
[Cancer Research 64, 606-611, January 15, 2004]
© 2004 American Association for Cancer Research
herg1 Gene and HERG1 Protein Are Overexpressed in Colorectal Cancers and Regulate Cell Invasion of Tumor Cells
Elena Lastraioli1,
Leonardo Guasti1,
Olivia Crociani1,
Simone Polvani1,
Giovanna Hofmann1,
Harry Witchel4,
Lapo Bencini3,
Massimo Calistri3,
Luca Messerini2,
Marco Scatizzi3,
Renato Moretti3,
Enzo Wanke5,
Massimo Olivotto1,
Gabriele Mugnai1 and
Annarosa Arcangeli1
1 Departments of Experimental Pathology and Oncology, and
2 Human Pathology and Oncology, University of Firenze, Firenze, Italy;
3 First Division of General Surgery and Transplantation, Careggi Hospital, Firenze, Italy;
4 Department of Physiology and Cardiovascular Research Laboratories, School of Medical Sciences, University of Bristol, Bristol, United Kingdom; and
5 Department of Biotechnology and Biosciences, University of Milano Bicocca, Milan, Italy
 |
ABSTRACT
|
|---|
The acquisition of the capacity to invade surrounding tissues confers a more malignant phenotype to tumor cells and is necessary for the establishment of metastases. The understanding of the molecular mechanisms underlying cell invasion in human solid tumors such as colorectal cancers could provide not only more sensitive prognostic analyses but also novel molecular targets for cancer therapy.
We report in this article that K+ ion channels belonging to the HERG family are important determinants for the acquisition of an invasive phenotype in colorectal cancers. The herg1 gene and HERG1 protein are expressed in many colon cancer cell lines, and the activity of HERG channels modulates colon cancer cell invasiveness. Moreover, the amount of HERG1 protein expressed on the plasma membrane is directly related to the invasive phenotype of colon cancer cells.
Finally, both the herg1 gene and HERG1 protein were expressed in a high percentage of primary human colorectal cancers, with the highest incidence occurring in metastatic cancers, whereas no expression could be detected either in normal colonic mucosa or in adenomas.
 |
INTRODUCTION
|
|---|
Cancer development is a multistep process, which includes not only alterations in cell growth and survival, but also the acquisition of the ability to invade surrounding tissues (1
, 2)
. The final step of tumor progression is the establishment of metastases, which represent the major hindrance to cancer therapy (1
, 2)
.
It has been proposed that the altered setting of the plasma membrane electric potential (Vrest) of cancer cells can contribute to tumor growth (3)
. Our studies have shown that Vrest in tumor cells can often be modulated by the activity of K+ channels, encoded by the human ether a-gò-gò related gene (herg; Ref. 4
). The corresponding current, IHERG, can contribute to driving the Vrest of tumor cells to more depolarized values, due to the peculiar biophysical properties of IHERG (5)
. Both the herg gene and HERG protein are indeed expressed in tumor cell lines of differing histogenesis (4)
, as well as in primary human cancers, such as endometrial adenocarcinomas (6)
, acute myeloid leukemias (7)
, and lymphoid leukemias (8)
. In leukemia (7
, 8)
and neuroblastoma cells (5
, 9)
, HERG channel activity modulates the progression through the mitotic cycle; in these cells an alternative transcript of the herg1 gene, herg1b, was cloned and shown to be mainly expressed during the S phase of the cell cycle (9)
. On the whole, data gathered thus far suggest that HERG channels may play a prominent role in the control of tumor cell proliferation (7, 8, 9)
and apoptosis (10)
. On the other hand, direct proof for the role of HERG channels in the regulation of tumor progression is lacking thus far, except for the demonstration of a functional association of HERG channels with integrin receptors (11
, 12)
, which are the adhesion receptors mainly involved in tumor cell migration and invasion (1
, 2)
.
Colorectal cancer is the third leading cause of cancer death worldwide (13)
, and the genetic steps involving mutations of suppressor genes (14, 15, 16)
are well known. On the other hand, there is a paucity of molecular predictive indicators for regional disease invasion and metastasis in this type of cancer.
On the basis of these premises, we studied the expression of HERG channels and their role in the process of tumor progression in colorectal cancers.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture.
