lumican. Coexpression of MT1-MMP abolished p21 induction concomitant with reduction of lumican secretion. Treatment of these cells with BB94 recovered both lumican secretion and p21 expression. Colony formation in soft agar by HeLa cells was suppressed by the expression of lumican, which was recovered by coexpression of MT1-MMP. The effects of lumican expression were also studied with HT1080 cells (Fig. 5) . HT1080 cells stably transfected with lumican gene (HT1080/Lum) secreted a moderate level of lumican into the culture medium, which was enhanced by treatment with BB94. Transfection of lumican gene into HT1080 cells did not substantially affect cell growth either in the presence or absence of BB94. The secretion of lumican from HT1080/Lum was also stimulated by the addition of recombinant TIMP-2 protein but not by TIMP-1 protein. The level of cell-associated lumican core protein was not altered by BB94 treatment. Expression of p21 was slightly induced by stable transfection of lumican into HT1080 cells and was stimulated by BB94 treatment; however, p21 expression was not affected by BB94 treatment in control HT1080 cells. Colony forming ability in soft agar was compared between control HT1080 and HT1080/Lum cells. HT1080/Lum cells formed smaller colonies in soft agar than control HT1080 cells. Addition of BB94 in soft agar had no effect on colony formation of control HT1080 cells, however, it dramatically reduced colony formation of HT1080/Lum cells. Because MT1-MMP is sensitive to TIMP-2 but not to TIMP-1 (38) , selective stimulation of lumican secretion from HT1080 cells by TIMP-2 suggests the involvement of MT1-MMP in degradation of lumican. To confirm the direct interaction between lumican and MT1-MMP, pull-down experiment was done. As shown in Fig. 5D , Lumican protein from HT/Lum cells was coprecipitated with MT1-E/A protein.

View larger version (83K): [in this window] [in a new window] [Download PPT slide]   Fig. 4. Degradation of lumican by MT1-MMP enhances colony formation in soft agar. A. Semiconfluent monolayers of HeLa cells stably transfected with empty pEAK8 and pIRES-hyg3 plasmids (–), pEAK8 and MMT1-MMP plasmids (MT1), lum-FLAG and pIRES-hyg3 plasmids (Lum), and lum-FLAG and MT1-MMP (Lum + MT1) plasmids were incubated in serum-free medium for 24 hours in the presence or absence of BB94, and the supernatants and cell lysates were examined for the expression of lumican, MT1-MMP, and p21. B. HeLa cells stably transfected as described above were plated into 0.3% agarose with or without 0.1 µmol/L BB94, and colonies were observed under microscopy 2-weeks after incubation.

View larger version (50K): [in this window] [in a new window] [Download PPT slide]   Fig. 5. Degradation of lumican by HT1080 cells enhances colony formation in soft agar. A. Semiconfluent monolayers of control HT1080 (–) or HT1080/Lum cells (Lum) were cultured in serum-free medium with or without 0.1 µmol/L BB94 for 24 hours, and the supernatants and cell lysates were examined for the expression of lumican and p21. B. HT1080 (–) or HT1080/Lum cells (Lum) were cultured with or without 2 µg/ml recombinant TIMP-1, TIMP-2, or 0.1 µmol/L BB94, and lumican expressions were analyzed as described above. C. Control HT1080 (–) or HT1080/Lum cells were plated into 0.3% agarose with or without 0.1 µmol/L BB94, and colonies were observed under microscopy 2 weeks after incubation. D. Culture supernatant from control HT1080 (HT) or HT1080/Lum cells (Lum) treated with BB94 was incubated with or without MT1-E/A protein, and then either anti-MT1-MMP antibody 113-5B7/protein-G Sepharose beads (left panel) or anti-FLAG M2 antibody-conjugated agarose beads (right panel) were added. Lumican protein precipitated with beads was analyzed by Western blotting with anti-FLAG M2 antibody labeled with Alexa Fluor 680.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Lumican is the most abundant proteoglycan among small leucine-rich proteoglycan family members in breast cancer (49) . Although lumican mRNA expression was high within the tumor and tumor margin, lumican protein was not immunolocalized within the tumor but within the collagenous stroma. Because MT1-MMP is predominantly found within the tumor in breast cancer (16) , lumican protein expressed by tumor cells would be degraded by MT1-MMP. This may account for the observation that differences between lumican levels in normal and malignant breast tissues observed by both immunohistochemistry and Western blot are not as marked as those seen at the level of mRNA expression (49) . Decorin and probably lumican are expected to be used for gene therapy to cause retardation of tumor growth (50) , and simultaneous treatment of tumors with MMP inhibitor should be considered for small leucine-rich proteoglycan gene therapy.

