| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Molecular Therapeutics Unit, Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland;
2 Department of Pharmacology, Duke University Medical Center, Durham, North Carolina; and
3 Institute of Signalling, Developmental Biology and Cancer Research, Centre Antoine Lacassagne, Nice, France
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Cell cycle progression is controlled by the cyclic activation of a family of serine-threonine kinases, the cyclin-dependent kinases (cdks; Refs. 11, 12, 13 ). Regulation of cdk activity occurs mainly through the complex with cyclin cofactors and through the stoichiometric binding of endogenous cdk inhibitors to the cdk/cyclin complex (11, 12, 13) . The cdk inhibitor p21waf1/cip1 is the prototype of an endogenous cdk inhibitor. This general cdk inhibitor is a downstream effector of the tumor suppressor gene p53 (14, 15, 16, 17) . Several important physiologic functions are ascribed to p21waf1/cip1, including cell cycle arrest, differentiation, DNA repair, apoptosis, and senescence, among other functions (18, 19, 20) . The regulation of p21waf1/cip1 occurs primarily at the transcriptional and post-transcriptional levels (21, 22, 23, 24) . The tumor suppressor gene p53 is the bona fide transcriptional activator of p21waf1/cip1 because this promoter displays p53 binding site in its sequence (15) . However, p21waf1/cip1 can also be transcriptionally regulated by p53-independent mechanisms (18 , 23, 24, 25, 26) .
Initial efforts in our laboratory demonstrated that ALKs (particularly perifosine) promote cell cycle arrest at the G1-S and G2/M by up-regulation of p21waf1/cip1 protein levels, independent of p53 function (9) . Increased levels of p21waf1/cip1 induced by perifosine are associated with cdks, thereby inhibiting cdk activity. The cell cycle arrest induced by perifosine requires p21waf1/cip1 because HCT 116 cell lines lacking p21 (HCT 116 p21-/-) are refractory to perifosine. Thus, the induction of p21waf1/cip1 by ALKs is p53 independent and is required for the cell cycle effects of ALKs (9) .
In this study, we investigated the mechanism by which ALKs induce p21waf1/cip1 protein accumulation. We showed that the induction of p21waf1/cip1 by ALKs is due to a p53-independent transcriptional activation of the p21waf1/cip1 promoter. We also showed that the minimal promoter region required by perifosine is similar to the minimal region required by Ras to induce p21waf1/cip1. Furthermore, we demonstrated that perifosine activates the mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK mitogen-activated protein kinase (MAPK) pathways, and this activation leads to increased Sp1 phosphorylation, leading to enhanced Sp1 DNA-binding activity. Altogether, our results illustrate a novel mechanistic aspect by which ALKs regulate p21waf1/cip1 transcription.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents.
Zentaris (Frankfurt, Germany) provided perifosine and other ALKs (miltefosine and edelfosine). For in vitro studies, perifosine was reconstituted as a 100 mM stock solution in PBS. PD98059 (Calbiochem, Darmstadt, Germany) and actinomycin D (Sigma Chemical Co., St. Louis, MO) were diluted in DMSO, stock concentrations of 25 µM and 5 µg/ml, respectively. PP2A was obtained from Upstate Cell Signaling (Lake Placid, NY).
Immunoblot Analysis.
To study the role of MEK/ERK pathways, HaCaT cells were cultured under serum deprivation conditions for 16 h and exposed to increasing concentrations of perifosine for 30 min, or to 10 µM of perifosine for increasing time periods. Cell lysates were obtained as described previously (9
, 27)
. Briefly, 25 µg of protein were electrophoretically resolved in 420% Tris Glycine SDS-PAGE gel (Invitrogen) and transferred to a polyvinylidene difluoride membrane, Immobilon-P (Millipore, Bedford, MA). The primary antibodies used were p21waf1/cip1 (clone 6B6; BD Transduction Laboratories, San Diego, CA), actin (Chemicon International, Temecula, CA), laminin C (c-20), pERK (E-4), ERK-2 (c-14), HSP90 (H114), and Sp1 (PEP 2; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Reactions were detected by horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence (ECL) following the manufacturers instructions. For PP2 treatments, nuclear extracts were incubated with 0.6 units of PP2A for 30 min at 30°C. The reaction was stopped by the addition of 50 mM NaF and 5 mM potassium PPI, and run on an SDS gel as described above.
ERK 1/2 in Vitro Kinase Assays.