Human colon cancer cell lines (H630, HCT8, DLD1, and HCT116) were cultured in RPMI 1640 containing 10% FCS and antibiotics (penicillin 100 units/ml and streptomycin 100 µg/ml). H630 cell clones were isolated by limiting dilution. HEK 293 cells were stably transfected with the herg1 gene in the pCDNA3.1(+) vector (Invitrogen; HEK-HERG1 cells) or with the empty vector (HEK-MOCK). Cells were routinely tested for HERG channel expression by RNase protection assay, Western Blot, and patch clamp (see below).
Tissue Collection.
Tissue specimens of paired neoplastic and normal mucosa (collected at least at 10 cm distant from the primary tumor), were obtained from surgical operations in patients suffering from colorectal cancers, after informed written consent was obtained. Patients were all treated at the First Division of General Surgery and Transplantation of Careggi Hospital, Firenze. Patients affected by viral hepatitis or who underwent previous combined neoadjuvant radiochemotherapy were excluded from data collection. Clinicopathological characteristics of patients enrolled in the study (evaluated by L. M.) are reported in Table 1
. Eleven polyps obtained from both colonoscopies and surgical operations were also examined. Tissue samples were taken in the operating room and immediately frozen or fixed in 4% formaldehyde in PBS in preparation for being embedded in paraffin. Particular care was taken in sampling normal mucosa to avoid the presence of muscolaris propria, which has been demonstrated to express the herg1 gene and HERG1 protein (17)
.
Cell Invasion Assay.
Cell invasion was studied essentially as reported in (18)
. Two hundred µl of cell suspension were inoculated into the upper well of a Boyden chamber in the presence or in the absence of the specific IHERG inhibitor Way 123,398 (Way; a kind gift from Dr. Walter Spinelli at Wyeth-Ayerst Research, Princeton, NJ) at 40 µM final concentration. After different times of incubation at 37°C, the migrated cells that remained trapped on the lower surface of the filter were fixed, stained with Diff-Quik stain kit (Dade Behering), and counted.
RNase Protection Assay.
RNase protection assay was performed essentially as reported in Crociani et al. (9)
, using the herg probe, which is capable of recognizing both the herg1 and the herg1b genes.
Reverse Transcription and PCR.
Reverse transcription-PCR for the herg1 and gapdh genes was performed as reported previously (7
, 8)
.
Production of the Anti-HERG1 COOH-Terminus Antibody.
The cDNA encoding amino acids 11061158 of the HERG1 protein was PCR amplified (5' primer: GTCGACGGACTCGCTTTCTCAGGT, SalI site italicized; 3' primer: GCGGCCGCACTGCCCGGGT, NotI site italicized) and cloned in frame with GST gene into pGEX 4T-2 vector (Pharmacia). Rabbit immunization, collection, and testing of the serum were performed as reported for the anti-HERG NH2 terminus antibody (8)
.
Protein Extraction and Western Blot.
Membrane protein extraction from HEK 293, H630, and HCT8 cells was performed as described previously (9)
. Tissues from both cancerous tissues and the corresponding mucosa were lysed by homogenizing samples in cold Tris HCl (pH 7.4) 50 mM, NaCl 125 mM, NP40 0.1%, EDTA 5 mM, and NaF 0.1 M, plus a complete protease inhibitors mixture (Roche). Western blots were obtained as reported (9)
, loading different amounts of protein extracts (15 µg for HEK-HERG1 cells, 60 µg for H630, HCT116, and HCT8 cells; and 60 µg for neoplastic and normal tissues), and membranes were decorated with the anti-HERG1 COOH-terminus antibody (see above) at 1:1000 dilution. In some experiments the antibody was preincubated with an excess of the antigenic peptide used for immunization.
Immunohistochemistry (IHC).
IHC was performed on 7-µm sections mounted on polylysine-coated slides. After dewaxing and blocking endogenous peroxidases, sections were treated with proteinase K (Roche; 5 µg/ml in PBS) and UltraVBlock solution (LabVision) containing 0.1% Triton X100, and then incubated with the primary antibody (anti-HERG1 COOH-terminus antibody; see above) diluted 1:100 in PBS-UltraVBlock (10:1 v/v) overnight at 4°C. Immunostaining was carried out using a commercially available kit (PicTure Plus kit; Zymed). For the negative control preimmune serum replacing the primary antibody was used.