In summary, we have shown that degradation of lumican by MT1-MMP abrogates p21-mediated suppression of tumorigenicity by lumican. Additional studies are needed to investigate whether degradation of lumican by MT1-MMP may contribute to early tumor development and progression in human cancer.

	ACKNOWLEDGMENTS

 
We thank Dr. Erik W. Thompson (St. Vincent’s Institute of Medical Research, Melbourne, Australia) for critical reading of the manuscript.

	FOOTNOTES

 
Grant support: Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan (B2-11240203 and 14370053; H. Sato).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Hiroshi Sato, Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234-4505; E-mail: vhsato{at}kenroku.kanazawa-u.ac.jp

Received 3/24/04. Revised 6/16/04. Accepted 7/28/04.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Danielson KG, Siracusa LD, Donovan PJ, Iozzo RV Decorin, epiphycan, and lumican genes are closely linked on murine Chromosome 10 and are deleted in lethal steel mutants. Mamm Genome 1999;10:201-3.[CrossRef][Medline]
2. Hocking AM, Shinomura T, McQuillan DJ Leucine-rich repeat glycoproteins of the extracellular matrix. Matrix Biol 1998;17:1-19.[CrossRef][Medline]
3. Iozzo RV The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J Biol Chem 1999;274:18843-6.[Free Full Text]
4. Iozzo RV, Murdoch AD Proteoglycans of the extracellular environment: clues from the gene and protein side offer novel perspectives in molecular diversity and function. FASEB J 1996;10:598-614.[Abstract]
5. Knudson CB, Knudson W Cartilage proteoglycans. Semin Cell Dev Biol 2001;12:69-78.[CrossRef][Medline]
6. Ying S, Shiraishi A, Kao CW, et al Characterization and expression of the mouse lumican gene. J Biol Chem 1997;272:30306-13.[Abstract/Free Full Text]
7. Iozzo RV, Chakrani F, Perrotti D, et al Cooperative action of germ-line mutations in decorin and p53 accelerates lymphoma tumorigenesis. Proc Natl Acad Sci USA 1999;96:3092-7.[Abstract/Free Full Text]
8. Chakravarti S, Petroll WM, Hassell JR, et al Corneal opacity in lumican-null mice: defects in collagen fibril structure and packing in the posterior stroma. Investig Ophthalmol Vis Sci 2000;41:3365-73.[Abstract/Free Full Text]
9. Ruoslahti E, Yamaguchi Y Proteoglycans as modulators of growth factor activities. Cell 1991;64:867-9.[CrossRef][Medline]
10. Stander M, Naumann U, Wick W, Weller M Transforming growth factor-beta and p-21: multiple molecular targets of decorin-mediated suppression of neoplastic growth. Cell Tissue Res 1999;296:221-7.[CrossRef][Medline]
11. Kolettas E, Rosenberger RF Suppression of decorin expression and partial induction of anchorage-independent growth by the v-src oncogene in human fibroblasts. Eur J Biochem 1998;254:266-74.[Medline]
12. Yoshioka N, Inoue H, Nakanishi K, et al Isolation of transformation suppressor genes by cDNA subtraction: lumican suppresses transformation induced by v-src and v-K-ras. J Virol 2000;74:1008-13.[Abstract/Free Full Text]
13. Seiki M Membrane-type matrix metalloproteinases. APMIS 1999;107:137-43.[Medline]
14. Nagase H, Woessner JF, Jr Matrix metalloproteinases. J Biol Chem 1999;274:21491-4.[Free Full Text]
15. Nomura H, Sato H, Seiki M, Mai M, Okada Y Expression of membrane-type matrix metalloproteinase in human gastric carcinomas. Cancer Res 1995;55:3263-66.[Abstract/Free Full Text]
16. Ueno H, Nakamura H, Inoue M, et al Expression and Tissue localization of membrane-type 1, 2 and 3 matrix metalloproteinases in human invasive breast carcinoma. Cancer Res 1997;57:2055-60.[Abstract/Free Full Text]