Exponentially growing HaCaT cells were serum starved for 16 h and exposed to vehicle (PBS) or to increasing concentrations of perifosine for 30 min. After treatment, cells were lysed as described previously (28)
. Briefly, 200 µg of total cellular lysate was immunoprecipitated with ERK-2 antibody (Santa Cruz Biotechnology, Inc.) for 1 h at 4°C. Then, Gammabind G Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) was used to capture the immune complexes. After three washes, kinase reactions were performed in kinase assay buffer [12.5 mM 4-morpholinepropanesulfonic acid (pH 7.5), 12.5 mM ß-glycerophosphate, 7.5 mM MgCl2, 0.5 mM EGTA (pH 8.0), 0.5 mM NaF, and 0.5 mM NaV4] containing
-[32P]ATP (3000 Ci/mmol; NEN, Boston, MA), 20 µM cold ATP, and 50 µg of myelin basic protein as substrate. Reactions were incubated at 37°C for 30 min and terminated by the addition of SDS-gel loading buffer. The resolved and dried gels were subjected to autoradiography and quantified by PhosphorImager (Molecular Dynamics).
Northern Blot Analysis.
Total RNA was extracted using TRIZOL (Invitrogen) following the manufacturers recommendations. Twenty-five µg of total RNA were separated on 1% formaldehyde-agarose gels and transferred to nylon membranes (Hybond-XL; Amersham Pharmacia Biotech) by capillary action. A p21waf1/cip1 probe was generated by digestion of pCMV p21waf1/cip1 (obtained from Michele Pagano, New York University, New York, NY) with XbaI and HindIII, and then gel purified using a GeneClean spin kit (Qbiogene, Inc., Carlsbad, CA). Glyceraldehyde-3-phosphate dehydrogenase was obtained from Ambion, Inc. (Austin, TX). Probes were labeled with [
32P]D-ATP by random priming using StripEZ DNA kit (Ambion, Inc.). Northern blot hybridization to 32P-labeled probes was performed using Hybrisol I solution (Intergen Company, Purchase, NY) following the manufacturers instructions. Signals were detected by exposure to BioMax MR film (Kodak, Rochester, NY), and quantitation of signals was performed by densitometry.
Real-Time Quantitative PCR.
HaCaT cells were plated and grown overnight to
70% confluence and treated with increasing concentrations of perifosine (1, 3, 5, and 10 µM) for 12 h or with 10 µM perifosine for several time periods (1, 3, 6, 9, and 12 h). Total RNA was extracted using TRIzol (Invitrogen) following the manufacturers recommendations. Two µg of RNA were incubated in a final volume of 20 µl containing 2 µl of real-time buffer (10x), 2 µl of deoxynucleoside triphosphate mix (5 mM), 2 µl of oligodeoxythymidylic acid primer (10 µM) and 1 µl of real-time Omniscript enzyme (Qiagen, Valencia, CA). After 1 h at 37°C, quantitative PCR was performed with 1 µl of cDNA, 1 µl of primer mix (10 µM), and 12.5 µl of SYBR Green (Quantitect SYBR Green PCR kit; Qiagen) in a final volume of 25 µl. The primers used were 5'CTG GAG ACT CTC AGG GTC GAA3' and 5'GAA TTA GGG CTT CCT CTT GGA 3' for p21waf1/cip1, and 5' GAA GGT GAA GGT CGG ACT C 3' and 5' GAA GAT GGT GAT GGG ATT TC 3' for glyceraldehyde-3-phosphate dehydrogenase. Quantitative PCR was performed in an ABI Prism 7700 Sequence Detector cycler (Perkin-Elmer Applied Biosystems, Foster City, CA) as follows, 94°C for 5 min, then 40 cycles at 95°C for 30 s and at 60°C for 30 s. To determine whether the accumulation of p21waf1/cip1 induction by perifosine is due to post-transcriptional control (i.e., increase in p21waf1/cip1 mRNA half-life), HaCaT cells were treated for 12 h with 10 µM of perifosine, washed with PBS, and exposed to actinomycin D (1 µg/ml) or actinomycin D and perifosine for increasing time periods (0.5, 1, 2, 4, 6, or 8 h). Cells were harvested, RNA was isolated using TRIzol, and real-time and quantitative PCR were performed as described above.
Luciferase Promoter Analysis.