Patch Clamp Recordings.
Patch-clamp recordings were performed on colon carcinoma cell lines at room temperature with an Axopatch 1-D amplifier (Axon Instruments, Foster City, CA), as reported previously (12)
. The antiarrhythmic drug Way was used at a 1 µM concentration. For data acquisition and analysis, the pClamp hardware and software (Axon Instruments) and Origin (Microcal Software, Northampton, MA) were routinely used.
 |
RESULTS AND DISCUSSION
|
|---|
The herg1 Gene and HERG1 Protein Are Highly Expressed in Colon Carcinoma Cell Lines.
herg1 gene expression was tested by RNase protection assay in various human colon cancer cell lines (DLD1, HCT8, HCT116, and H630) as performed previously in various cancer cell lines (9)
. As shown in Fig. 1A
, the herg1 gene was expressed in all of the cell lines examined although at different degrees (see Fig. 1
, inset). In particular, HCT116 and H630 cells expressed herg1 at the highest level, whereas HCT8 cells expressed it at the lowest level. No expression of the alternative transcript herg1b could be detected in colon cancer cell lines, whereas it was present in the heart, as expected (9
, 19)
.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1. herg1 gene and HERG1 protein expression in human colon carcinoma cell lines. A, herg1 gene expression. RNase protection assay was performed on RNA extracted from DLD1, HCT8, HCT116, and H630 colon carcinoma cells, and probed with the herg1 probe, which is able to discriminate between herg1 and herg1b as described in (9)
. Human heart RNA was used as a control; human cyclophilin (hcyc; Ambion) was used as an internal control and yeast tRNA as a negative control to test for probe self protection bands. Exposure was for 1 day. herg1, herg1b, and hcyc protected bands are indicated by arrows. Inset, densitometric analysis of herg1 expression; signals of the herg1 protected bands were normalized using the corresponding values of cyclophilin, and the value obtained in HCT116 cells was normalized to 1. B, HERG1 protein expression in HEK 293 cells; Western Blots were performed on proteins extracted from HEK 293 cells transfected with a herg1 construct (HEK-HERG1; Lane 1) and from HEK 293 wild-type cells (Lane 2), and were then probed with the anti COOH-terminus antibody as described in "Materials and Methods." Lane 3 shows the result of a Western blot performed on HEK-HERG1 using the antibody preincubated with an excess of antigenic protein. C, HERG1 protein expression in colon carcinoma cells lines. A Western blot was performed as in B. Lane 1: HEK-HERG1; Lane 2: H630; Lane 3: HCT8; Lane 4: HCT116. D, HERG current traces obtained in H630 colon carcinoma cell line: IHERG was measured at [K+]o = 40 mM, as the peak current elicited at -120 mV, after 15 s preconditioning at 0 mV. Top, protocol used in the experiment shown. (D') traces obtained in control conditions; (D'') traces obtained after perfusion of the cell examined with 1 µM Way; (D''') traces obtained after subctracting traces of D'' from traces of D' and revealing the net IHERG. Note the different X-axis scale in D'''.
|
|
The above results were also confirmed by Western blots with a novel anti-HERG1 COOH-terminus antibody developed in our laboratory. The immunoreactivity and specificity of the antibody was first tested on proteins extracted from herg1-transfected HEK 293 cells (Fig. 1B)
. The protein pattern was the same as that obtained with commercial anti-COOH-terminus antibodies (9)
. When tested on colon cancer cells (Fig. 1C)
, the antibody recognized the HERG1 protein in its immature (Mr 135,000) and mature (Mr
155,000) forms (9)
. No HERG1B protein was detectable. These experiments also confirmed that H630 and HCT116 cells express the HERG1 protein at higher levels compared with HCT8 cells.
A typical IHERG could also be recorded in colon cancer cells: a representative example is shown in Fig. 1D
. The inward current that was observed in high potassium extracellular solution (Fig. 1D')
, was completely blocked by Way, specific inhibitor of IHERG (Fig. 1D'')
. The current resulting from the subtraction of traces obtained in the presence and absence of Way (Fig. 1D''')
displays the typical features of the IHERG described previously in many tumor cell lines (4
, 5)
.