17. Powell WC, Fingleton B, Wilson CL, Boothby M, Matrisian LM The metalloproteinase matrilysin proteolytically generates active soluble Fas ligand and potentiates epithelial cell apoptosis. Curr Biol 1999;9:1441-7.[CrossRef][Medline]
18. Gearing AJ, Beckett P, Christodoulou M, et al Processing of tumour necrosis factor-alpha precursor by metalloproteinases. Nature (Lond) 1994;370:555-7.[CrossRef][Medline]
19. Levi E, Fridman R, Miao HQ, et al Matrix metalloproteinase 2 releases active soluble ectodomain of fibroblast growth factor receptor 1. Proc Natl Acad Sci USA 1996;93:7069-74.[Abstract/Free Full Text]
20. Suzuki M, Raab G, Moses MA, Fernandez CA, Klagsbrun M Matrix metalloproteinase-3 releases active heparin-binding EGF-like growth factor by cleavage at a specific juxtamembrane site. J Biol Chem 1997;272:31730-7.[Abstract/Free Full Text]
21. Van den Steen PE, Proost P, Wuyts A, Van Damme J, Opdenakker G Neutrophil gelatinase B potentiates interleukin-8 tenfold by aminoterminal processing, whereas it degrades CTAP-III, PF-4, and GRO-alpha and leaves RANTES and MCP-2 intact. Blood 2000;96:2673-81.[Abstract/Free Full Text]
22. Ito A, Mukaiyama A, Itoh Y, et al Degradation of interleukin 1beta by matrix metalloproteinases. J Biol Chem 1996;271:14657-60.[Abstract/Free Full Text]
23. Fowlkes JL, Enghild JJ, Suzuki K, Nagase H Matrix metalloproteinases degrade insulin-like growth factor-binding protein-3 in dermal fibroblast cultures. J Biol Chem 1994;269:25742-6.[Abstract/Free Full Text]
24. Hiller O, Lichte A, Oberpichler A, Kocourek A, Tschesche H Matrix metalloproteinases collagenase-2, macrophage elastase, collagenase-3, and membrane type 1-matrix metalloproteinase impair clotting by degradation of fibrinogen and factor XII. J Biol Chem 2000;275:33008-13.[Abstract/Free Full Text]
25. McQuibban GA, Gong JH, Tam EM, et al Inflammation dampened by gelatinase A cleavage of monocyte chemoattractant protein-3. Science (Wash DC) 2000;289:1202-6.[Abstract/Free Full Text]
26. McQuibban GA, Butler GS, Gong JH, et al Matrix metalloproteinase activity inactivates the CXC chemokine stromal cell-derived factor-1. J Biol Chem 2001;276:43503-8.[Abstract/Free Full Text]
27. McQuibban GA, Gong JH, Wong JP, et al Matrix metalloproteinase processing of monocyte chemoattractant proteins generates CC chemokine receptor antagonists with anti-inflammatory properties in vivo. Blood 2002;100:1160-7.[Abstract/Free Full Text]
28. Takino T, Koshikawa N, Miyamori H, et al Cleavage of metastasis suppressor gene product KiSS-1 protein/metastin by matrix metalloproteinases. Oncogene 2003;22:4617-26.[CrossRef][Medline]
29. Endo K, Takino T, Miyamori H, et al Cleavage of syndecan-1 by membrane type matrix metalloproteinase-1 stimulates cell migration. J Biol Chem 2003;278:40764-70.[Abstract/Free Full Text]
30. Miyamori H, Takino T, Kobayashi Y, et al Claudin promotes activation of pro-matrix metalloproteinase-2 mediated by membrane-type matrix metalloproteinases. J Biol Chem 2001;276:28204-11.[Abstract/Free Full Text]
31. Nakada M, Yamada A, Takino T, et al Suppression of membrane-type 1 matrix metalloproteinase (MMP)-mediated MMP-2 activation and tumor invasion by testican 3 and its splicing variant gene product, N-Tes. Cancer Res 2001;61:8896-902.[Abstract/Free Full Text]
32. Kinoshita T, Sato H, Okada A, et al TIMP-2 promotes activation of progelatinase A by membrane-type 1 matrix metalloproteinase immobilized on agarose beads. J Biol Chem 1998;273:16098-103.[Abstract/Free Full Text]
33. Shimada T, Nakamura H, Ohuchi E, et al Characterization of a truncated recombinant form of human membrane type 3 matrix metalloproteinase. Eur J Biochem 1999;262:907-14.[Medline]
