| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
with
V Integrin Ligands Improves Its Antineoplastic Activity
1 Department of Biological and Technological Research and Cancer Immunotherapy and Gene Therapy Program, San Raffaele H. Scientific Institute, Milan, Italy, and
2 Consiglio Nazionale delle Ricerche, Istituto di Chimica del Riconoscimento Molecolare, Milan, Italy
| ABSTRACT |
|---|
|
|
|---|
(TNF) as an anticancer drug is limited by severe toxicity. We have shown previously that targeted delivery of TNF to aminopeptidase N (CD13), a marker of angiogenic vessels, improved the therapeutic index of this cytokine in tumor-bearing mice. To assess whether the vascular-targeting approach could be extended to other markers of tumor blood vessels, in this work, we have fused TNF with the ACDCRGDCFCG peptide, a ligand of
V integrins by recombinant DNA technology. We have found that subnanogram doses of this conjugate are sufficient to induce antitumor effects in tumor-bearing mice when combined with melphalan, a chemotherapeutic drug. Cell adhesion assays and competitive binding experiments with anti-integrin antibodies showed that the Arg-Gly-Asp moiety interacts with cell adhesion receptors, including
Vß3 integrin, as originally postulated. In addition, ACGDRGDCFCG-mouse TNF conjugate induced cytotoxic effects in standard cytolytic assays, implying that ACGDRGDCFCG-mouse TNF conjugate can also bind TNF receptors and trigger death signals. These results indicate that coupling TNF with
V integrin ligands improves its antineoplastic activity and supports the concept that vascular targeting is a strategy potentially applicable to different endothelial markers, not limited to CD13. | INTRODUCTION |
|---|
|
|
|---|
(TNF) is an inflammatory cytokine originally identified for its cytotoxic activity against some tumor cell lines and for its ability to induce hemorrhagic necrosis of transplanted solid tumors (1
, 2)
. Despite the impressive results obtained with various animal models, the clinical use of TNF as an anticancer drug is limited by systemic toxicity, the maximum tolerated dose (510 µg/kg) being 1050 times lower than the estimated effective dose. For this reason, TNF can be administered to patients only locoregionally. Regional administration of relatively high doses of TNF in combination with chemotherapeutic drugs, by isolated limb or hepatic perfusion, has produced high-response rates in patients with advanced tumors of the limbs (3, 4, 5)
as well as regression of primary and metastatic tumors confined to the liver (6)
. These results are of outstanding interest because they show that, in principle, the antitumor effects of TNF can be exploited therapeutically in humans with great success if sufficient dose levels can be attained locally and if the organism can be shielded from the systemic toxic effect of TNF. The antitumor activity of TNF depends on a variety of effects that this cytokine can trigger on neoplastic cells as well as on normal cells within the tumor microenvironment, leading to selective obliteration and damage of tumor-associated vessels, activation of inflammatory and immune mechanisms, tumor cell apoptosis, and tumor cell necrosis (7, 8, 9, 10) . Among the various cells that are affected by TNF, endothelial cells are of central importance, particularly in mediating tumor vascular damage. TNF-induced vascular damage is thought to occur because of the combination of direct toxic effects on endothelial cells (11) and because of the TNF-induced shift in the homeostatic properties of endothelial cells from anticoagulant to procoagulant (9) . Unfortunately, endothelial cells of normal vessels can also be affected by TNF, and this interaction is likely at the origin of hypotension (12) , the most important dose-limiting toxicity for this cytokine (5) . This is an obvious reason why the therapeutic window was found to be so narrow for systemically administered TNF.
These notions provide the rational for developing vascular-targeting strategies aimed at increasing the selectivity of TNF for the endothelial lining of tumor vessels, while sparing normal vessels. For instance, the targeted delivery of TNF to vascular proliferation antigens, e.g., angiogenic vessel endothelium markers, is an attractive possibility.