The Activity of HERG Channels Regulates Cell Invasion in Colon Cancer Cells.
The role of HERG channels in the invasiveness of colon cancer cells was first studied by analyzing the effect of HERG channel activity on cell migration through Matrigel-coated porous membranes inserted into Boyden chambers. Experiments were performed in the absence or in the presence of the HERG current inhibitor Way (5
, 9)
. As shown in Fig. 2
the addition of Way significantly reduced cell migration in H630, HCT116, and, although to a lesser extent, HCT8 cells; on the other hand, migration of HEK 293 cells, an epithelial cell line devoid of HERG channels, was unaffected by Way addition (Ref. 20
; see also Fig. 1B
).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2. Role of HERG1 in invasion of colon carcinoma cells, effect of Way. Colon carcinoma cell lines (H630, HCT116, and HCT8) and HEK 293 cells were seeded onto Matrigel-coated porous membranes inserted into Boyden chambers, in RPMI 1640 containing 250 µg/ml BSA, and left to migrate for 6 h (H630, HCT 116, and HCT8) or 16 h (HEK 293) at 37°C in a humidified atmosphere containing 5% CO2. The specific HERG inhibitor Way was added at time zero to the cell suspension at 40 µM final concentration; this concentration has been used previously to impair leukemia and neuroblastoma cell proliferation (7
, 9)
. Values are reported as the total number of migrated cells, and represent means of three separate experiments performed, each carried out in triplicate; bars, ±SE. * P < 0.005 Students t test.
|
|
These data show that HERG activity is an important factor regulating cell invasion of colon cancer cells. Moreover, data on Fig. 2
show a trend of correlation between the amount of HERG1 expressed and the invasion potential in the various cell lines, suggesting that the amount of HERG1 protein could somehow modulate the invasive capacity of colon cancer cells.
The Amount of HERG1 Protein Correlates with the Invasion Capacity of Colon Cancer Cells.
Because the cells in Fig. 2
were derived from potentially divergent sources (and may have many genetic differences in addition to their HERG expression), to test whether HERG1 expression could be specifically responsible for the difference in invasive capacity in colonic cancer cells, we developed a set of cell lines with various levels of HERG expression from a homogeneous background. Different clones from the H630 cell line were selected to obtain cells displaying low and high HERG expression. Cloning by limiting dilution yielded
20 clones, with roughly the same amount of clones with low and high HERG expression. Two clones were chosen displaying both the herg1 mRNA (Fig. 3A)
and the HERG1 protein (Fig. 3B)
at high (clone 3C8) and low (clone 3D3) levels, respectively. A correlation between the amount of HERG1 protein and the average amount of IHERG expressed in the cell population was confirmed (data not shown). When analyzed regarding their migration through Matrigel, the 3C8 clone displayed an invasion capacity almost three times higher than the 3D3 clone (Fig. 3C
, black bars). The invasive phenotype of the 3C8 clone reverted to the less invasive phenotype (associated with low HERG activity) when the activity of the HERG channels was specifically blocked by Way addition (Fig. 3C
, white bars). The difference in both HERG expression and invasion capacity of the two clones was maintained between 4 and 20 passages, and after freezing and thawing. On the other hand no difference in the growth in soft agar of the two clones was ever detected (10.8 ± 2.9 large colonies/microscopic field in 3D3 versus 11.0 ± 7.0 in 3C8).
The relationship between HERG1 expression and invasion capacity was confirmed by experiments on HEK 293 cells transfected with either a herg1-containing plasmid (HEK-HERG1) or an empty vector (HEK-MOCK). As shown in Fig. 4
, cell migration through Matrigel was strongly increased in HEK 293 cells overexpressing herg1 as compared with HEK-MOCK. Here again cell invasion turned out to depend on HERG channel activity (see the inhibitory effect of Way on HEK-HERG1 cells reported in Fig. 4
, inset). It is worth noting that Way addition did not alter cell invasion capacity in HEK-MOCK cells (data not shown), as stated above for HEK 293 wild-type cells.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4. Effect of HERG1 overexpression on invasion by HEK 293 cells. HEK 293 cells were stably transfected with herg1-containing (HEK-HERG1) or an empty pCDNA3.1 vector (Mock transfected, see "Materials and Methods"). Cell invasion was studied as reported in the legend to Fig. 2
except that the cells were left to migrate for 12 h. Values are means of four separate experiments each carried out in triplicate; bars, ±SE. * P < 0.005, Students t test. Inset, the effect of Way addition on HEK-HERG1 migration.
|
|
herg1 Gene and HERG1 Protein Are Expressed in Primary Human Colorectal Cancers, with a Higher Incidence in Metastatic Cancers.