HaCaT cells were transfected with different expression plasmids using Fugene (Roche, Indianapolis, IN) according to the manufacturers protocol, 1 µg of each of the reporter plasmids, and 0.01 µg of pRL-null (a plasmid expressing the enzyme Renilla luciferase from Renilla reniformis) as an internal control, adjusting the total amount of plasmid DNA with empty vector (pcDNAIII-ß gal, a plasmid expressing the enzyme ß-galactosidase). Twelve h after transfection, cells were exposed to 10 µM perifosine for 18 h. Firefly and Renilla luciferase activities present in cellular lysates were assayed using the Dual-Luciferase Reporter System (Promega, Madison, WI), and light emission was quantitated using the MLX Microtiter plate luminometer as specified by the manufacturer (Dynex Technologies, Chantilly, VA). Luciferase activities were normalized based on total protein concentrations and Renilla luciferase activity. All of the p21waf1/cip1 promoter constructs used herein were reported previously (26)
. Briefly, p21PSma
1-luc was created by the digestion of the 2.4-kb full-length promoter (p21P-luc) with SmaI and religation. p21Psma-luc (minimal promoter region for Ras activity) was created by cloning the 50-bp SmaI fragment of the p21waf1/cip1 promoter into pGL-2 basic (26)
. Mutagenesis of p21P93-S-luc was performed to generate p21P93-Smut#2 to 5 and p21P93-Smut#2.2. Sp11 site was mutated from the wild-type CCCGCCTCCT to TATCTAGAAC (p21P 93-S mut#2-luc); Sp12 was mutated from TGAGGCGGGC to CTCTAGAAAT (p21P 93-S mut#3-luc); Sp13 was mutated from CCGGGCGGGG to ATCTAGACAT (p21P 93-S mut#4-luc); and Sp14 was mutated from CGGTTGTATAT to TCTAGACCGT (p21P 93-S mut#5-luc; Ref. 26
). Plasmids encoding vectors for the activating mutant for Ras (Ras V12) and dominant-negative MEK (MEKAA) were provided by Silvio Gutkind (NIH, Bethesda, MD) and have been described previously (28)
.
Electrophoretic Mobility Shift Assays.
Oligonucleotides corresponding to the wild-type consensus Sp1 site (5'ATT CGA TCG GGG CGG GGC GAG C3') were obtained from Promega, or an oligonucleotide corresponding with the mutant Sp1 sequence in the p21waf1/cip1 promoter (p21P 93-S mut#2.2, CCC GCC TCA AGG ATC CGG GAC CCG C) was end-labeled with [
32P]ATP using T4 polynucleotide kinase (Invitrogen). The resulting end-labeled oligo was purified using a G25 column (Amersham Pharmacia Biotech). Approximately 10,000 cpm of labeled probe was used in each gel shift analysis reaction. To prepare nuclear extracts, HaCaT cells were plated in 150-mm plates and grown to 70% confluency. Cells were then incubated with vehicle (PBS) or 10 µM perifosine for 12 h. As a positive control, HaCaT cells were transfected with 500 ng of activated Ras (Ras V12). Cells were washed in cold PBS and lysed in 400 µl of lysis buffer [0.1 mM HEPES (pH 7.9) 1 mM KCl, 0.02 µM EDTA, 0.04 µM EGTA, 1 mM DTT, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride]. After 15 min, 25 µl of 10% of NP40 was added and vigorously vortexed for 10 s. After centrifugation (13,000 x g), nuclear pellets were resuspend in 50 µl of ice-cold hypotonic lysis buffer [20 mM HEPES (pH 7.9), 0.42 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride]. Six µg of nuclear protein extract were incubated at 4°C with 1 µg of poly(deoxyinosinic-deoxycytidylic acid) in 10 µl of buffer reaction [24 mM HEPES (pH 7.8), 120 mM KCl, 4 mM MgCl2, 0.24 mM EDTA, 0.6 mM DTT, 0.6 mM phenylmethylsulfonyl fluoride, and 24% glycerol] and 0.1 µg of salmon sperm DNA for 15 min. Wild-type or mutant probes were then added, and after 20 min of incubation at room temperature, the reaction was stopped with loading buffer and resolved on a 5% acrylamide gel at 100 V for 4 h at 4°C. Gels were subsequently dried and exposed to autoradiograph film. For Sp1 supershift assays, 0.4 µg of Sp1 (PEP-2)-specific antibody (Santa Cruz Biotechnology, Inc.) was added to the binding reaction before the addition of radiolabeled probe for 15 min.
Immunofluorescence Studies.
HaCaT cells were seeded on glass coverslips and serum starved for 16 h. HaCaT cells were exposed to vehicle alone or to 10 µM perifosine for 1 h. Also, HaCaT cells were preincubated with 50 µM PD98059 for 15 min before perifosine exposure (for a total of 75 min). Cells were washed twice with 1x PBS, fixed, and permeabilized with 4% formaldehyde and 0.5% Triton X-100 in 1x PBS for 10 min. After washing with PBS, cells were blocked with 1% BSA and incubated with the indicated primary antibodies for 1 h, rabbit polyclonal anti-phospho-Thr453 (1:120), rabbit polyclonal anti-phospho-Thr739 (1:120; Ref. 29
), or Sp1 (PEP-2; 1:100; Santa Cruz Biotechnology). After an incubation period of 1 h, cells were washed three times with 1x PBS, then incubated additionally for 1 h with the corresponding secondary antibodies (Cy-3-conjugated donkey antirabbit; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA; 1:500). Coverslips were washed three times, mounted in Vectashield mounting medium with 4',6-diamidino-2-phenylindole (Vector Laboratories, Inc., Burlingame, CA), and viewed using a Leica TCS-SP2 confocal system (Heidelberg, Germany).