In vivo panning of phage libraries in tumor-bearing animals has proven useful for selecting peptides able to interact with angiogenic endothelium markers and "to home" to tumors (13)
. Among the various peptides identified thus far, the CNGRC and ACDCRGDCFC peptides have proven useful for delivering various antitumor compounds, like chemotherapeutic drugs and apoptotic peptides to tumor vessels (13, 14, 15)
. These peptides bind, respectively, to an aminopeptidase N (CD13) isoform (16)
and to
V integrins expressed by angiogenic vessels (17)
. In previous work, we showed that a CNGRC-mTNF conjugate (NGR-mTNF) is endowed with more potent antitumor properties than TNF (15
, 18)
, supporting the hypothesis that targeted delivery of TNF to CD13-positive tumor vessels could be a valid strategy to increase its therapeutic index. To assess whether the vascular-targeting approach could be extended to other markers of tumor blood vessels, such as
V integrins, we have prepared an ACDCRGDCFCG-murine TNF conjugate (RGD-mTNF), by recombinant DNA technology, and studied its in vitro and in vivo antitumor activity. We have found that this peptide, fused to the NH2 terminus of TNF, is able to target TNF to cell membrane adhesion receptors. Moreover, we show that subnanogram doses of this conjugate are sufficient to induce antitumor effects in tumor-bearing mice.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Vß3; Chemicon, Temecula, CA), mAb 15.2 [antihuman intercellular adhesion molecule 1 (ICAM-1); Boehringer Mannheim Gmbh, Germany], mAb B4E11 (antihuman chromogranin A; Ref. 23
), H9.2B8 (biotinylated antimouse
V-integrin subunit; PharMingen, San Diego, CA), and goat antimouse-FITC secondary antibody (Sigma). Actinomycin D, crystal violet, and oxidized L-glutathione were obtained from Fluka Chemie (Buchs, Switzerland); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide was obtained from Merk (Darmstadt, Germany); human serum albumin was supplied by Farma-Biagini SpA (Lucca, Italy); and strepavidin-phycoerythrin was obtained from Sigma. Endotoxin content was measured using the quantitative chromogenic Limulus Amoebocyte Lysate test (BioWhittaker Europe, Verviers, Belgium).
Peptide Synthesis.
CNGRC and ACDCRGDCFCG peptides were prepared using the stepwise solid-phase Fmoc method and a 433A Applied Biosystem peptide synthesizer (Foster City, CA). Peptide folding was obtained by leaving the peptide solutions [100 µM in 20 mM Tris-HCl (pH 8)] for 2 days in open air under stirring. Oxidized peptide was then purified by reverse-phase high-performance liquid chromatography on a Jupiter 10-µm C18 300A column (250 x 21.2 mm; Phenomenex, Torrance, CA). Free sulfhydryl groups in peptides were <0.1%, as checked by titration with Ellmans reagent (Pierce, Pierce, Rockford, Illinois). Peptide concentrations were measured using the Protein Assay ESL kit (Roche). The molecular masses of CNGRC and ACDCRGDCFCG were 550.23 ± 1 Da and 1145.58 ± 1 Da, respectively (expected for disulfide-bridged peptide, 551.18 Da and 1145.29 Da, respectively), by matrix-assisted laser desorption ionization time-of-flight mass spectrometry.
Preparation of mTNF, NGR-mTNF, and RGD-mTNF.
Murine TNF (mTNF) and NGR-mTNF (mTNF fused with the COOH-terminus of CNGRCG) were prepared as described previously (15)
. The cDNA coding for RGD-mTNF (murine TNF fused with the COOH-terminus of ACDCRGDCFCG) was obtained by PCR on plasmid containing the mTNF cDNA sequence (15)
, using the following primers: TGCAGATCATATGGCTTGCGACTGCCGTGGTGACTGCTTCTGCGGTCTCAGATCATCTTCTC (5' primer); TCAGGATCCTCACAGGGCAATGATCCCAAAGTAGAC (3' primer). Primer sequences were designed to include the NdeI and BamHI restriction sites (underlined) for cloning in pET11 plasmid (Novagen, Madison, WI). The NdeI site contains also the translation starting codon. A glycine residue was interposed between ACDCRGDCFC and mTNF as a spacer. The RGD-mTNF cDNA was expressed in BL21(DE3) E. coli cells and purified from cell extracts by ammonium sulfate precipitation and hydrophobic interaction chromatography on Phenyl-Sepharose 6 Fast Flow (Amersham