34. De Luca A, Santra M, Baldi A, Giordano A, Iozzo RV Decorin-induced growth suppression is associated with up-regulation of p21, an inhibitor of cyclin-dependent kinases. J Biol Chem 1996;271:18961-5.[Abstract/Free Full Text]
35. Schonherr E, Levkau B, Schaefer L, Kresse H, Walsh K Decorin-mediated signal transduction in endothelial cells. Involvement of Akt/protein kinase B in up-regulation of p21(WAF1/CIP1) but not p27(KIP1). J Biol Chem 2001;276:40687-92.[Abstract/Free Full Text]
36. Santra M, Mann DM, Mercer EW, et al Ectopic expression of decorin protein core causes a generalized growth suppression in neoplastic cells of various histogenetic origin and requires endogenous p21, an inhibitor of cyclin-dependent kinases. J Clin Investig 1997;100:149-57.[Medline]
37. Sato H, Takino T, Okada Y, et al A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature (Lond) 1994;370:61-5.[CrossRef][Medline]
38. Sato H, Kinoshita T, Takino T, Nakayama K, Seiki M Activation of a recombinant membrane type 1-matrix metalloproteinase (MT1-MMP) by furin and its interaction with tissue inhibitor of metalloproteinases (TIMP)-2. FEBS Lett 1996;393:101-4.[CrossRef][Medline]
39. Ohuchi E, Imai K, Fujii Y, Sato H, Seiki M, Okada Y Membrane-type 1 matrix metalloproteinase digests interstitial collagens and other extracellular matrix macromolecules. J Biol Chem 1997;272:2446-51.[Abstract/Free Full Text]
40. Koshikawa N, Giannelli G, Cirulli V, Miyazaki K, Vito Quaranta V Role of cell surface metalloprotease MT1-MMP in epithelial cell migration over laminin-5. J Cell Biol 2000;148:615-24.[Abstract/Free Full Text]
41. Ratnikov BI, Rozanov EV, Postnova TI, et al An alternative processing of integrin v subunit in tumor cells by membrane type-1 matrix metalloproteinase. J Biol Chem 2002;277:7377-85.[Abstract/Free Full Text]
42. Belkin AM, Akimov SS, Zaritskayai LS, et al Matrix-dependent proteolysis of surface transglutaminase by membrane-type metalloproteinase regulates cancer cell adhesion and locomotion. J Biol Chem 2001;276:18415-22.[Abstract/Free Full Text]
43. Higashi S, Miyazaki M Identification of a region of ß-amyloid precursor protein essential for its gelatinase a inhibitory activity. J Biol Chem 2003;278:14020-8.[Abstract/Free Full Text]
44. Tam EM, Morrison CJ, Wu YI, Stack MS, Overall CM Membrane protease proteomics: Isotope-coded affinity tag MS identification of undescribed MT1–matrix metalloproteinase substrates. Proc Natl Acad Sci USA 2004;101:6917-22.[Abstract/Free Full Text]
45. Moscatello DK, Santra M, Mann DM, et al Decorin suppresses tumor cell growth by activating the epidermal growth factor receptor. J Clin Investig 1998;101:406-12.[Medline]
46. Patel S, Santra M, McQuillan DJ, Iozzo RV, Thomas AP Decorin activates the epidermal growth factor receptor and elevates cytosolic Ca2+ in A431 carcinoma cells. J Biol Chem 1998;273:3121-4.[Abstract/Free Full Text]
47. Iozzo RV, Moscatello DK, McQuillan DJ, Eichstetter I Decorin is a biological ligand for the epidermal growth factor receptor. J Biol Chem 1999;274:4489-92.[Abstract/Free Full Text]
48. Imai K, Hiramatsu A, Fukushima D, Pierschbacher MD, Okada Y Degradation of decorin by matrix metalloproteinases: identification of the cleavage sites, kinetic analyses and transforming growth factor-beta1 release. Biochem J 1997;322:809-14.
49. Leygue E, Snell L, Dotzlaw H, et al Lumican and decorin are differentially expressed in human breast carcinoma. J Pathol 2000;192:313-20.[CrossRef][Medline]
50. Reed CC, Gauldie J, Iozzo RV Suppression of tumorigenicity by adenovirus-mediated gene transfer of decorin. Oncogene 2002;21:3688-95.[CrossRef][Medline]