| RESULTS |
|---|
|
|
|---|
3 µM at 6 h of treatment, reaching
2.5-fold induction with 10 µM at 12 h of exposure, suggesting that perifosine accumulates p21waf1/cip1 protein by increasing p21waf1/cip1 mRNA levels. To determine whether perifosine-induced accumulation of p21waf1/cip1 was due to post-transcriptional control, we conducted pulse-chase analyses in the presence of actinomycin D and measured p21 mRNA by reverse transcription-PCR. We observed that p21 mRNA expression decreased to a similar extent in both vehicle and perifosine up to 8 h after actinomycin D exposure (17% ±2 and by 12% ±1, respectively). These experiments demonstrated that the p21waf1/cip1 induction by perifosine cannot be explained by p21 mRNA stabilization, suggesting that the accumulation of p21waf1/cip1 mRNA by perifosine is mainly due to transcriptional effects.
|
10-fold) was observed when cotransfected Ras V12 (the activated form of Ras) was used as a positive control (26)
. To investigate whether the transcriptional activation of p21waf1/cip1 by perifosine is related to p53 function, we transfected the p53-mutant HaCaT cell lines with the p21P
p53-luc reporter, a p21waf1/cip1 reporter construct lacking 250 bp from the 5' end corresponding to a p53 consensus DNA-binding site. Perifosine activates this construct (
9-fold) despite the lack of the p53 consensus site, indicating that neither the presence of p53 binding sites in the p21waf1/cip1 promoter nor the presence of p53 protein was required for perifosine to activate the p21waf1/cip1 promoter.
|
20-fold), similar to Ras V12. Moreover, when HaCaT cells were transfected with full-length p21waf1/cip1 construct lacking the Ras minimal promoter region (p21PSma
1-luc), the induction was lost for both Ras V12 and perifosine. Of note, induction of p21SMA-luc was also observed when edelfosine and miltefosine were used as controls (data not shown). Thus, the minimal p21waf1/cip1 promoter region for ALKs is similar to that of Ras and seems to be represented by a region in the p21waf1/cip1 promoter proximal to the SmaI site at -111 (p21PSma-luc).
To additionally define the cis-acting elements in the p21waf1/cip1 minimal promoter required for perifosine induction, we tested a series of mutant Sp1 constructs (p21 93-S-luc) as described in "Materials and Methods." The "wild-type" p21P93-S-luc reporter plasmid contains the promoter sequence between -93 and -34, and spans four Sp1-binding sites: Sp1 site 1 (-84 to -79) and Sp1 site 2 (-70 to -65) are independent binding sites, whereas Sp1 site 3 (-60 to -55) and Sp1 site 4 (-55 to -51) have overlapping features (see Fig. 3
). To determine which of these Sp1 elements mediate perifosine effects, five P21 93-S mutant "scrambled" constructs were initially used (see Fig. 3
; Refs. 26
, 31
). When p21P93-S-luc (wild-type) was transfected, perifosine induced a 7-fold increase in luciferase activity, similar to Ras V12 (5-fold). Mutation of Sp1-binding sites 2, 3, or 4 (constructs p21P 93-S mut#3, mut#4, and mut#5) led to a significant decrease in luciferase activity (
2-fold induction for both perifosine and Ras V12, respectively). Moreover, when the Sp1-binding site (site 1) was scrambled (p21P 93-S mut#2) or mutated by the addition of 2-bp mutations CCGCCTCAAGGATCCGGGACCCGC) in this site (p21P 93-S mut#2.2), the blocking effect of these mutants was even more evident. Taken together, these results indicate that all of the Sp1 sites in this region are required for perifosine induction of the p21waf1/cip1 promoter.
|
|
Perifosine Enhances Sp1 DNA-Binding Activity Due to Increased Sp1 Phosphorylation.
To determine whether perifosine affects the DNA-binding activity of Sp1, we performed electrophoretic mobility shift analyses by incubating nuclear extracts from cells exposed to perifosine with a radiolabeled Sp1 response element containing oligonucleotide. As shown in Fig. 5
, we were able to detect several protein-DNA binding complexes, which were undetected when a mutant Sp1 oligonucleotide was used in the binding reaction, indicating that these complexes contained specific proteins binding to the Sp1 consensus site. Supershift assays using specific Sp1 antibody confirmed that the slowest migrating complex represents Sp1 (Fig. 5
, Lane 2). Of note, this band was not visualized when an irrelevant IgG was used (data not shown). Moreover, treatment with perifosine or overexpression of Ras V12 increased the specific DNA-binding activity of Sp1, as demonstrated by the supershift of the Sp1 complexes (compare Lanes 2, 4, and 6 in Fig. 5A
). Of note, several bands in both perifosine- and Ras-treated cells remained unaltered when incubated with specific Sp1 antibodies. Moreover, they were not present when nuclear extracts were incubated with mutant Sp1 oligonucleotides. These bands, as previously reported elsewhere in the case of Ras, represent increased binding to Sp3, a transcriptional factor that binds to DNA using the same DNA-binding consensus sequence as Sp1 (26)
. Taken together, these results suggest that perifosine, similar to Ras, activates p21waf1/cip1 transcription by increasing the binding of the Sp1 transcription factor to the minimal promoter region of the p21waf1/cip1 promoter.
|
Perifosine-Induced Sp1 DNA Activity Requires the Phosphorylation of Sp1 by MEK/ERK Pathway.