Biosciences Europe GmbH, Freiburg, Germany), followed by ion exchange chromatography on DEAE-Sepharose Fast Flow (Amersham). Oxidized L-glutathione was added to the product of ion exchange (2 mM final concentration) and incubated for 72 h at 4°C. RGD-mTNF was then denatured by adding urea (7 M, final concentration) and gel-filtered through an HR Sephacryl S-300 column (1025 ml; Amersham) pre-equilibrated with 7 M urea, 100 mM Tris-HCl (pH 8.0). Fractions corresponding to monomeric RGD-mTNF were pooled and refolded by adding, slowly, 4 volumes of distilled water, followed by 1 volume of 20 mM Tris-HCl (pH 8.0). The diluted RGD-mTNF solution (10 µg/ml) was left to incubate overnight at 4°C. Finally, the product was concentrated by ion exchange chromatography on DEAE-Sepharose Fast Flow and gel-filtered through an HR Sephacryl S-300 column (1025 ml) pre-equilibrated with 150 mM sodium chloride, 50 mM sodium phosphate (pH 6.8). All solutions used in purification and refolding steps were prepared with sterile and endotoxin-free water (S.A.L.F. Laboratorio Farmacologico SpA, Bergamo, Italy). Protein concentration was measured using the BCA Protein Assay Reagent (Pierce, Rockford, Illinois). About 2 mg of purified protein was recovered from 1 liter of E. coli culture. Protein purity and identity was checked by SDS-PAGE and Western blotting. The molecular mass of RGD-mTNF monomer was 18,383.2 ± 2.4 Da as determined by electrospray ionization mass spectrometry (expected for Met-ACDCRGDCFCG-mTNF1156, 18,388.8 Da; Fig. 1A
). The endotoxin content of RGD-mTNF was 0.033 units/µg.
|
ICAM-1 and Integrin Flow Cytometry Analysis.
Detection of ICAM-1 and
Vß3 integrin on the membrane of human EA.hy926 cells was carried out as follows. The cells were resuspended in cold 138 mM sodium chloride, 2.7 mM potassium chloride, 10 mM sodium phosphate [(pH 7.3) PBS] containing 2% FCS and 1 µg/ml mAb 15.2 (anti human-ICAM-1) or mAb LM609 (antihuman
Vß3 integrin), and incubated for 1 h on ice. After washing with PBS, the cells were incubated with goat antimouse-FITC secondary antibody, diluted (1:100) in PBS containing 2% FCS (30 min, on ice), washed again, and fixed with 4% formaldehyde in PBS. The cells were then analyzed by fluorescence-activated cell sorter. Expression of
V integrin subunits on murine L-M cells was quantified using 3 µg/ml biotinylated mAb H9.2B8 (rat antimurine
V integrin) and streptavidin-phycoerythrin, essentially as described above.
EA.hy926 Cell Adhesion Assay.
Polyvinyl chloride microtiter plates (Falcon code no. 3912; Becton Dickinson, Franklin Lakes, NJ) were coated with RGD-mTNF or mTNF solutions at various concentrations [50 µl/well in 150 mM sodium chloride, 50 mM sodium phosphate (pH 7.3) at 4°C overnight]; after washing with 0.9% sodium chloride, each well was filled with DMEM containing 2% BSA (45 min at 37°C) and washed again. EA.hy926 cells were then detached, washed three times with 0.9% sodium chloride, resuspended in incomplete DMEM and added to mTNF- or RGD-mTNF-coated plates (3 x 104 cells/100-µl well). After incubation (11.5 h) at 37°C, 5% CO2, unbound cells were removed by washing with incomplete DMEM. Adherent cells were fixed with 3% paraformaldehyde, 2% sucrose in PBS (pH 7.3) and stained with 0.5% crystal violet. Adherent cells were quantified by reading the absorbance of each well at 540 nm, using a microplate reader.
Radio-Binding Assay.
125I-mTNF (13.91 µCi/µg) and 125I-RGD-mTNF (11.64 µCi/µg) were prepared using Iodo-GenR precoated tubes (Pierce, Rockford, IL) according to the manufacturers instructions. Binding of radio-labeled mTNF or RGD-mTNF to EA.hy926 cell suspensions (106 cell/tube) was carried out in the presence or absence of 10 µg/ml of unlabeled competitors (mTNF or RGD-mTNF) diluted in DMEM containing 1 mg/ml human serum albumin and 0.02% sodium azide. The mixtures (100 µl) were incubated in tubes containing 100 µl of 20% mineral oil and 80% melting point bath oil (Sigma). After incubation (2 h) at 37°C, the tubes were centrifuged and cut at the bottom level. The bound radioactivity was measured using a gamma counter.