This article has been cited by other articles:

				Y. Nishida, H. Miyamori, E. W. Thompson, T. Takino, Y. Endo, and H. Sato Activation of Matrix Metalloproteinase-2 (MMP-2) by Membrane Type 1 Matrix Metalloproteinase through an Artificial Receptor for ProMMP-2 Generates Active MMP-2 Cancer Res., November 1, 2008; 68(21): 9096 - 9104. [Abstract] [Full Text] [PDF]

				Y. Wu, Y.-Y. Li, K. Matsushima, T. Baba, and N. Mukaida CCL3-CCR5 Axis Regulates Intratumoral Accumulation of Leukocytes and Fibroblasts and Promotes Angiogenesis in Murine Lung Metastasis Process J. Immunol., November 1, 2008; 181(9): 6384 - 6393. [Abstract] [Full Text] [PDF]

				C. Nyalendo, E. Beaulieu, H. Sartelet, M. Michaud, N. Fontaine, D. Gingras, and R. Beliveau Impaired tyrosine phosphorylation of membrane type 1-matrix metalloproteinase reduces tumor cell proliferation in three-dimensional matrices and abrogates tumor growth in mice Carcinogenesis, August 1, 2008; 29(8): 1655 - 1664. [Abstract] [Full Text] [PDF]

				X. Li, A. Pennisi, and S. Yaccoby Role of decorin in the antimyeloma effects of osteoblasts Blood, July 1, 2008; 112(1): 159 - 168. [Abstract] [Full Text] [PDF]

				D. V. Rozanov, A. Y. Savinov, R. Williams, K. Liu, V. S. Golubkov, S. Krajewski, and A. Y. Strongin Molecular Signature of MT1-MMP: Transactivation of the Downstream Universal Gene Network in Cancer Cancer Res., June 1, 2008; 68(11): 4086 - 4096. [Abstract] [Full Text] [PDF]

				D. V. Rozanov, A. Y. Savinov, V. S. Golubkov, S. Tomlinson, and A. Y. Strongin Interference with the complement system by tumor cell membrane type-1 matrix metalloproteinase plays a significant role in promoting metastasis in mice. Cancer Res., June 15, 2006; 66(12): 6258 - 6263. [Abstract] [Full Text] [PDF]

				M. Ahmad, T. Takino, H. Miyamori, T. Yoshizaki, M. Furukawa, and H. Sato Cleavage of Amyloid-{beta} Precursor Protein (APP) by Membrane-Type Matrix Metalloproteinases. J. Biochem., March 1, 2006; 139(3): 517 - 526. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, Y. Articles by Sato, H. Search for Related Content PubMed PubMed Citation Articles by Li, Y. Articles by Sato, H.