To assess the pathophysiological significance in vivo of the results gathered thus far, we investigated whether HERG channels were expressed also in primary colorectal cancers, and if a correlation existed between such expression and the acquisition of an invasive and metastatic phenotype.
The expression of the herg1 gene and protein was determined in a set of primary colorectal adenocarcinomas (Adk) displaying different anatomical localizations and tumor grades (see Table 1
). For each tumor, a sample of the corresponding normal colonic mucosa (M) was also included in the study; some adenomas (Ad) obtained either from surgical operations or endoscopies were also studied. All of the samples were analyzed for herg1 gene expression by reverse transcription-PCR, and HERG1 expression by Western blot and IHC.
As shown in Fig. 5A
the PCR band related to the herg1 transcript was easily detectable in representative samples belonging to Adk, whereas a corresponding band was undetectable both in M and Ad. This result was confirmed by Western blot experiments: a typical experiment is reported in Fig. 5B
. The molecular weight of the band was Mr 145,000, as described in human hearts by Pond et al. (21)
. Here again HERG1B was not expressed.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 5. herg1 gene and HERG1 protein expression in primary human colorectal cancers. A, herg1 gene expression. Reverse transcription-PCR relative to herg1 and gapdh genes from colorectal cancer cDNA was performed as reported previously (10)
. The FLG 29.1 cell line was used as the positive control for herg1 expression; ADK, adenocarcinoma sample; AD, adenoma sample; M, normal colonic mucosa sample of the two ADK reported in the figure; C-: no DNA, no RNA sample. B, HERG1 protein expression in neoplastic and normal tissue. A Western blot was performed on primary human tissue as reported in "Materials and Methods" using the anti-HERG 1 antibody produced in our laboratory. ADK, adenocarcinoma sample; M, normal colonic mucosa sample; ADK (antigen excess), adenocarcinoma sample probed with the anti-HERG 1 antibody preincubated with an excess of antigenic protein. Note that no band below the HERG1 band (in the expected position of HERG1B) is detectable.
|
|
A complete IHC analysis of HERG1 protein expression on paraffin sections of all of the cases collected was performed. As shown in Fig. 6
no specific signal relative to HERG1 protein was evident either in epithelial tubules of M (Fig. 6A)
or in Ad (Fig. 6B)
; on the other hand, Adk samples were positive for HERG1 (Fig. 6C)
, showing a specific labeling of epithelial cells. A focal pattern of staining was always detected in positive Adk samples. Control experiments performed with preimmune serum resulted in no positive staining (a representative example of an Adk sample is shown in Fig. 6C
, inset).

View larger version (91K):
[in this window]
[in a new window]
|
Fig. 6. Immunohistochemical detection of HERG1 protein on normal and neoplastic colorectal tissues. Immunohistochemical detection of HERG1 protein on paraffin-embedded normal and neoplastic human colorectal tissues was performed as reported in "Materials and Methods," using the anti-HERG 1 polyclonal antibody reported above, and used at 1:100 dilution. A, normal colonic mucosa, normal epithelial tubules resulted in no HERG-specific staining. B, colonic adenoma, with no HERG-staining in tubular structures. C, adenocarcinoma of the rectum. Note neoplastic epithelial cells showing an intense and focal immunostaining; in the inset is reported a neoplastic specimen decorated with preimmune serum diluted 1:50. D, histogram showing data relative to all of the specimens collected (see Table 1
). Sixty samples of adenocarcinoma (ADK) and paired colonic mucosa (M) were examined: 8 ADK were classified as Dukes D (ADK Mtx), whereas the others belonged to Dukes groups AC. Eleven adenomas (AD) were also examined in this study. E, adenocarcinoma metastasis to the liver. Almost all of the metastatic epithelial cells show an intense immunostaining, without the focal pattern displayed by primary tumors (see C). In this case the anti-HERG1 antibody used was diluted 1:200.
|
|
The comparison of data obtained by reverse transcription-PCR and IHC resulted in essentially concordant results: a quantitative analysis of all of the results obtained is reported in Fig. 6D
and shows that the HERG1 protein was never expressed in M (60 of 60 specimens examined), but was expressed in 9% (1 of 11) Ad, and in 75% (39 of 52 cases) of nonmetastatic Adk (Dukes A-C). Metastatic (Dukes D) Adk turned out to be 100% positive for HERG1 protein expression (8 of 8). Hepatic and peritoneal metastases (Fig. 6E)
not only were positive, but also displayed a widespread and homogeneous staining (rather than showing a focal pattern of HERG1 expression).
 |
CONCLUSIONS
|
|---|
We studied the role of HERG channels in colon cancer cell invasiveness, and showed that: (a) almost all of the colon cancer cell lines express the herg1 gene and HERG1 protein; (b) the activity of HERG channels regulates cell invasiveness in many colon cancer cell lines; (c) the amount of HERG1 protein correlates with a more invasive phenotype of colon cancer cells; and (d) whereas no expression of HERG channels was detected in normal human colonic mucosa and adenomas, a high percentage of primary colorectal cancers expressed the HERG channel, with a higher incidence in metastatic cancers. Therefore, these results provide evidence that K+ channels belonging to the HERG family are involved in the establishment of an invasive phenotype in colorectal cancer cells both in vitro and in vivo.
Data reported in this article point to the conclusion that the role of HERG channels in primary solid tumors like colorectal cancers could be that of determining the acquisition of features leading to the establishment of a true invasive and metastatic cancer. Therefore, the immunohistochemical detection of HERG1 protein could represent an independent prognostic factor in the future.
On the whole, voltage-dependent K+ channels, especially those belonging to the HERG subfamily, could represent oncogenic products, because they promote cell proliferation and survival (7, 8, 9, 10)
, and contribute to conferring a malignant, invasive phenotype to cancer cells.
Targeted therapies promise to revolutionize the care of cancer patients: HERG channels and their inhibitors could be used not only as novel prognostic factors but also as novel molecular targets in the future.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Giacomo Trallori (Gastroenterology Unit, Careggi Hospital, Firenze) and the operation room staff of the First Division of General Surgery and Transplantation, Careggi Hospital, Firenze, Italy.
 |
FOOTNOTES
|
|---|
Grant support: Ministero dellUniversità e della Ricerca Scientifica e Tecnologica (COFIN, to A. A.), from Associazione Italiana contro le Leucemie (AIL, Firenze, to A. A.), from Fondazione Cassa di Risparmio Firenze (A. A.), and from Associazione Italiana per la Ricerca sul Cancro (AIRC, to M. O.).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Notes: The first and second author contributed equally to this work; Drs. Lastraioli and Guasti are PhD students in Experimental and Clinical Oncology (University of Firenze); Dr. Hoffman is a fellow of the Fondazione Italiana per la Ricerca sul Cancro (FIRC); Dr. Polvani is a fellow supported by Fondazione Cassa di Risparmio Pistoia.
Requests for reprints: Annarosa Arangeli, Department of Experimental Pathology and Oncology, University of Firenze, Firenze, Italy. Phone: 39 055 4282326; Fax: 39 055 4282333; E-mail: annarosa.arcangeli{at}unifi.it
Received 7/31/03.
Revised 10/ 7/03.
Accepted 11/ 3/03.
 |
REFERENCES
|
|---|
- Hanahan D., Weinberg R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.[CrossRef][Medline]
- Liotta L. A., Kohn E. C. Invasion and metastasis Bast R. C., Jr. Kufe D. W. Pollock R. E. Weichselbaum R. R. Holland J. F. Frei E., III eds. . Cancer Medicine, Ed. 5 121-131, B. C. Hamilton, Ontario, Canada 2000.
- Binggeli R., Weinstein R. C. Membrane potentials and sodium channels: hypoteses for growth regulation and cancer formation based on changes in sodium channels and gap junctions. J. Theor. Biol., 123: 377-401, 1986.[CrossRef][Medline]
- Bianchi L., Wible B., Arcangeli A., Taglialatela M., Morra F., Castaldo P., Crociani O., Rosati B., Faravelli L., Olivotto M., Wanke E. herg encodes a K+ current highly conserved in tumors of different histogenesis: a selective advantage for cancer cells?. Cancer Res., 58: 815-822, 1998.[Abstract/Free Full Text]
- Arcangeli A., Bianchi L., Becchetti A., Faravelli L., Colonnello M., Mini E., Olivotto M., Wanke E. A novel inward-rectifying K+ current with a cell cycle dependance governs the resting potentials of mammalian neuroblastoma cells. J. Physiol., 489: 455-471, 1995.[Medline]
- Cherubini A., Taddei G. L., Crociani O., Paglierani M., Buccoliero A. M., Fontana L., Noci I., Borri P., Borrani E., Giachi M., Becchetti A., Rosati B., Wanke E., Olivotto M., Arcangeli A. HERG potassium channels are more frequently expressed in human endometrial cancer as compared to non cancerous endometrium. Br. J. Cancer, 83: 1722-1729, 2000.[CrossRef][Medline]
- Pillozzi S., Brizzi M. F., Balzi M., Crociani O., Cherubini A., Guasti L., Bartolozzi B., Becchetti A., Wanke E., Bernabei P. A., Olivotto M., Pegoraro L., Arcangeli A. HERG potassium channels are constitutively expressed in primary human acute myeloid leukemias and regulate cell proliferation of normal and leukemic hemopoietic progenitors. Leukemia (Baltimore), 16: 1791-1798, 2002.
- Smith G. A. M., Tsui H. W., Newell E. W., Jiang X., Zhu X. P., Tsui F. W., Schlichter L. C. Functional up regulation of HERG K+ channels in neoplastic hematopoietic cells. J. Biol. Chem., 277: 18528-18534, 2002.[Abstract/Free Full Text]
- Crociani O., Guasti L., Balzi M., Becchetti A., Wanke E., Olivotto M., Wymore R. S., Arcangeli A. Cell cycle-dependent expression of HERG1 and HERG1B isoforms in tumor cells. J. Biol. Chem., 278: 2947-2955, 2003.[Abstract/Free Full Text]
- Wang H., Zang Y., Cao L., Han H., Wang J., Yang B., Nattel S., Wang Z. HERG K+ channel, a regulator of tumor cell apoptosis and proliferation. Cancer Res., 62: 4843-4848, 2002.[Abstract/Free Full Text]
- Arcangeli A., Becchetti A., Mannini A., Mugnai G., Defilippi P., Tarone G., Del Bene M. R., Barletta E., Wanke E., Olivotto M. Integrin mediated neurite outgrowth in neuroblastoma cells depends on the activation of potassium channel. J. Cell Biol., 122: 1131-1143, 1993.[Abstract/Free Full Text]
- Hofmann G., Bernabei P. A., Crociani O., Cherubini A., Guasti L., Pillozzi S., Lastraioli E., Polvani S., Bartolozzi B., Solazzo V., Gragnani L., DeFilippi P., Rosati B., Wanke E., Olivotto M., Arcangeli A. HERG K+ channels activation during ß1 integrin mediated adhesion to fibronectin induces an up regulation of
vb3 integrin in the preosteoclastic cell line FLG 29.1. J. Biol. Chem., 276: 4923-4931, 2001.[Abstract/Free Full Text]
- Greenlee R. T., Murray T., Bolden S., Wingo P. A. Cancer Statistics 2001. CA Cancer J. Clin., 50: 7-33, 2000.[Abstract]
- Fearon E. R., Vogelstein B. A genetic model for colorectal tumorigenesis. Cell, 61: 759-767, 1990.[CrossRef][Medline]
- Tacheuchi H., Bilchick A., Saha S., Turner R., Wiese D., Tanaka M., Kuo C., Wang H-J., Hoon D. S. B. cMET expression level in primary colon cancer: a predictor of tumor invasion and lymph node metastases. Clin. Cancer Res., 9: 1480-148, 2003.[Abstract/Free Full Text]
- Krishnamachary B., Berg-Dixon S., Kelly B., Agani F., Feldser D., Ferreira G., Iyer N., LaRusch J., Pak B., Taghavi P., Semenza G. L. Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1. Cancer Res., 63: 1138-1143, 2003.[Abstract/Free Full Text]