In Vivo Studies.
Studies on animal models were approved by the Ethical Committee of the San Raffaele H. Scientific Institute and performed according to the prescribed guidelines. C57BL/6 mice (Harlan, Italy) 8 weeks old were challenged with s.c. injection in the left flank of 7 x 104 RMA living cells; 10 days later, mice were treated with RGD-mTNF or NGR-mTNF solutions (100 µl) followed 2 h later by administration of melphalan (100 µl; Glaxo Wellcome Operations, Dartford, United Kingdom). All drugs, diluted with 0.9% sodium chloride containing 100 µg/ml endotoxin-free human serum albumin, were administered i.p. Tumor growth was monitored daily by measuring tumor volumes with calipers as described previously (7)
. Animals were sacrificed before tumors reached 1.01.3 cm in diameter. Tumor sizes are shown as mean ± SE (5 animals/group).
| RESULTS |
|---|
|
|
|---|
RGD-mTNF Promotes Cell Adhesion and Spreading.
To assess whether the Arg-Gly-Asp (RGD) domain of RGD-mTNF is functional and accessible to integrins, we compared the cell pro-adhesive properties of RGD-mTNF and mTNF in a cell adhesion assay. This assay takes advantage of the fact that RGD is the minimal recognition sequence of many integrins and serves as an adhesion motif. To this aim, microtiter wells were coated with various amounts of RGD-mTNF or mTNF and seeded with EA.hy926 cells. Cell adhesion was then measured 1.5 h later. We observed adhesion and spreading of EA.hy926 cells on plates coated with RGD-mTNF but not with mTNF (Fig. 2, A and B)
. These results strongly suggest that the RGD domain of RGD-mTNF was properly folded and able to interact with adhesion receptors, very likely integrins, on cell membrane. Cell adhesion was completely abrogated when the cells were plated in DMEM containing 5 mM EDTA (data not shown), as expected for divalent ion-dependent integrin binding.
|
To further analyze the binding specificity of RGD-mTNF, we performed cell adhesion inhibition experiments with an anti-
Vß3 integrin antibody. mAb LM609 (antihuman
Vß3) partially inhibited EA.hy926 cell adhesion to RGD-mTNF-coated plates (Fig. 2D)
, whereas the isotype-matched control mAb B4E11 (antihuman chromogranin A) did not affect cell adhesion. These results suggest that
Vß3 integrin is a receptor for RGD-mTNF.
Determination of RGD-mTNF-Binding Constants.
The binding of radiolabeled 125I-RGD-mTNF and 125I-mTNF to EA.hy926 cells was then investigated. Scatchard plot analysis of binding data suggests that more than one receptor is involved in the binding (Fig. 3)
. The results of dissociation constant (Kd) and binding site measurements (Table 1)
suggest that RGD-mTNF binds a small fraction of EA.hy926 receptors with a 10-fold higher affinity (Kd1) than mTNF and a large fraction of receptors with an affinity similar to that of mTNF.
|
|
Vß3 and
Vß5 integrins (26)
, the expression of integrin subunits on these cells was first characterized. Fluorescence-activated cell sorter analysis with specific antibodies showed that EA.hy926 cells express
Vß3 and ß5-subunits (Fig. 4)
V-subunits (Fig. 4)
|
|
V integrins, and the results also support the hypothesis that the improved activity of RGD-mTNF is related to targeting mechanisms depending on the ACDCRGDCFCG domain. Also noteworthy is that the addition of 5 mM EDTA to the binding buffer inhibited the cytolytic activity of RGD-mTNF to the level of mTNF (not shown). Given that divalent cations are critical for integrin structure and function, these results are in accordance with the hypothesis of a role of integrins as receptors for RGD-mTNF.
It is well known that TNF can induce the expression of ICAM-1 on endothelial cells (27)
. To provide additional evidence that RGD-mTNF is more active than mTNF, the effect of RGD-mTNF and mTNF on ICAM-1 expression by EA.hy926 cells was then investigated. To this aim, EA.hy926 cells were detached and immediately incubated with various doses of mTNF or RGD-mTNF for 1.5 h, washed, further incubated for 20 h, and then analyzed by fluorescence-activated cell sorter. The dose-response curves of mTNF and RGD-mTNF were different, the latter inducing more efficiently ICAM-1 expression at doses of 200 and 20 ng/ml (Fig. 6A)
. Also in this assay, the ACDCRGDCFCG peptide (40 µg/ml) partially inhibited the activity of RGD-mTNF but not that of mTNF (Fig. 6B)
, suggesting again that the improved activity of RGD-mTNF depends on the ACDCRGDCFCG domain.
|
|
| DISCUSSION |
|---|
|
|
|---|
It has been shown recently that the CDCRGDCFC peptide binds
Vß3 integrin expressed by both tumor cell and tumor endothelial cells (17)
. Because RMA tumor cells used in our in vivo experimental model do not express
V integrins, the improved activity of RGD-mTNF is likely related to endothelial cell targeting. We have also shown previously that NGR-mTNF, another conjugate prepared by fusing TNF with CNGRC peptide, can induce significant antitumor effects when administered at very low doses to tumor-bearing mice. Given that this peptide is known to target different receptors, e.g., CD13, in angiogenic vessels (16)
, the results obtained with both RGD-mTNF and NGR-mTNF support the concept that vascular targeting is a strategy potentially applicable to a broader spectrum of endothelial markers, not limited to CD13.
The results of in vitro experiments suggest that the RGD moiety of RGD-mTNF improves the amount and/or the persistence of this cytokine on targeted cells. Interestingly, cell adhesion assays and competitive binding experiments with anti-integrin antibodies showed that the RGD moiety interacts with cell adhesion receptors, including
Vß3 integrin, as originally postulated. On the other hand, the strong cytolytic activity of RGD-mTNF on L-M cells implies that RGD-mTNF can also bind TNF receptors and trigger death signals. The finding that the in vitro biological activity of RGD-mTNF is decreased by coincubation with an excess of free RGD peptide suggests that the improved activity of RGD-mTNF is related to targeting. Also of note is that the antitumor activity of NGR-mTNF can be inhibited by an excess of free-NGR peptide or by an anti-CD13 antibody (15)
. These findings suggest that the improved properties of RGD-mTNF or NGR-mTNF depend on targeted delivery of TNF to RGD or NGR receptors and not to unspecific mechanisms related to NH2-terminal extension.
TNF binds p55- and p75-TNF receptors with Kds of 0.30.6 pM and 0.070.2 pM, respectively (29, 30, 31, 32, 33, 34)
. However, depending on assay conditions and cell species, other values have been reported in the literature (35, 36, 37, 38)
. For instance, mouse L-929 and L-M cells express on their surface 5000 receptors/cell with Kd of 35 nM (35)
. Accordingly, we found that mTNF binds EA.hy926 cells with Kd1 = 0.43 nM and Kd2 = 3 nM. Scatchard analysis of RGD-mTNF binding to EA.hy926 cells (
Vß3 positive) showed the presence of a few high-affinity binding sites (Kd = 0.03 nM), potentially related to high-avidity multimeric complex interactions. Possibly, these sites are related to simultaneous double interaction of RGD-mTNF with integrins and mTNF receptors, leading to formation of high-avidity trimolecular complexes. However, a high proportion of binding sites able to bind RGD-mTNF with an affinity comparable with that of mTNF was also observed. Thus, a clear conclusion on the mechanism of interaction occurring among RGD-mTNF, integrins, and TNF receptors is difficult to draw from these data. The time of exposure of these cells to RGD-mTNF or mTNF also seems to be very important for activity. For instance, the in vitro cytotoxic activity of RGD-mTNF was stronger than that of mTNF when the cells were treated for 1.5 h, washed, and further incubated for 20 h, whereas their activities were similar in a standard 20 h-incubation assay. One possibility is that the targeting mechanism increases the binding and/or the persistence of TNF on endothelial cells of tumor vessels. The results obtained with the 1.5 h-incubation assay, followed by washing, are likely to simulate in a better manner the in vivo conditions, given that TNF is rapidly cleared from circulation after injection (39)
.
The addition of TNF to regional isolated limb perfusion with melphalan has produced response rates in patients with extremity soft-tissue sarcomas or melanomas higher than those obtained with chemotherapeutic drugs alone (3, 4, 5 , 40 , 41) . TNF-induced alteration of endothelial barrier function, reduction of tumor interstitial pressure, and increased chemotherapeutic drug penetration are believed to be important mechanisms of the synergy between TNF and chemotherapy (4 , 40 , 42, 43, 44, 45) . We proposed previously that targeted delivery of minute amounts of NGR-mTNF to tumor vessels can also increase the penetration of chemotherapeutic drugs in tumors in animal models. It is therefore possible that the synergistic activity observed with low doses of RGD-mTNF and melphalan is also related to alteration of the vessel wall barrier function and, consequently, to increased penetration of the chemotherapeutic drug in tumors. However, other mechanisms are possible. For instance killing of both endothelial and cancer cells cannot be excluded.
Molecules containing the ACDCRGDCFCG motif are expected to target murine as well as human angiogenic vessels (13
, 46)
. Thus, RGD-mTNF might be expected to have better antitumor properties than TNF in patients. Also noteworthy is that when we compared the activity of RGD-mTNF with that of NGR-mTNF in the RMA lymphoma model, we observed that >3 times higher doses of RGD-mTNF were necessary to achieve comparable responses. Thus, apparently, the antitumor activity of NGR-mTNF is superior to that of RGD-mTNF. However, because it is difficult to predict the level of expression of functional CD13 and
V integrin in patients, RGD-mTNF could be a valid alternative to NGR-mTNF that deserves to be investigated further. Moreover, because it is possible that the expression of CD13 and
V integrin does not entirely overlap in tumor vasculature, the combination of NGR-mTNF and RGD-mTNF could target different vessels and induce stronger antitumor effects than the single agents.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Angelo Corti, Department of Biological and Technological Research, San Raffaele H. Scientific Institute, via Olgettina 58, 20132 Milan, Italy. Phone: 39-02-26434802; Fax: 39-02-26434786; E-mail: corti.angelo{at}hsr.it
Received 6/16/03. Revised 7/31/03. Accepted 8/18/03.
| REFERENCES |
|---|
|
|
|---|
in combination with interferon
and melphalan in isolation perfusion of the limbs for melanoma and sarcoma. J. Clin. Oncol., 10: 52-60, 1992.[Abstract]
in combination with interferon-
and melphalan for nonresectable extremity soft tissue sarcomas: a multicenter trial. J. Clin. Oncol., 14: 2653-2665, 1996.
: results of a tumor necrosis factor dose-escalation study. J. Clin. Oncol., 14: 479-489, 1996.
in mouse models. Cancer Res., 59: 2917-2923, 1999.
and the comparison with other cytokines: induction of tumor-specific immunity. J. Biol. Chem., 138: 4023-4032, 1987.
antitumor immunotherapeutic properties by targeted delivery to aminopeptidase N (CD13). Nat. Biotechnol., 18: 1185-1190, 2000.[CrossRef][Medline]
V integrins as receptors for tumor targeting by circulating ligands. Nat. Biotechnol., 15: 542-546, 1997.[CrossRef][Medline]
. Cancer Res., 57: 1922-1928, 1997.
quantification by ELISA and bioassay: effects of TNF
-soluble TNF receptor (p55) complex dissociation during assay incubations. J. Immunol. Methods, 177: 191-198, 1994.[CrossRef][Medline]
enhances endothelial activation induced by tumor necrosis factor but not IL-1. J. Immunol., 145: 1727-1733, 1990.[Abstract]
B.TNF
is not needed for induction of a biological effect via TNF receptors. J. Biol. Chem., 265: 22409-22417, 1990.