Previous studies using Ras and/or activators of the MEK/ERK pathway have demonstrated that phosphorylation of Sp1 increased its transactivation capacity (39
, 40)
. A recent study demonstrated that Ras induces the phosphorylation of Sp1 at two specific sites, threonine 453 and 739, and this phosphorylation increases Sp1 transcriptional activity (29)
. To determine whether perifosine can promote the phosphorylation of Sp1 in these MAPK-specific sites, nuclear extracts obtained from HaCaT cells exposed to perifosine were immunoblotted with Sp1 phosphospecific antibodies. As clearly shown in Fig. 6A
, increased Sp1 phosphorylation at residue threonine 453 (a known MAPK site) was observed within 60 min of perifosine incubation. Moreover, preincubation of perifosine-treated cells with PD98059 (a known MEK inhibitor) demonstrated loss in Sp1 phosphorylation, suggesting that the increased phosphorylation induced by perifosine in this particular site is due to MEK activation. As a loading control, we used laminin C, an intermediate filament protein localized in the nucleus (41)
.
|
We then examined whether the increased Sp1 DNA-binding activity by perifosine is mediated by the MEK/ERK pathway. To this end, nuclear extracts obtained from HaCaT cells exposed to perifosine in the presence of MEK blockers (PD98059 or MEKAA) were used in the binding reactions. As demonstrated in Fig. 6C
, the increase in Sp1 binding activity induced by perifosine was blunted by the presence of either PD98059 or MEKAA, indicating that the increased Sp1 DNA-binding activity promoted by perifosine occurs as a result of activation of MEK/ERK leading to Sp1 phosphorylation.
In summary, the ALK perifosine promotes cell cycle arrest as a result of transcriptional activation of p21waf1/cip1. This effect occurs because of activation of the MEK/ERK pathway, and this enhanced activity promotes the specific phosphorylation of Sp1 protein, thereby increasing Sp1 DNA binding to the p21waf1/cip1 promoter.
| DISCUSSION |
|---|
|
|
|---|
Initial efforts from our laboratory demonstrated that ALKs promote G1 and G2/M arrest in tumor cell lines because of up-regulation of p21waf1/cip1 (9) . The endogenous cdk inhibitor p21waf1/cip1 is a known universal cdk inhibitor of which the induction may lead to several phenotypes, including cell cycle arrest, cellular senescence, apoptosis, and differentiation (14 , 15 , 16 , 42, 43, 44, 45, 46, 47, 48, 49, 50) . Perifosine induced accumulation of p21 protein at the transcriptional level by an increase in mRNA message, not by an increase in p21 mRNA stability. Studies using full-length and deletion mutant p21waf1/cip1 luciferase reporters demonstrated a significant activation of the full-length 2.4-kb (p21P-luc) and the construct lacking p53-binding sites, suggesting that the transcriptional activation of p21waf1/cip1 by ALKs was independent of p53 function. Suprisingly, the minimal p21promoter region is the same minimal region (pSMA-luc) required by the proto-oncogene Ras to induce p21waf1/cip1 promoter (26 , 31) . To test whether the p21waf1/cip1 transcriptional activation by perifosine occurred in other cell types, we transfected pSMA-luc into HCT116 isogenic cell lines (wild-type or p53 null cells). Again, perifosine activated pSMA-luc in both cell lines (data not shown), demonstrating that the induction of the p21 minimal promoter by perifosine occurred in other cell types and was also independent of p53 function. Interestingly, the induction of pSMA-luc by Ras or perifosine appeared to be higher than the full-length construct (p21P-luc). This higher activation could be explained by the presence of a distal negative regulatory region in the p21 promoter for both Ras and ALKs. We are currently studying the cause of this event.
The pSma-luc construct contains several Sp1-binding sites that play a major role in the transcriptional regulation of p21waf1/cip1 by Ras (26 , 31) . Mutational analysis of this minimal promoter demonstrated that mutations in each Sp1 site had a profound effect on p21 transcription by perifosine, similar to Ras. Taken together, these results suggest a critical role of Sp1 in p21waf1/cip1 activation by perifosine, as has been observed previously with Ras (26) .