- Farrelly A. M., Ro S., Callaghan B. P., Khoyi M. A., Fleming N., Horowitz B., Sanders K. M., Keef K. D. Expression and function of KCNH2 (HERG) in the human jejunum. Am. J. Physiol. Gastrointest. Liver Physiol., 284: G883-893, 2003.[Abstract/Free Full Text]
- Dabizzi S., Noci I., Borri P., Borrani E., Giachi M., Balzi M., Taddei G. L., Marchionni M., Scarselli G., Arcangeli A. Luteinizing hormone increases human endometrial cancer cell invasiveness through activation of PKA. Cancer Res., 63: 4281-4286, 2003.[Abstract/Free Full Text]
- Lees-Miller J. P., Kondo C., Wang L., Duff H. J. Electrophysiological characterization of an alternatively processed ERG K+ channel in mouse and human hearts. Circ. Res., 81: 719-726, 1997.[Abstract/Free Full Text]
- Zhou Z., Gong Q., Ye B., Fan Z., Makielski J. C., Robertson G. A., January C. T. Properties of HERG channels stably expressed in HEK 293 cells studied at physiological temperature. Biophys. J., 74: 230-241, 1998.[Abstract/Free Full Text]
- Pond A. L., Scheve B. K., Benedict A. T., Petrecca K., Van Wagoner D. R., Shrier A., Nerbonne J. M. Expression of distinct ERG proteins in rat, mouse, and human heart. Relation to functional I(Kr) channels. J. Biol. Chem., 275: 5997-6006, 2000.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
L. Guasti, O. Crociani, E. Redaelli, S. Pillozzi, S. Polvani, M. Masselli, T. Mello, A. Galli, A. Amedei, R. S. Wymore, et al.
Identification of a Posttranslational Mechanism for the Regulation of hERG1 K+ Channel Expression and hERG1 Current Density in Tumor Cells
Mol. Cell. Biol.,
August 15, 2008;
28(16):
5043 - 5060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Heitzmann and R. Warth
Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia
Physiol Rev,
July 1, 2008;
88(3):
1119 - 1182.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pillozzi, M. F. Brizzi, P. A. Bernabei, B. Bartolozzi, R. Caporale, V. Basile, V. Boddi, L. Pegoraro, A. Becchetti, and A. Arcangeli
VEGFR-1 (FLT-1), {beta}1 integrin, and hERG K+ channel for a macromolecular signaling complex in acute myeloid leukemia: role in cell migration and clinical outcome
Blood,
August 15, 2007;
110(4):
1238 - 1250.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Spitzner, J. Ousingsawat, K. Scheidt, K. Kunzelmann, and R. Schreiber
Voltage-gated K+ channels support proliferation of colonic carcinoma cells
FASEB J,
January 1, 2007;
21(1):
35 - 44.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chapman, C. Ramstrom, L. Korhonen, M. Laine, K. T. Wann, D. Lindholm, M. Pasternack, and K. Tornquist
Downregulation of the HERG (KCNH2) K+ channel by ceramide: evidence for ubiquitin-mediated lysosomal degradation
J. Cell Sci.,
November 15, 2005;
118(22):
5325 - 5334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Miranda, T. Giraldez, P. de la Pena, D. G Manso, C. Alonso-Ron, D. Gomez-Varela, P. Dominguez, and F. Barros
Specificity of TRH receptor coupling to G-proteins for regulation of ERG K+ channels in GH3 rat anterior pituitary cells
J. Physiol.,
August 1, 2005;
566(3):
717 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Cherubini, G. Hofmann, S. Pillozzi, L. Guasti, O. Crociani, E. Cilia, P. Di Stefano, S. Degani, M. Balzi, M. Olivotto, et al.
Human ether-a-go-go-related Gene 1 Channels Are Physically Linked to {beta}1 Integrins and Modulate Adhesion-dependent Signaling
Mol. Biol. Cell,
June 1, 2005;
16(6):
2972 - 2983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Pardo
Voltage-Gated Potassium Channels in Cell Proliferation
Physiology,
October 1, 2004;
19(5):
285 - 292.
[Abstract]
[Full Text]
[PDF]
|
 |
|