(TNF
) mutants with exclusive specificity for the 55-kDa or 75-kDa TNF receptors. J. Biol. Chem., 268: 26350-26357, 1993.
from human placental membranes. Lymphokine Res., 9: 333-344, 1990.[Medline]
) administered by isolation perfusion for advanced tumours of the limbs: a model for biochemotherapy of cancer. Eur. J. Cancer, 31A: 1009-1016, 1995.
augments intratumoural concentrations of doxorubicin in TNF-
-based isolated limb perfusion in rat sarcoma models and enhances anti-tumour effects. Br. J. Cancer, 82: 973-980, 2000.[CrossRef][Medline]
treatment of three human melanoma xenografts. Br. J. Cancer, 74: 533-536, 1996.[Medline]
in mice. Int. J. Cancer, 46: 1095-1100, 1990.[Medline]
increases melphalan concentration in tumour tissue after isolated limb perfusion. Br. J. Cancer, 82: 1000-1003, 2000.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
F. Curnis, A. Sacchi, A. Gasparri, R. Longhi, A. Bachi, C. Doglioni, C. Bordignon, C. Traversari, G.-P. Rizzardi, and A. Corti Isoaspartate-Glycine-Arginine: A New Tumor Vasculature-Targeting Motif Cancer Res., September 1, 2008; 68(17): 7073 - 7082. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, K. Chen, W. Cai, Z. Li, L. He, A. Kashefi, and X. Chen Integrin-targeted imaging and therapy with RGD4C-TNF fusion protein Mol. Cancer Ther., May 1, 2008; 7(5): 1044 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cao, P. Du, S.-H. Jiang, G.-H. Jin, Q.-L. Huang, and Z.-C. Hua Enhancement of antitumor properties of TRAIL by targeted delivery to the tumor neovasculature Mol. Cancer Ther., April 1, 2008; 7(4): 851 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Marturano, R. Longhi, V. Russo, and M. P. Protti Endosomal Proteases Influence the Repertoire of MAGE-A3 Epitopes Recognized In vivo by CD4+ T Cells Cancer Res., March 1, 2008; 68(5): 1555 - 1562. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Crippa, A. Gasparri, A. Sacchi, E. Ferrero, F. Curnis, and A. Corti Synergistic Damage of Tumor Vessels with Ultra Low-Dose Endothelial-Monocyte Activating Polypeptide-II and Neovasculature-Targeted Tumor Necrosis Factor-{alpha} Cancer Res., February 15, 2008; 68(4): 1154 - 1161. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seresini, M. Origoni, F. Lillo, L. Caputo, A. M. Paganoni, S. Vantini, R. Longhi, G. Taccagni, A. Ferrari, C. Doglioni, et al. IFN-{gamma} Produced by Human Papilloma Virus-18 E6-Specific CD4+ T Cells Predicts the Clinical Outcome after Surgery in Patients with High-Grade Cervical Lesions J. Immunol., November 15, 2007; 179(10): 7176 - 7183. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Elia, E. Cassol, N. Sidenius, F. Blasi, A. Castagna, G. Poli, and M. Alfano Inhibition of HIV replication by the plasminogen activator is dependent on vitronectin-mediated cell adhesion J. Leukoc. Biol., November 1, 2007; 82(5): 1212 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhu, M. Waguespack, S. A. Barker, and S. Li Doxorubicin Directs the Accumulation of Interleukin-12 Induced IFN{gamma} into Tumors for Enhancing STAT1 Dependent Antitumor Effect Clin. Cancer Res., July 15, 2007; 13(14): 4252 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Curnis, R. Longhi, L. Crippa, A. Cattaneo, E. Dondossola, A. Bachi, and A. Corti Spontaneous Formation of L-Isoaspartate and Gain of Function in Fibronectin J. Biol. Chem., November 24, 2006; 281(47): 36466 - 36476. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bauer, N. Adrian, E. Fischer, S. Kleber, F. Stenner, A. Wadle, N. Fadle, A. Zoellner, R. Bernhardt, A. Knuth, et al. Structure-Activity Profiles of Ab-Derived TNF Fusion Proteins J. Immunol., August 15, 2006; 177(4): 2423 - 2430. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, E. Giraudo, J. A. Hoffman, D. Hanahan, and E. Ruoslahti Lymphatic Zip Codes in Premalignant Lesions and Tumors Cancer Res., June 1, 2006; 66(11): 5696 - 5706. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Crosti, R. Longhi, G. Consogno, G. Melloni, P. Zannini, and M. P. Protti Identification of Novel Subdominant Epitopes on the Carcinoembryonic Antigen Recognized by CD4+ T Cells of Lung Cancer Patients. J. Immunol., April 15, 2006; 176(8): 5093 - 5099. [Abstract] [Full Text] [PDF] |