The proto-oncogene Ras is a known activator of prototypical MAPK pathways, ERK1 and ERK2 (51 , 52) . Activated ERK, in turn, phosphorylates multiple transcription factors, thereby enhancing its transcriptional activation (53) . On the basis of the similar effects of ALKs and Ras on the p21waf1/cip1 promoter, we determined the effects of perifosine on MEK activation. A very potent activation of the MEK/ERK pathway was observed within minutes of perifosine exposure. Moreover, this activation preceded the p21waf1/cip1 mRNA accumulation by perifosine. The role of MEK activation in p21waf1/cip1 induction by perifosine was analyzed using dominant-negative alleles and/or chemical inhibitors of MEK (PD98059). Blockade of MEK clearly blunted the p21waf1/cip1 promoter induction. Thus, perifosine mediated the transcriptional activation of the p21waf1/cip1 promoter by activation of MEK, similar to Ras. Moreover, MEK blockade blunted the induction of p21waf1/cip1 at the protein level, indicating that MAPK activation induced by perifosine was required for p21 accumulation. Interestingly, addition of the chemical MEK inhibitor PD98059 to HaCaT cells somewhat increased p21waf1/cip1 protein expression. This phenomenon may be explained by the lack of specificity of chemical inhibitors in general (54) . Thus, it is possible that PD98059 may inhibit, in addition to MEK, a kinase relevant for p21waf1/cip1 expression. To explore how MAPK activation leads to an increase in p21waf1/cip1 expression, gel-shift studies demonstrated that perifosine increased Sp1 DNA-binding activity. Moreover, MEK ablation by PD98059 and/or dominant-negative MEK prevented increased Sp1 DNA-binding activity by perifosine. Taken together, the transcriptional transactivation of the p21waf1/cip1 promoter by perifosine required MEK activation.
Sp1 is a member of a multigene family that binds DNA through COOH-terminal zinc-finger motifs (32 , 33) . Sp1 is a ubiquitous transcription factor that has been implicated in the activation of many genes (32 , 55 , 56) . Although Sp1 activity was initially thought to be constitutive, it has been shown that it can be regulated at different levels (20 , 57, 58, 59, 60) . Sp1 can be phosphorylated (a modification that affects its binding to the DNA; Refs. 29 , 39 , 57 , 58 ) and O-glycosylated (a modification that confers resistance to proteosome-dependent degradation; Ref. 61 ). Milanini-Mongiat et al. (29) demonstrated recently that Ras modulates the transcription of the vascular endothelial growth factor promoter by the phosphorylation of Sp1 at two specific sites (threonines 453 and 739) by activation of the MEK/ERK pathways. On the basis of the potent activation of MEK/ERK by perifosine, we asked whether perifosine modulates Sp1 phosphorylation. As expected, increased phosphorylation was demonstrated at both phosphorylation sites by Western blotting and/or immunofluorescence. Moreover, the increased specific phosphorylation and enhanced Sp1 DNA-binding activity induced by perifosine was blunted with pretreatment with the MEK inhibitor PD98059 and/or incubation of lysates with the serine-threonine phosphatase PP2A. Thus, it appears that activation of the MAPK pathway not only regulates the phosphorylation of Sp1 but also mediates the enhanced DNA-binding activity and increases transcriptional p21waf1/cip1 promoter activation induced by perifosine. Experiments in our laboratory are being undertaken to elucidate this novel mechanism.
Notably, it appears that the increased Sp1 phosphorylation coincides with an increase in Sp1 protein, and this increase appears to be partially mediated by activation of MEK because PD98059 can, to some extent, blunt the induction of Sp1 by perifosine. Noe et al. (39)
demonstrated that acute exposure (
15 min) of Chinese hamster ovary cells to 12-O-tetradecanoylphorbol-13-acetate, a known activator of MEK/ERK pathway (62)
, promotes increase in Sp1 mRNA and protein levels, leading to increased Sp1 DNA-binding activity to the dihydrofolate reductase promoter. Thus, our observations confirm separate observations by other investigators (29
, 39
, 40)
that the activation of MEK/ERK pathways by different stimuli promotes the increase in Sp1 expression, phosphorylation, and DNA-binding activity, thereby enhancing Sp1 transcriptional activation. In our study, MEK blockade prevented p21 transactivation/expression, decreased Sp1 DNA binding, and decreased Sp1 phosphorylation with perifosine exposure. Thus, these data indicate that the activation of MAPK by ALKs is required for all of the events necessary for p21 transactivation.
Although Sp1 is a transcriptional factor involved in the transcription of several genes, we demonstrated the specificity and requirement of Sp1 in p21 transactivation by ALKs using several strategies: first, we showed that the minimal promoter region of the p21 promoter (
60 bp) is composed of several Sp1 sites that, when mutated, render the promoter inactive; second, perifosine promoted a specific increase in Sp1 DNA-binding activity at concentrations and times required for p21 up-regulation; third, phosphorylation of Sp1 at specific MAPK-dependent sites was required for p21 transactivation; and fourth, MEK blockade promoted loss in p21 transactivation that is associated with loss in Sp1 phosphorylation and loss in Sp1 DNA binding.
One intriguing detail to note is the ability of ALKs to activate the MEK/ERK MAPK pathway. It is counterintuitive that a small molecule that belongs to a known class of antiproliferative agents, ALKs, may have the capacity to activate a proliferative pathway such as the MEK/ERK MAPK. However, other antiproliferative agents, including paclitaxel and cisplatin, do activate MEK/ERK MAPK pathways (63 , 64) . Furthermore, Ras (a known activator of MEK/ERK) itself can lead to antiproliferative phenotypes such as cell death or senescence, in some models, due to activation of the MEK/ERK pathways (65 , 66) . Thus, activation of the MEK/ERK pathways by different stimuli including proto-oncogenes or drugs can, in some circumstances, mediate antiproliferative pathways. How alkylphospholipids activate the MEK/ERK pathway is still unknown. In some in vitro models, ALKs modulate several signal transduction pathways, including protein kinase C, phospholipase C, and phospholipase D (67 , 68) . It is quite possible that modulation of these and other unknown pathways by ALKs may promote the activation of MAPKs. Moreover, it is still possible that ALKs may activate a stress response leading to the activation of MAPKs (69) . Additional experiments are warranted to investigate the exact nature of this activation.
In summary, APKs are a novel class of antiproliferative small molecules that modulate cell cycle progression via transcriptional activation of the p21waf1/cip1 promoter. This activation is due to MAPK-dependent Sp1 phosphorylation and increased Sp1 DNA-binding activity to the p21waf1/cip1 promoter. Thus, this novel pathway by which alkylphospholipids regulate p21waf1/cip1 gene expression appears to be highly dependent on MAPK-dependent phosphorylation of Sp1. Additional work will be necessary to identify the nature of the molecules required for alkylphospholipids to activate MAPK and to investigate the role of this novel signaling pathway in normal and aberrant cell growth.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Requests for reprints: Adrian M. Senderowicz, Molecular Therapeutics Unit, Oral and Pharyngeal Cancer Branch, National Institute of Craniofacial and Dental Research, NIH, 30 Convent Drive, Building 30, Room 212, Bethesda, MD 20892-4330. Phone: (301) 594-5270; Fax: (301) 402-0823; E-mail: sendero{at}helix.nih.gov
Received 8/12/03. Revised 10/14/03. Accepted 11/ 3/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Xiao, M. Eto, and M. G. Kazanietz ROCK Mediates Phorbol Ester-induced Apoptosis in Prostate Cancer Cells via p21Cip1 Up-regulation and JNK J. Biol. Chem., October 23, 2009; 284(43): 29365 - 29375. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kim and I. K. Lim Phosphorylated Extracellular Signal-regulated Protein Kinases 1 and 2 Phosphorylate Sp1 on Serine 59 and Regulate Cellular Senescence via Transcription of p21Sdi1/Cip1/Waf1 J. Biol. Chem., June 5, 2009; 284(23): 15475 - 15486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. YOSHIDA, Y. MATSUI, A. IIZUKA, and Y. IKARASHI G2-Phase Arrest Through p21(WAF1 / Cip1) Induction and cdc2 Repression by Gnidimacrin in Human Hepatoma HLE Cells Anticancer Res, April 1, 2009; 29(4): 1349 - 1354. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. GIRI, A. GOMES, R. SENGUPTA, S. BANERJEE, J. NAUTIYAL, F. H. SARKAR, and A. P.N. MAJUMDAR Curcumin Synergizes the Growth Inhibitory Properties of Indian Toad (Bufo melanostictus Schneider) Skin-derived Factor (BM-ANF1) in HCT-116 Colon Cancer Cells Anticancer Res, January 1, 2009; 29(1): 395 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Choi, C. G. Kim, Y.-S. Bae, Y. Lim, Y. H. Lee, and S. Y. Shin p21Waf1/Cip1 Expression by Curcumin in U-87MG Human Glioma Cells: Role of Early Growth Response-1 Expression Cancer Res., March 1, 2008; 68(5): 1369 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Papineni, S. Chintharlapalli, and S. Safe Methyl 2-Cyano-3,11-dioxo-18{beta}-olean-1,12-dien-30-oate Is a Peroxisome Proliferator-Activated Receptor-{gamma} Agonist That Induces Receptor-Independent Apoptosis in LNCaP Prostate Cancer Cells Mol. Pharmacol., February 1, 2008; 73(2): 553 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. O'Brien, T. J. Peterson, M. H. Tong, E.-J. Lee, L. E. Pfaff, S. C. Hewitt, K. S. Korach, J. Weiss, and J. L. Jameson Estrogen-induced Proliferation of Uterine Epithelial Cells Is Independent of Estrogen Receptor {alpha} Binding to Classical Estrogen Response Elements J. Biol. Chem., September 8, 2006; 281(36): 26683 - 26692. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Chao, C.-M. Chen, P.-L. Cheng, J.-W. Shih, A.-P. Tsou, and Y.-H. Wu Lee DDX3, a DEAD Box RNA Helicase with Tumor Growth-Suppressive Property and Transcriptional Regulation Activity of the p21waf1/cip1 Promoter, Is a Candidate Tumor Suppressor. Cancer Res., July 1, 2006; 66(13): 6579 - 6588. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. de la Pena, W. E. Burgan, D. J. Carter, M. G. Hollingshead, M. Satyamitra, K. Camphausen, and P. J. Tofilon Inhibition of Akt by the alkylphospholipid perifosine does not enhance the radiosensitivity of human glioma cells. Mol. Cancer Ther., June 1, 2006; 5(6): 1504 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nyakern, A. Cappellini, I. Mantovani, and A. M. Martelli Synergistic induction of apoptosis in human leukemia T cells by the Akt inhibitor perifosine and etoposide through activation of intrinsic and Fas-mediated extrinsic cell death pathways. Mol. Cancer Ther., June 1, 2006; 5(6): 1559 - 1570. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hideshima, L. Catley, H. Yasui, K. Ishitsuka, N. Raje, C. Mitsiades, K. Podar, N. C. Munshi, D. Chauhan, P. G. Richardson, et al. Perifosine, an oral bioactive novel alkylphospholipid, inhibits Akt and induces in vitro and in vivo cytotoxicity in human multiple myeloma cells Blood, May 15, 2006; 107(10): 4053 - 4062. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Bilsland, K. Stevenson, S. Atkinson, W. Kolch, and W. N. Keith Transcriptional Repression of Telomerase RNA Gene Expression by c-Jun-NH2-Kinase and Sp1/Sp3 Cancer Res., February 1, 2006; 66(3): 1363 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Momota, E. Nerio, and E. C. Holland Perifosine Inhibits Multiple Signaling Pathways in Glial Progenitors and Cooperates With Temozolomide to Arrest Cell Proliferation in Gliomas In vivo Cancer Res., August 15, 2005; 65(16): 7429 - 7435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-A. Lee, D.-C. Suh, J.-E. Kang, M.-H. Kim, H. Park, M.-N. Lee, J.-M. Kim, B.-N. Jeon, H.-E. Roh, M.-Y. Yu, et al. Transcriptional Activity of Sp1 Is Regulated by Molecular Interactions between the Zinc Finger DNA Binding Domain and the Inhibitory Domain with Corepressors, and This Interaction Is Modulated by MEK J. Biol. Chem., July 29, 2005; 280(30): 28061 - 28071. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qian, J. Niu, M. Li, P. J. Chiao, and M.-S. Tsao In vitro Modeling of Human Pancreatic Duct Epithelial Cell Transformation Defines Gene Expression Changes Induced by K-ras Oncogenic Activation in Pancreatic Carcinogenesis Cancer Res., June 15, 2005; 65(12): 5045 - 5053. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wuerzberger-Davis, P.-Y. Chang, C. Berchtold, and S. Miyamoto Enhanced G2-M Arrest by Nuclear Factor-{kappa}B-Dependent p21waf1/cip1 Induction Mol. Cancer Res., June 1, 2005; 3(6): 345 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Aguero, M. M. Facchinetti, Z. Sheleg, and A. M. Senderowicz Phenoxodiol, a Novel Isoflavone, Induces G1 Arrest by Specific Loss in Cyclin-Dependent Kinase 2 Activity by p53-Independent Induction of p21WAF1/CIP1 Cancer Res., April 15, 2005; 65(8): 3364 - 3373. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venkatasubbarao, A. Choudary, and J. W. Freeman Farnesyl Transferase Inhibitor (R115777)-Induced Inhibition of STAT3(Tyr705) Phosphorylation in Human Pancreatic Cancer Cell Lines Require Extracellular Signal-Regulated Kinases Cancer Res., April 1, 2005; 65(7): 2861 - 2871. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahmani, E. Reese, Y. Dai, C. Bauer, S. G. Payne, P. Dent, S. Spiegel, and S. Grant Coadministration of Histone Deacetylase Inhibitors and Perifosine Synergistically Induces Apoptosis in Human Leukemia Cells through Akt and ERK1/2 Inactivation and the Generation of Ceramide and Reactive Oxygen Species Cancer Res., March 15, 2005; 65(6): 2422 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Facchinetti, A. De Siervi, D. Toskos, and A. M. Senderowicz UCN-01-Induced Cell Cycle Arrest Requires the Transcriptional Induction of p21waf1/cip1 by Activation of Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase Kinase/Extracellular Signal-Regulated Kinase Pathway Cancer Res., May 15, 2004; 64(10): 3629 - 3637. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |