Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  Joint Metastasis Research Society-AACR Conference on Metastasis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Siervi, A.
Right arrow Articles by Senderowicz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Siervi, A.
Right arrow Articles by Senderowicz, A.
[Cancer Research 64, 743-750, January 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Transcriptional Activation of p21waf1/cip1 by Alkylphospholipids

Role of the Mitogen-Activated Protein Kinase Pathway in the Transactivation of the Human p21waf1/cip1 Promoter by Sp1

Adriana De Siervi1, Maria Marinissen1, Jessica Diggs1, Xiao-Fan Wang2, Gilles Pages3 and Adrian Senderowicz1

1 Molecular Therapeutics Unit, Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland;
2 Department of Pharmacology, Duke University Medical Center, Durham, North Carolina; and
3 Institute of Signalling, Developmental Biology and Cancer Research, Centre Antoine Lacassagne, Nice, France


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Alkylphospholipids (ALKs) are a novel class of antitumor agents with an unknown mechanism of action. The first ALK tested in the clinic, miltefosine, has been approved recently in Europe for the local treatment of patients with cutaneous metastasis. Perifosine, the only available oral ALK, is being studied currently in human cancer clinical trials. We have shown previously that perifosine induces p21waf1/cip1 in a p53-independent fashion and that induction of p21waf1/cip1 is required for the perifosine-induced cell cycle arrest because cell lines lacking p21waf1/cip1 are refractory to perifosine. In this report, we investigated the mechanism by which perifosine induces p21waf1/cip1 protein expression. We observed that perifosine induces the accumulation of p21waf1/cip1 mRNA without affecting p21waf1/cip1 mRNA stability. Using several p21waf1/cip1 promoter-driven luciferase reporter plasmids, we observed that perifosine activates the 2.4-kb full-length p21waf1/cip1 promoter as well as a p21 promoter construct lacking p53-binding sites, suggesting that perifosine activates the p21waf1/cip1 promoter independent of p53. The minimal p21 promoter region required for perifosine-induced p21 promoter activation contains four consensus Sp1-binding sites. Mutations in each particular Sp1 site block perifosine-induced p21waf1/cip1 expression. Moreover, we showed that perifosine activates the mitogen-activated protein/extracellular signal-regulated kinase pathway, and this activation promotes the phosphorylation of Sp1 in known mitogen-activated protein kinase residues (threonine 453 and 739), thereby leading to increased Sp1 binding and enhanced p21waf1/cip1 transcription. These results represent a novel mechanism by which alkylphospholipids modulate transcription, and may contribute to the discovery of new signal transduction pathways crucial for normal and neoplastic cell cycle control.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Alkylphospholipids (ALKs) belong to a novel class of antineoplastic compounds that display potent antiproliferative activity against several in vitro and in vivo human tumor models. ALKs include ET-18-OCH3 (eldefosine), hexadecylphosphocholine (miltefosine), and octadecylpipiridine (perifosine; Refs. 1 , 2 ). In addition to its striking curative effects in leishmaniasis (3) , miltefosine has been approved recently in Europe for the local treatment of patients with cutaneous metastasis (4) . Perifosine is an analogue of miltefosine with similar antiproliferative effects but with better oral tolerability in preclinical models (1 , 2) . On the basis of these unique features, several clinical trials with oral perifosine are being conducted worldwide (5 , 6) . Although ALKs have demonstrated antitumoral effects in in vitro and in vivo models (1 , 2 , 7 , 8) , the exact mechanism of action remains elusive (2 , 9 , 10) .

Cell cycle progression is controlled by the cyclic activation of a family of serine-threonine kinases, the cyclin-dependent kinases (cdks; Refs. 11, 12, 13 ). Regulation of cdk activity occurs mainly through the complex with cyclin cofactors and through the stoichiometric binding of endogenous cdk inhibitors to the cdk/cyclin complex (11, 12, 13) . The cdk inhibitor p21waf1/cip1 is the prototype of an endogenous cdk inhibitor. This general cdk inhibitor is a downstream effector of the tumor suppressor gene p53 (14, 15, 16, 17) . Several important physiologic functions are ascribed to p21waf1/cip1, including cell cycle arrest, differentiation, DNA repair, apoptosis, and senescence, among other functions (18, 19, 20) . The regulation of p21waf1/cip1 occurs primarily at the transcriptional and post-transcriptional levels (21, 22, 23, 24) . The tumor suppressor gene p53 is the bona fide transcriptional activator of p21waf1/cip1 because this promoter displays p53 binding site in its sequence (15) . However, p21waf1/cip1 can also be transcriptionally regulated by p53-independent mechanisms (18 , 23, 24, 25, 26) .

Initial efforts in our laboratory demonstrated that ALKs (particularly perifosine) promote cell cycle arrest at the G1-S and G2/M by up-regulation of p21waf1/cip1 protein levels, independent of p53 function (9) . Increased levels of p21waf1/cip1 induced by perifosine are associated with cdks, thereby inhibiting cdk activity. The cell cycle arrest induced by perifosine requires p21waf1/cip1 because HCT 116 cell lines lacking p21 (HCT 116 p21-/-) are refractory to perifosine. Thus, the induction of p21waf1/cip1 by ALKs is p53 independent and is required for the cell cycle effects of ALKs (9) .

In this study, we investigated the mechanism by which ALKs induce p21waf1/cip1 protein accumulation. We showed that the induction of p21waf1/cip1 by ALKs is due to a p53-independent transcriptional activation of the p21waf1/cip1 promoter. We also showed that the minimal promoter region required by perifosine is similar to the minimal region required by Ras to induce p21waf1/cip1. Furthermore, we demonstrated that perifosine activates the mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK mitogen-activated protein kinase (MAPK) pathways, and this activation leads to increased Sp1 phosphorylation, leading to enhanced Sp1 DNA-binding activity. Altogether, our results illustrate a novel mechanistic aspect by which ALKs regulate p21waf1/cip1 transcription.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Exponentially growing HaCaT human keratinocyte cells were grown in DMEM containing 10% fetal bovine serum (Invitrogen, Carlsbad, CA) in a 5% CO2 humidified atmosphere at 37°C as shown previously (9) .

Reagents.
Zentaris (Frankfurt, Germany) provided perifosine and other ALKs (miltefosine and edelfosine). For in vitro studies, perifosine was reconstituted as a 100 mM stock solution in PBS. PD98059 (Calbiochem, Darmstadt, Germany) and actinomycin D (Sigma Chemical Co., St. Louis, MO) were diluted in DMSO, stock concentrations of 25 µM and 5 µg/ml, respectively. PP2A was obtained from Upstate Cell Signaling (Lake Placid, NY).

Immunoblot Analysis.
To study the role of MEK/ERK pathways, HaCaT cells were cultured under serum deprivation conditions for 16 h and exposed to increasing concentrations of perifosine for 30 min, or to 10 µM of perifosine for increasing time periods. Cell lysates were obtained as described previously (9 , 27) . Briefly, 25 µg of protein were electrophoretically resolved in 4–20% Tris Glycine SDS-PAGE gel (Invitrogen) and transferred to a polyvinylidene difluoride membrane, Immobilon-P (Millipore, Bedford, MA). The primary antibodies used were p21waf1/cip1 (clone 6B6; BD Transduction Laboratories, San Diego, CA), actin (Chemicon International, Temecula, CA), laminin C (c-20), pERK (E-4), ERK-2 (c-14), HSP90 (H114), and Sp1 (PEP 2; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Reactions were detected by horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence (ECL) following the manufacturer’s instructions. For PP2 treatments, nuclear extracts were incubated with 0.6 units of PP2A for 30 min at 30°C. The reaction was stopped by the addition of 50 mM NaF and 5 mM potassium PPI, and run on an SDS gel as described above.

ERK 1/2 in Vitro Kinase Assays.
Exponentially growing HaCaT cells were serum starved for 16 h and exposed to vehicle (PBS) or to increasing concentrations of perifosine for 30 min. After treatment, cells were lysed as described previously (28) . Briefly, 200 µg of total cellular lysate was immunoprecipitated with ERK-2 antibody (Santa Cruz Biotechnology, Inc.) for 1 h at 4°C. Then, Gammabind G Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) was used to capture the immune complexes. After three washes, kinase reactions were performed in kinase assay buffer [12.5 mM 4-morpholinepropanesulfonic acid (pH 7.5), 12.5 mM ß-glycerophosphate, 7.5 mM MgCl2, 0.5 mM EGTA (pH 8.0), 0.5 mM NaF, and 0.5 mM NaV4] containing {gamma}-[32P]ATP (3000 Ci/mmol; NEN, Boston, MA), 20 µM cold ATP, and 50 µg of myelin basic protein as substrate. Reactions were incubated at 37°C for 30 min and terminated by the addition of SDS-gel loading buffer. The resolved and dried gels were subjected to autoradiography and quantified by PhosphorImager (Molecular Dynamics).

Northern Blot Analysis.
Total RNA was extracted using TRIZOL (Invitrogen) following the manufacturer’s recommendations. Twenty-five µg of total RNA were separated on 1% formaldehyde-agarose gels and transferred to nylon membranes (Hybond-XL; Amersham Pharmacia Biotech) by capillary action. A p21waf1/cip1 probe was generated by digestion of pCMV p21waf1/cip1 (obtained from Michele Pagano, New York University, New York, NY) with XbaI and HindIII, and then gel purified using a GeneClean spin kit (Qbiogene, Inc., Carlsbad, CA). Glyceraldehyde-3-phosphate dehydrogenase was obtained from Ambion, Inc. (Austin, TX). Probes were labeled with [{alpha}32P]D-ATP by random priming using StripEZ DNA kit (Ambion, Inc.). Northern blot hybridization to 32P-labeled probes was performed using Hybrisol I solution (Intergen Company, Purchase, NY) following the manufacturer’s instructions. Signals were detected by exposure to BioMax MR film (Kodak, Rochester, NY), and quantitation of signals was performed by densitometry.

Real-Time Quantitative PCR.
HaCaT cells were plated and grown overnight to ~70% confluence and treated with increasing concentrations of perifosine (1, 3, 5, and 10 µM) for 12 h or with 10 µM perifosine for several time periods (1, 3, 6, 9, and 12 h). Total RNA was extracted using TRIzol (Invitrogen) following the manufacturer’s recommendations. Two µg of RNA were incubated in a final volume of 20 µl containing 2 µl of real-time buffer (10x), 2 µl of deoxynucleoside triphosphate mix (5 mM), 2 µl of oligodeoxythymidylic acid primer (10 µM) and 1 µl of real-time Omniscript enzyme (Qiagen, Valencia, CA). After 1 h at 37°C, quantitative PCR was performed with 1 µl of cDNA, 1 µl of primer mix (10 µM), and 12.5 µl of SYBR Green (Quantitect SYBR Green PCR kit; Qiagen) in a final volume of 25 µl. The primers used were 5'CTG GAG ACT CTC AGG GTC GAA3' and 5'GAA TTA GGG CTT CCT CTT GGA 3' for p21waf1/cip1, and 5' GAA GGT GAA GGT CGG ACT C 3' and 5' GAA GAT GGT GAT GGG ATT TC 3' for glyceraldehyde-3-phosphate dehydrogenase. Quantitative PCR was performed in an ABI Prism 7700 Sequence Detector cycler (Perkin-Elmer Applied Biosystems, Foster City, CA) as follows, 94°C for 5 min, then 40 cycles at 95°C for 30 s and at 60°C for 30 s. To determine whether the accumulation of p21waf1/cip1 induction by perifosine is due to post-transcriptional control (i.e., increase in p21waf1/cip1 mRNA half-life), HaCaT cells were treated for 12 h with 10 µM of perifosine, washed with PBS, and exposed to actinomycin D (1 µg/ml) or actinomycin D and perifosine for increasing time periods (0.5, 1, 2, 4, 6, or 8 h). Cells were harvested, RNA was isolated using TRIzol, and real-time and quantitative PCR were performed as described above.

Luciferase Promoter Analysis.
HaCaT cells were transfected with different expression plasmids using Fugene (Roche, Indianapolis, IN) according to the manufacturer’s protocol, 1 µg of each of the reporter plasmids, and 0.01 µg of pRL-null (a plasmid expressing the enzyme Renilla luciferase from Renilla reniformis) as an internal control, adjusting the total amount of plasmid DNA with empty vector (pcDNAIII-ß gal, a plasmid expressing the enzyme ß-galactosidase). Twelve h after transfection, cells were exposed to 10 µM perifosine for 18 h. Firefly and Renilla luciferase activities present in cellular lysates were assayed using the Dual-Luciferase Reporter System (Promega, Madison, WI), and light emission was quantitated using the MLX Microtiter plate luminometer as specified by the manufacturer (Dynex Technologies, Chantilly, VA). Luciferase activities were normalized based on total protein concentrations and Renilla luciferase activity. All of the p21waf1/cip1 promoter constructs used herein were reported previously (26) . Briefly, p21PSma{Delta}1-luc was created by the digestion of the 2.4-kb full-length promoter (p21P-luc) with SmaI and religation. p21Psma-luc (minimal promoter region for Ras activity) was created by cloning the 50-bp SmaI fragment of the p21waf1/cip1 promoter into pGL-2 basic (26) . Mutagenesis of p21P93-S-luc was performed to generate p21P93-Smut#2 to 5 and p21P93-Smut#2.2. Sp1–1 site was mutated from the wild-type CCCGCCTCCT to TATCTAGAAC (p21P 93-S mut#2-luc); Sp1–2 was mutated from TGAGGCGGGC to CTCTAGAAAT (p21P 93-S mut#3-luc); Sp1–3 was mutated from CCGGGCGGGG to ATCTAGACAT (p21P 93-S mut#4-luc); and Sp1–4 was mutated from CGGTTGTATAT to TCTAGACCGT (p21P 93-S mut#5-luc; Ref. 26 ). Plasmids encoding vectors for the activating mutant for Ras (Ras V12) and dominant-negative MEK (MEKAA) were provided by Silvio Gutkind (NIH, Bethesda, MD) and have been described previously (28) .

Electrophoretic Mobility Shift Assays.
Oligonucleotides corresponding to the wild-type consensus Sp1 site (5'ATT CGA TCG GGG CGG GGC GAG C3') were obtained from Promega, or an oligonucleotide corresponding with the mutant Sp1 sequence in the p21waf1/cip1 promoter (p21P 93-S mut#2.2, CCC GCC TCA AGG ATC CGG GAC CCG C) was end-labeled with [{gamma}32P]ATP using T4 polynucleotide kinase (Invitrogen). The resulting end-labeled oligo was purified using a G25 column (Amersham Pharmacia Biotech). Approximately 10,000 cpm of labeled probe was used in each gel shift analysis reaction. To prepare nuclear extracts, HaCaT cells were plated in 150-mm plates and grown to 70% confluency. Cells were then incubated with vehicle (PBS) or 10 µM perifosine for 12 h. As a positive control, HaCaT cells were transfected with 500 ng of activated Ras (Ras V12). Cells were washed in cold PBS and lysed in 400 µl of lysis buffer [0.1 mM HEPES (pH 7.9) 1 mM KCl, 0.02 µM EDTA, 0.04 µM EGTA, 1 mM DTT, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride]. After 15 min, 25 µl of 10% of NP40 was added and vigorously vortexed for 10 s. After centrifugation (13,000 x g), nuclear pellets were resuspend in 50 µl of ice-cold hypotonic lysis buffer [20 mM HEPES (pH 7.9), 0.42 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride]. Six µg of nuclear protein extract were incubated at 4°C with 1 µg of poly(deoxyinosinic-deoxycytidylic acid) in 10 µl of buffer reaction [24 mM HEPES (pH 7.8), 120 mM KCl, 4 mM MgCl2, 0.24 mM EDTA, 0.6 mM DTT, 0.6 mM phenylmethylsulfonyl fluoride, and 24% glycerol] and 0.1 µg of salmon sperm DNA for 15 min. Wild-type or mutant probes were then added, and after 20 min of incubation at room temperature, the reaction was stopped with loading buffer and resolved on a 5% acrylamide gel at 100 V for 4 h at 4°C. Gels were subsequently dried and exposed to autoradiograph film. For Sp1 supershift assays, 0.4 µg of Sp1 (PEP-2)-specific antibody (Santa Cruz Biotechnology, Inc.) was added to the binding reaction before the addition of radiolabeled probe for 15 min.

Immunofluorescence Studies.
HaCaT cells were seeded on glass coverslips and serum starved for 16 h. HaCaT cells were exposed to vehicle alone or to 10 µM perifosine for 1 h. Also, HaCaT cells were preincubated with 50 µM PD98059 for 15 min before perifosine exposure (for a total of 75 min). Cells were washed twice with 1x PBS, fixed, and permeabilized with 4% formaldehyde and 0.5% Triton X-100 in 1x PBS for 10 min. After washing with PBS, cells were blocked with 1% BSA and incubated with the indicated primary antibodies for 1 h, rabbit polyclonal anti-phospho-Thr453 (1:120), rabbit polyclonal anti-phospho-Thr739 (1:120; Ref. 29 ), or Sp1 (PEP-2; 1:100; Santa Cruz Biotechnology). After an incubation period of 1 h, cells were washed three times with 1x PBS, then incubated additionally for 1 h with the corresponding secondary antibodies (Cy-3-conjugated donkey antirabbit; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA; 1:500). Coverslips were washed three times, mounted in Vectashield mounting medium with 4',6-diamidino-2-phenylindole (Vector Laboratories, Inc., Burlingame, CA), and viewed using a Leica TCS-SP2 confocal system (Heidelberg, Germany).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Perifosine Increases p21waf1/cip1 mRNA and Protein Levels in HaCaT Cells.
We demonstrated previously that perifosine promotes cell cycle arrest by inducing p21waf1/cip1 protein in a p53-independent fashion (9) . To further study the mechanism by which perifosine induces p21waf1/cip1 accumulation, we used HaCaT cell lines, an immortalized human keratinocyte cell line with deficient p53 function, as a model (30) . Initial dose response analysis performed in HaCaT cells demonstrated that maximal activation of p21waf1/cip1 protein was reached after a 12-h treatment with 10 µM perifosine (Fig. 1A)Citation . Time response analysis in the same cell line showed that 10 µM perifosine promotes a significant accumulation of p21waf1/cip1 protein after 6 h of treatment (Fig. 1B)Citation . To determine whether perifosine-induced accumulation of p21waf1/cip1 protein occurred at the mRNA level, we performed Northern blot analyses in parallel samples. As shown in Fig. 1CCitation , p21waf1/cip1 mRNA was induced significantly by perifosine at concentrations >=3 µM at 6 h of treatment, reaching ~2.5-fold induction with 10 µM at 12 h of exposure, suggesting that perifosine accumulates p21waf1/cip1 protein by increasing p21waf1/cip1 mRNA levels. To determine whether perifosine-induced accumulation of p21waf1/cip1 was due to post-transcriptional control, we conducted pulse-chase analyses in the presence of actinomycin D and measured p21 mRNA by reverse transcription-PCR. We observed that p21 mRNA expression decreased to a similar extent in both vehicle and perifosine up to 8 h after actinomycin D exposure (17% ±2 and by 12% ±1, respectively). These experiments demonstrated that the p21waf1/cip1 induction by perifosine cannot be explained by p21 mRNA stabilization, suggesting that the accumulation of p21waf1/cip1 mRNA by perifosine is mainly due to transcriptional effects.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Perifosine induces p21waf1/cip1 mRNA and protein in HaCaT cells in a time- and dose-dependent manner. A, dose-response analysis of p21waf1/cip1 protein induction in HaCaT cells. B, time course of p21waf1/cip1 protein in HaCaT cells. Exponentially growing HaCaT cells were exposed to increasing concentrations of perifosine for 12 h (A) or with 10 µM perifosine for increasing time periods (B). Western blot analysis is described in "Materials and Methods." Equal loading was demonstrated by immunoblots against actin. C, dose-response and time course analysis of perifosine-induced p21waf1/cip1 mRNA expression in HaCaT cells. HaCaT cells were exposed to the concentrations and times described, and total RNA was prepared and subjected to Northern blotting using probes against p21waf1/cip1. Equal loading of total RNA was demonstrated by glyceraldehyde-3-phosphate dehydrogenase hybridization. Representative experiment for p21waf1/cip1:glyceraldehyde-3-phosphate dehydrogenase ratios from at least three independent experiments are shown (bottom panel). Quantitation was performed by phosphorimaging. Per, perifosine.

 
Perifosine Activates the p21waf1/cip1 Promoter by a p53-Independent Mechanism.
To investigate whether the increase in p21waf1/cip1 mRNA by perifosine is due to transcriptional activation of the p21waf1/cip1 promoter, we transiently transfected HaCaT cells with wild-type and several p21waf1/cip1 promoter-driven luciferase mutant reporter plasmids (26 , 31) . Twelve h after transfection, HaCaT cells were exposed to perifosine for 18 h, and luciferase activity was measured as described in "Materials and Methods" (26) . As shown in Fig. 2Citation , perifosine significantly enhanced the transcriptional activity of the full-length (2.4 kb) p21 promoter (p21P-luc) by 6-fold; similar activation (~10-fold) was observed when cotransfected Ras V12 (the activated form of Ras) was used as a positive control (26) . To investigate whether the transcriptional activation of p21waf1/cip1 by perifosine is related to p53 function, we transfected the p53-mutant HaCaT cell lines with the p21P{Delta}p53-luc reporter, a p21waf1/cip1 reporter construct lacking 250 bp from the 5' end corresponding to a p53 consensus DNA-binding site. Perifosine activates this construct (~9-fold) despite the lack of the p53 consensus site, indicating that neither the presence of p53 binding sites in the p21waf1/cip1 promoter nor the presence of p53 protein was required for perifosine to activate the p21waf1/cip1 promoter.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Stimulation of the p21waf1/cip1 promoter by perifosine is independent of p53 activity, and the minimal promoter region is similar to the one activated by Ras V12. HaCaT cells were transfected with the full-length (p21P-luc) and deletion p21 promoter reporter constructs (p21{Delta}p53-luc, p21PSma-luc, and p21PSma{Delta}1-luc), exposed to 10 µM perifosine for 18 h, then harvested and assayed for luciferase activity. As a positive control, cells were cotransfected with expression vector for the activated forms of Ras (Ras V12), as indicated. Histograms represent luciferase activity in each sample, normalized for the corresponding efficiency of transfection and protein expression, and they are the average of triplicate samples from a typical experiment; bars, ±SE. {square}, vehicle treatment; , Ras; {blacksquare}, perifosine; Luc, luciferase; p53, p53 DNA binding site; Sp1, Sp1 DNA consensus sites.

 
Sp1 Sites in the Minimal p21 Promoter Are Required for Perifosine Effects.
To determine the minimal promoter region required for the transcriptional activation of p21waf1/cip1 by perifosine, additional promoter deletion constructs were tested. We initially used the p21PSma-luc construct (26 , 31) , which contains the p21waf1/cip1 promoter sequence from base -111 through the transcriptional initiation site. Of note, this construct contains four consensus Sp1-binding sites, and this is the minimal promoter region activated by Ras (26) . Sp1 is a member of a multigene family that binds DNA through COOH-terminal zinc-finger motifs and is important for the transcription of multiple cell cycle genes, including p21waf/cip1 (32 , 33) . As shown in Fig. 2Citation , perifosine significantly activated this minimal promoter (~20-fold), similar to Ras V12. Moreover, when HaCaT cells were transfected with full-length p21waf1/cip1 construct lacking the Ras minimal promoter region (p21PSma{Delta}1-luc), the induction was lost for both Ras V12 and perifosine. Of note, induction of p21SMA-luc was also observed when edelfosine and miltefosine were used as controls (data not shown). Thus, the minimal p21waf1/cip1 promoter region for ALKs is similar to that of Ras and seems to be represented by a region in the p21waf1/cip1 promoter proximal to the SmaI site at -111 (p21PSma-luc).

To additionally define the cis-acting elements in the p21waf1/cip1 minimal promoter required for perifosine induction, we tested a series of mutant Sp1 constructs (p21 93-S-luc) as described in "Materials and Methods." The "wild-type" p21P93-S-luc reporter plasmid contains the promoter sequence between -93 and -34, and spans four Sp1-binding sites: Sp1 site 1 (-84 to -79) and Sp1 site 2 (-70 to -65) are independent binding sites, whereas Sp1 site 3 (-60 to -55) and Sp1 site 4 (-55 to -51) have overlapping features (see Fig. 3Citation ). To determine which of these Sp1 elements mediate perifosine effects, five P21 93-S mutant "scrambled" constructs were initially used (see Fig. 3Citation ; Refs. 26 , 31 ). When p21P93-S-luc (wild-type) was transfected, perifosine induced a 7-fold increase in luciferase activity, similar to Ras V12 (5-fold). Mutation of Sp1-binding sites 2, 3, or 4 (constructs p21P 93-S mut#3, mut#4, and mut#5) led to a significant decrease in luciferase activity (~2-fold induction for both perifosine and Ras V12, respectively). Moreover, when the Sp1-binding site (site 1) was scrambled (p21P 93-S mut#2) or mutated by the addition of 2-bp mutations CCGCCTCAAGGATCCGGGACCCGC) in this site (p21P 93-S mut#2.2), the blocking effect of these mutants was even more evident. Taken together, these results indicate that all of the Sp1 sites in this region are required for perifosine induction of the p21waf1/cip1 promoter.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Sp1 DNA-binding sites in the p21waf1/cip1 promoter are required for the activation by perifosine. HaCaT cells were transfected with the minimal promoter region (p21P93-S-luc) and deletion/mutant p21waf1/cip1minimal promoter constructs (p21P93-SM2-luc, p21P93-SM2.2-luc, p21P93-SM3-luc, p21P93-SM4-luc, p21P93-SM5-luc, see "Materials and Methods"), exposed to 10 µM perifosine for 18 h, then harvested and assayed for luciferase activity. As a positive control, cells were cotransfected with expression vector for the activated forms of Ras (Ras V12), as indicated. Histograms represent firefly luciferase activity in each sample, normalized for the corresponding efficiency of transfection and protein expression, and expressed as fold induction relative to controls for each reporter, of which the values were taken as 1. All of the values are the average of triplicate samples from a typical experiment; bars, ±SE. In each case, similar results were obtained in three additional experiments. {bullet}, scrambled Sp1 site; {circ}, point mutation in site #2. {square}, vehicle treatment; , Ras; {blacksquare}, perifosine; Luc, luciferase; Sp1, Sp1 DNA consensus sites.

 
Transactivation of the p21waf1/cip1 Promoter and the Increase in p21waf1/cip1 Protein Requires Activation of MAPK by Perifosine.
Ras is known to modulate transcriptional events by activating the MAPK kinase kinase, Raf (34, 35, 36, 37) . In turn, Raf activates MEK and activated MEK phosphorylates, and activates ERK1 and ERK2, leading to the phosphorylation and activation of several transcriptional factors (34, 35, 36, 37, 38) . On the basis of the similar effect of Ras and perifosine on the p21waf1/cip1 promoter, we tested whether perifosine was able to activate the ERK1/2 signaling pathway. We exposed serum-starved HaCaT cells to increasing concentrations of perifosine for 30 min or for increasing time periods followed by in vitro kinase reactions/immunoblots with phosphospecific antibodies. Perifosine, at concentrations as low as 3 µM, significantly activated ERK activity as measured by in vitro kinase assays (Fig. 4A)Citation . Similar results were obtained when protein lysates were immunoblotted with a phosphospecific ERK antibody (Fig. 4A)Citation . Time course analysis revealed a very early activation of the ERK pathway by perifosine (Fig. 4B)Citation . Thus, ERK activation occurred at concentrations similar to those required for p21 promoter up-regulation. Moreover, as shown in Fig. 4BCitation , the activation of MAPK temporally preceded the increase in p21 mRNA (3–6 h; Fig. 1, C and DCitation ), suggesting that the activation of this kinase could be a preliminary event in the perifosine-induced p21 promoter activation.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. Activation of p21waf1/cip1 promoter and p21waf1/cip1 protein expression induced by perifosine is dependent on the activation of mitogen-activated protein kinase (MAPK) pathway. Activation of MAPK activity by perifosine in HaCaT cells. A, endogenous extracellular signal-regulated kinase (ERK) 1/ERK2 activity was analyzed by in vitro kinase assay ("kinase") or using specific anti-phospho MAPK antibodies, as indicated (B). Serum-starved HaCaT cells were exposed to increasing concentrations of perifosine for 30 min (A) and/or with 10 µM perifosine for increasing time periods (B). Equal expression of ERK1/ERK2 in the different samples was also confirmed. C, stimulation of p21waf1/cip1 promoter transcriptional activity in HaCaT cells transfected with the p21waf1/cip1 promoter reporter plasmid (pSma-Luc) and treated with perifosine (Lanes 2–4), with PD98059 (Lane 9), or pretreated with PD98059 (50 µM) 20 min before perifosine exposure (Lane 4). Moreover, HaCaT cells were cotransfected with an expression vector for the dominant-negative forms of mitogen-activated protein/ ERK kinase (MEKAA), as indicated. As a positive control, cells were cotransfected with expression vector for the activated forms of Ras (Ras V12). Histograms represent firefly luciferase activity in each sample, normalized for the corresponding efficiency of transfection and protein expression, and expressed as fold induction relative to controls for each reporter, of which the values were taken as 1. All values are the average of triplicate samples from a typical experiment; bars, ±SE. In each case, similar results were obtained in three additional experiments. Luc, luciferase; MBP, myelin basic protein; S, serum stimulation, -Ab, no antibody. D, induction of p21 protein expression is blunted by MEK ablation. Serum-starved HaCaT cells were exposed to perifosine in the presence (or absence of) PD98059 and protein lysates were obtained for Western blots against the indicated antibodies. Equal loading expression in the different samples was confirmed by Western blots against HSP90.

 
To study the specificity of and requirement for the activation of MAPK in p21waf1 up-regulation by perifosine, we used two different, widely known approaches. First, we used a commercial chemical inhibitor of MEK, the PD98059 compound; second, we used a dominant-negative mutant of MEK, MEKAA. Cells transfected with an expression vector for MEKAA or those preincubated with PD98059 showed a significant loss in the transactivation of the p21waf1/cip1 promoter by perifosine, indicating that the MEK/ERK pathway is required for perifosine-induced effects on p21waf1/cip1 promoter activation (Fig. 4C)Citation . To determine whether MEK/ERK activation is also important for the accumulation of p21waf1/cip1 protein by perifosine, serum-starved HaCaT cells were exposed to perifosine in the absence or presence of PD98059. As shown in Fig. 4DCitation , preincubation with the MEK chemical inhibitor significantly decreased p21waf1/cip1 up-regulation by perifosine. Thus, the activation of MAPK pathway induced by perifosine is required for the induction of p21waf1.

Perifosine Enhances Sp1 DNA-Binding Activity Due to Increased Sp1 Phosphorylation.
To determine whether perifosine affects the DNA-binding activity of Sp1, we performed electrophoretic mobility shift analyses by incubating nuclear extracts from cells exposed to perifosine with a radiolabeled Sp1 response element containing oligonucleotide. As shown in Fig. 5Citation , we were able to detect several protein-DNA binding complexes, which were undetected when a mutant Sp1 oligonucleotide was used in the binding reaction, indicating that these complexes contained specific proteins binding to the Sp1 consensus site. Supershift assays using specific Sp1 antibody confirmed that the slowest migrating complex represents Sp1 (Fig. 5Citation , Lane 2). Of note, this band was not visualized when an irrelevant IgG was used (data not shown). Moreover, treatment with perifosine or overexpression of Ras V12 increased the specific DNA-binding activity of Sp1, as demonstrated by the supershift of the Sp1 complexes (compare Lanes 2, 4, and 6 in Fig. 5ACitation ). Of note, several bands in both perifosine- and Ras-treated cells remained unaltered when incubated with specific Sp1 antibodies. Moreover, they were not present when nuclear extracts were incubated with mutant Sp1 oligonucleotides. These bands, as previously reported elsewhere in the case of Ras, represent increased binding to Sp3, a transcriptional factor that binds to DNA using the same DNA-binding consensus sequence as Sp1 (26) . Taken together, these results suggest that perifosine, similar to Ras, activates p21waf1/cip1 transcription by increasing the binding of the Sp1 transcription factor to the minimal promoter region of the p21waf1/cip1 promoter.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 5. Perifosine promotes increased Sp1 DNA binding by increased Sp1 phosphorylation. A, nuclear extracts prepared from perifosine-treated (Lanes 3, 4, and 8), transfected with Ras (Lanes 4, 5, and 9) or untreated HaCaT cells (Lanes 1, 2, and 8) were incubated with an end-labeled Sp1-binding sequence oligonucleotides wild-type or mutant probes as described in "Materials and Methods." In Lanes 2, 4, and 6, nuclear extracts were preincubated with Sp1 antibody and supershift bands were observed. B, nuclear extracts prepared from untreated HaCaT cells (Lanes 1 and 4), treated with perifosine (Lanes 3 and 6), and with an expression vector for the activated forms of Ras (Ras V12; Lanes 2 and 5) were incubated with an end-labeled Sp1-binding sequence oligonucleotides wild-type. In Lanes 4 through 6, phosphatase treatment (PP2A) of nuclear extracts occurred before incubation with end-labeled Sp1 oligonucleotide. Retention signals due to binding of Sp1 and Sp3 signals are indicated.

 
To additionally investigate whether perifosine-induced Sp1 DNA-binding activity was due to Sp1 phosphorylation, we incubated the nuclear extract with the serine-threonine phosphatase PP2A before the binding reaction. As observed in Fig. 5BCitation , the increased Sp1 DNA-binding activity provoked by perifosine was blunted in the samples treated with PP2A. These data suggest that perifosine activates p21waf1/cip1 transcription by increasing Sp1 phosphorylation and consequent Sp1 DNA-binding activity.

Perifosine-Induced Sp1 DNA Activity Requires the Phosphorylation of Sp1 by MEK/ERK Pathway.
Previous studies using Ras and/or activators of the MEK/ERK pathway have demonstrated that phosphorylation of Sp1 increased its transactivation capacity (39 , 40) . A recent study demonstrated that Ras induces the phosphorylation of Sp1 at two specific sites, threonine 453 and 739, and this phosphorylation increases Sp1 transcriptional activity (29) . To determine whether perifosine can promote the phosphorylation of Sp1 in these MAPK-specific sites, nuclear extracts obtained from HaCaT cells exposed to perifosine were immunoblotted with Sp1 phosphospecific antibodies. As clearly shown in Fig. 6ACitation , increased Sp1 phosphorylation at residue threonine 453 (a known MAPK site) was observed within 60 min of perifosine incubation. Moreover, preincubation of perifosine-treated cells with PD98059 (a known MEK inhibitor) demonstrated loss in Sp1 phosphorylation, suggesting that the increased phosphorylation induced by perifosine in this particular site is due to MEK activation. As a loading control, we used laminin C, an intermediate filament protein localized in the nucleus (41) .



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 6. MAPK activation by perifosine is required for Sp1 phosphorylation and increased Sp1 DNA binding to the p21waf1/cip1 promoter. A, Western blotting from serum-starved HaCaT cells untreated (Lane 1) or treated with perifosine (Lanes 2, 3, and 5), treated with 50 µM PD98059 (Lane 4), pretreated with 50 µM PD98059 20 min before perifosine (Lane 3), or lysates treated with PP2A (Lanes 5 and 6) were performed using specific anti-phospho Sp1 threonine 453 site (P-453) and total Sp1. Equal loading expression in the different samples was confirmed by Western blots against laminin C. B, immunofluorescence studies of untreated HaCaT cells (left panel) or HaCaT cells treated with perifosine. Sp1 threonine 453 site (P-453), anti specific anti-phospho Sp1 threonine 739 site (P-739) and total Sp1 were used as described in Methods. C, Nuclear extracts prepared from untreated HaCaT cells (Lane 1), treated with perifosine (10 µM, 12 h; Lanes 3, 5, and 7), treated with 50 µM PD98059 (Lane 4), pretreated with 50 µM PD98059 30 min before perifosine exposure (Lane 5), and transfected with an expression vector for the dominant-negative forms of MEK (MEKAA; Lanes 6 and 7) were incubated with an end-labeled Sp1-binding sequence oligonucleotides wild-type.

 
To determine whether the other known MAPK site, Sp1 threonine 739, was phosphorylated by perifosine, HaCaT cells were exposed to perifosine, and Sp1 phosphorylation was monitored by immunofluorescence with phosphospecific Sp1 antibodies. Again, a specific increase in Sp1 phosphorylation was evident in threonine 739 (Fig. 6BCitation , left panels) with perifosine treatment. Similar effects were observed with antibodies against Sp1-T453 (Fig. 6A)Citation . In contrast, total Sp1 levels were not significantly changed with perifosine treatment as evaluated by immunofluorescence (Fig. 6BCitation , right panels). As a positive control, cells were transfected with an expression vector for Ras V12. Increased phosphorylation at both sites was observed, as has been reported previously (data not shown; Ref. 29 ). Preincubation of HaCaT cells with PD98059 followed by perifosine treatment revealed a decrease in Sp1 phosphorylation at both sites (data not shown), indicating that the Sp1 phosphorylation induced by perifosine was dependent on ERK activation.

We then examined whether the increased Sp1 DNA-binding activity by perifosine is mediated by the MEK/ERK pathway. To this end, nuclear extracts obtained from HaCaT cells exposed to perifosine in the presence of MEK blockers (PD98059 or MEKAA) were used in the binding reactions. As demonstrated in Fig. 6CCitation , the increase in Sp1 binding activity induced by perifosine was blunted by the presence of either PD98059 or MEKAA, indicating that the increased Sp1 DNA-binding activity promoted by perifosine occurs as a result of activation of MEK/ERK leading to Sp1 phosphorylation.

In summary, the ALK perifosine promotes cell cycle arrest as a result of transcriptional activation of p21waf1/cip1. This effect occurs because of activation of the MEK/ERK pathway, and this enhanced activity promotes the specific phosphorylation of Sp1 protein, thereby increasing Sp1 DNA binding to the p21waf1/cip1 promoter.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We demonstrated that ALKs, a novel class of small-molecule cell cycle modulators, promote cell cycle arrest by transcriptional activation of p21waf1/cip1. Detailed studies of the p21waf1/cip1 promoter revealed that the minimal promoter region required by ALKs is similar to the region modulated by Ras. Furthermore, the activation of the minimal promoter region requires MAPK activation, which, in turn, phosphorylates the transcription factor Sp1, thereby promoting increased Sp1 DNA-binding activity to the p21waf1/cip1 promoter.

Initial efforts from our laboratory demonstrated that ALKs promote G1 and G2/M arrest in tumor cell lines because of up-regulation of p21waf1/cip1 (9) . The endogenous cdk inhibitor p21waf1/cip1 is a known universal cdk inhibitor of which the induction may lead to several phenotypes, including cell cycle arrest, cellular senescence, apoptosis, and differentiation (14 , 15 , 16 , 42, 43, 44, 45, 46, 47, 48, 49, 50) . Perifosine induced accumulation of p21 protein at the transcriptional level by an increase in mRNA message, not by an increase in p21 mRNA stability. Studies using full-length and deletion mutant p21waf1/cip1 luciferase reporters demonstrated a significant activation of the full-length 2.4-kb (p21P-luc) and the construct lacking p53-binding sites, suggesting that the transcriptional activation of p21waf1/cip1 by ALKs was independent of p53 function. Suprisingly, the minimal p21promoter region is the same minimal region (pSMA-luc) required by the proto-oncogene Ras to induce p21waf1/cip1 promoter (26 , 31) . To test whether the p21waf1/cip1 transcriptional activation by perifosine occurred in other cell types, we transfected pSMA-luc into HCT116 isogenic cell lines (wild-type or p53 null cells). Again, perifosine activated pSMA-luc in both cell lines (data not shown), demonstrating that the induction of the p21 minimal promoter by perifosine occurred in other cell types and was also independent of p53 function. Interestingly, the induction of pSMA-luc by Ras or perifosine appeared to be higher than the full-length construct (p21P-luc). This higher activation could be explained by the presence of a distal negative regulatory region in the p21 promoter for both Ras and ALKs. We are currently studying the cause of this event.

The pSma-luc construct contains several Sp1-binding sites that play a major role in the transcriptional regulation of p21waf1/cip1 by Ras (26 , 31) . Mutational analysis of this minimal promoter demonstrated that mutations in each Sp1 site had a profound effect on p21 transcription by perifosine, similar to Ras. Taken together, these results suggest a critical role of Sp1 in p21waf1/cip1 activation by perifosine, as has been observed previously with Ras (26) .

The proto-oncogene Ras is a known activator of prototypical MAPK pathways, ERK1 and ERK2 (51 , 52) . Activated ERK, in turn, phosphorylates multiple transcription factors, thereby enhancing its transcriptional activation (53) . On the basis of the similar effects of ALKs and Ras on the p21waf1/cip1 promoter, we determined the effects of perifosine on MEK activation. A very potent activation of the MEK/ERK pathway was observed within minutes of perifosine exposure. Moreover, this activation preceded the p21waf1/cip1 mRNA accumulation by perifosine. The role of MEK activation in p21waf1/cip1 induction by perifosine was analyzed using dominant-negative alleles and/or chemical inhibitors of MEK (PD98059). Blockade of MEK clearly blunted the p21waf1/cip1 promoter induction. Thus, perifosine mediated the transcriptional activation of the p21waf1/cip1 promoter by activation of MEK, similar to Ras. Moreover, MEK blockade blunted the induction of p21waf1/cip1 at the protein level, indicating that MAPK activation induced by perifosine was required for p21 accumulation. Interestingly, addition of the chemical MEK inhibitor PD98059 to HaCaT cells somewhat increased p21waf1/cip1 protein expression. This phenomenon may be explained by the lack of specificity of chemical inhibitors in general (54) . Thus, it is possible that PD98059 may inhibit, in addition to MEK, a kinase relevant for p21waf1/cip1 expression. To explore how MAPK activation leads to an increase in p21waf1/cip1 expression, gel-shift studies demonstrated that perifosine increased Sp1 DNA-binding activity. Moreover, MEK ablation by PD98059 and/or dominant-negative MEK prevented increased Sp1 DNA-binding activity by perifosine. Taken together, the transcriptional transactivation of the p21waf1/cip1 promoter by perifosine required MEK activation.

Sp1 is a member of a multigene family that binds DNA through COOH-terminal zinc-finger motifs (32 , 33) . Sp1 is a ubiquitous transcription factor that has been implicated in the activation of many genes (32 , 55 , 56) . Although Sp1 activity was initially thought to be constitutive, it has been shown that it can be regulated at different levels (20 , 57, 58, 59, 60) . Sp1 can be phosphorylated (a modification that affects its binding to the DNA; Refs. 29 , 39 , 57 , 58 ) and O-glycosylated (a modification that confers resistance to proteosome-dependent degradation; Ref. 61 ). Milanini-Mongiat et al. (29) demonstrated recently that Ras modulates the transcription of the vascular endothelial growth factor promoter by the phosphorylation of Sp1 at two specific sites (threonines 453 and 739) by activation of the MEK/ERK pathways. On the basis of the potent activation of MEK/ERK by perifosine, we asked whether perifosine modulates Sp1 phosphorylation. As expected, increased phosphorylation was demonstrated at both phosphorylation sites by Western blotting and/or immunofluorescence. Moreover, the increased specific phosphorylation and enhanced Sp1 DNA-binding activity induced by perifosine was blunted with pretreatment with the MEK inhibitor PD98059 and/or incubation of lysates with the serine-threonine phosphatase PP2A. Thus, it appears that activation of the MAPK pathway not only regulates the phosphorylation of Sp1 but also mediates the enhanced DNA-binding activity and increases transcriptional p21waf1/cip1 promoter activation induced by perifosine. Experiments in our laboratory are being undertaken to elucidate this novel mechanism.

Notably, it appears that the increased Sp1 phosphorylation coincides with an increase in Sp1 protein, and this increase appears to be partially mediated by activation of MEK because PD98059 can, to some extent, blunt the induction of Sp1 by perifosine. Noe et al. (39) demonstrated that acute exposure (~15 min) of Chinese hamster ovary cells to 12-O-tetradecanoylphorbol-13-acetate, a known activator of MEK/ERK pathway (62) , promotes increase in Sp1 mRNA and protein levels, leading to increased Sp1 DNA-binding activity to the dihydrofolate reductase promoter. Thus, our observations confirm separate observations by other investigators (29 , 39 , 40) that the activation of MEK/ERK pathways by different stimuli promotes the increase in Sp1 expression, phosphorylation, and DNA-binding activity, thereby enhancing Sp1 transcriptional activation. In our study, MEK blockade prevented p21 transactivation/expression, decreased Sp1 DNA binding, and decreased Sp1 phosphorylation with perifosine exposure. Thus, these data indicate that the activation of MAPK by ALKs is required for all of the events necessary for p21 transactivation.

Although Sp1 is a transcriptional factor involved in the transcription of several genes, we demonstrated the specificity and requirement of Sp1 in p21 transactivation by ALKs using several strategies: first, we showed that the minimal promoter region of the p21 promoter (~60 bp) is composed of several Sp1 sites that, when mutated, render the promoter inactive; second, perifosine promoted a specific increase in Sp1 DNA-binding activity at concentrations and times required for p21 up-regulation; third, phosphorylation of Sp1 at specific MAPK-dependent sites was required for p21 transactivation; and fourth, MEK blockade promoted loss in p21 transactivation that is associated with loss in Sp1 phosphorylation and loss in Sp1 DNA binding.

One intriguing detail to note is the ability of ALKs to activate the MEK/ERK MAPK pathway. It is counterintuitive that a small molecule that belongs to a known class of antiproliferative agents, ALKs, may have the capacity to activate a proliferative pathway such as the MEK/ERK MAPK. However, other antiproliferative agents, including paclitaxel and cisplatin, do activate MEK/ERK MAPK pathways (63 , 64) . Furthermore, Ras (a known activator of MEK/ERK) itself can lead to antiproliferative phenotypes such as cell death or senescence, in some models, due to activation of the MEK/ERK pathways (65 , 66) . Thus, activation of the MEK/ERK pathways by different stimuli including proto-oncogenes or drugs can, in some circumstances, mediate antiproliferative pathways. How alkylphospholipids activate the MEK/ERK pathway is still unknown. In some in vitro models, ALKs modulate several signal transduction pathways, including protein kinase C, phospholipase C, and phospholipase D (67 , 68) . It is quite possible that modulation of these and other unknown pathways by ALKs may promote the activation of MAPKs. Moreover, it is still possible that ALKs may activate a stress response leading to the activation of MAPKs (69) . Additional experiments are warranted to investigate the exact nature of this activation.

In summary, APKs are a novel class of antiproliferative small molecules that modulate cell cycle progression via transcriptional activation of the p21waf1/cip1 promoter. This activation is due to MAPK-dependent Sp1 phosphorylation and increased Sp1 DNA-binding activity to the p21waf1/cip1 promoter. Thus, this novel pathway by which alkylphospholipids regulate p21waf1/cip1 gene expression appears to be highly dependent on MAPK-dependent phosphorylation of Sp1. Additional work will be necessary to identify the nature of the molecules required for alkylphospholipids to activate MAPK and to investigate the role of this novel signaling pathway in normal and aberrant cell growth.


    ACKNOWLEDGMENTS
 
We thank Lourdes Villalba for critically reading the manuscript and Silvio Gutkind for reagents and for critically reading the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Adrian M. Senderowicz, Molecular Therapeutics Unit, Oral and Pharyngeal Cancer Branch, National Institute of Craniofacial and Dental Research, NIH, 30 Convent Drive, Building 30, Room 212, Bethesda, MD 20892-4330. Phone: (301) 594-5270; Fax: (301) 402-0823; E-mail: sendero{at}helix.nih.gov

Received 8/12/03. Revised 10/14/03. Accepted 11/ 3/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hilgard P., Stekar J., Klenner T., Nossner B., Kutscher B., Engel J. Heterocyclic alkylphospholipids with an improved therapeutic range. Adv. Exp. Med. Biol., 416: 157-164, 1996.[Medline]
  2. Hilgard P., Klenner T., Stekar J., Nossner G., Kutscher B., Engel J. D-21266, a new heterocyclic alkylphospholipid with antitumour activity. Eur. J. Cancer, 33: 442-446, 1997.
  3. Sundar S., Jha T. K., Thakur C. P., Engel J., Sindermann H., Fischer C., Junge K., Bryceson A., Berman J. Oral Miltefosine for Indian Visceral Leishmaniasis. N. Engl. J. Med., 347: 1739-1746, 2002.[Abstract/Free Full Text]
  4. Terwogt J. M., Mandjes I. A., Sindermann H., Beijnen J. H., ten Bokkel Huinink W. W. Phase II trial of topically applied miltefosine solution in patients with skin-metastasized breast cancer. Br. J. Cancer, 79: 1158-1161, 1999.[CrossRef][Medline]
  5. Crul M., Rosing H., de Klerk G. J., Dubbelman R., Traiser M., Reichert S., Knebel N. G., Schellens J. H., Beijnen J. H., ten Bokkel Huinink W. W. Phase I and pharmacological study of daily oral administration of perifosine (D-21266) in patients with advanced solid tumours. Eur. J. Cancer, 38: 1615-1621, 2002.
  6. Messmann R. A., Headlee D., Woo E., Figg W., Ryan q., Arbuck S., Murgo A., Melillo G., Dancey J., Senderowicz A. M., Sausville E. A. . A phase I trial of oral perifosine with different loading and maintenance schedules in patients with refractory neoplasms, March 25, 2001 Proceedings of the American Academy of Cancer Research New Orleans, LA
  7. Hilgard P., Stekar J., Voegeli R., Harleman J. H. Experimental therapeutic studies with miltefosine in rats and mice. Prog. Exp. Tumor Res., 34: 116-130, 1992.[Medline]
  8. Unger C., Damenz W., Fleer E. A., Kim D. J., Breiser A., Hilgard P., Engel J., Nagel G., Eibl H. Hexadecylphosphocholine, a new ether lipid analogue. Studies on the antineoplastic activity in vitro and in vivo. Acta Oncol., 28: 213-217, 1989.[Medline]
  9. Patel V., Lahusen T., Sy T., Sausville E. A., Gutkind J. S., Senderowicz A. M. Perifosine, a novel alkylphospholipid, induces p21(WAF1) expression in squamous carcinoma cells through a p53-independent pathway, leading to loss in cyclin-dependent kinase activity and cell cycle arrest. Cancer Res., 62: 1401-1409, 2002.[Abstract/Free Full Text]
  10. Ruiter G. A., Verheij M., Zerp S. F., van Blitterswijk W. J. Alkyl-lysophospholipids as anticancer agents and enhancers of radiation-induced apoptosis. Int. J. Radiat. Oncol. Biol. Phys., 49: 415-419, 2001.[CrossRef][Medline]
  11. Morgan D. O. Principles of CDK regulation. Nature (Lond.), 374: 131-134, 1995.[CrossRef][Medline]
  12. Senderowicz A. M., Sausville E. A. Preclinical and clinical development of cyclin-dependent kinase modulators. J. Natl. Cancer Inst., 92: 376-387, 2000.[Abstract/Free Full Text]
  13. Sherr C. J. Cancer cell cycles. Science (Wash. DC), 274: 1672-1677, 1996.[Abstract/Free Full Text]
  14. Xiong Y., Hannon G. J., Zhang H., Casso D., Kobayashi R., Beach D. p21 is a universal inhibitor of cyclin kinases[see comments]. Nature (Lond.), 366: 701-704, 1993.[CrossRef][Medline]
  15. el-Deiry W. S., Tokino T., Velculescu V. E., Levy D. B., Parsons R., Trent J. M., Lin D., Mercer W. E., Kinzler K. W., Vogelstein B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817-825, 1993.[CrossRef][Medline]
  16. Harper J. W., Adami G. R., Wei N., Keyomarsi K., Elledge S. J. The p21 cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell, 75: 805-816, 1993.[CrossRef][Medline]
  17. Cheng M., Olivier P., Diehl J. A., Fero M., Roussel M. F., Roberts J. M., Sherr C. J. The p21(Cip1) and p27(Kip1) CDK ‘inhibitors’ are essential activators of cyclin D-dependent kinases in murine fibroblasts. EMBO J., 18: 1571-1583, 1999.[CrossRef][Medline]
  18. Dotto G. P. p21(WAF1/Cip1): more than a break to the cell cycle?. Biochim. Biophys. Acta, 1471: M43-M56, 2000.[Medline]
  19. Sherr C. J., Roberts J. M. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev., 13: 1501-1512, 1999.[Free Full Text]
  20. Billon N., Carlisi D., Datto M. B., van Grunsven L. A., Watt A., Wang X. F., Rudkin B. B. Cooperation of Sp1 and p300 in the induction of the CDK inhibitor p21WAF1/CIP1 during NGF-mediated neuronal differentiation. Oncogene, 18: 2872-2882, 1999.[CrossRef][Medline]
  21. Parker S. B., Eichele G., Zhang P., Rawls A., Sands A. T., Bradley A., Olson E. N., Harper J. W., Elledge S. J. p53-independent expression of p21Cip1 in muscle and other terminally differentiating cells[see comments]. Science (Wash. DC), 267: 1024-1027, 1995.[Abstract/Free Full Text]
  22. Esposito F., Cuccovillo F., Vanoni M., Cimino F., Anderson C. W., Appella E., Russo T. Redox-mediated regulation of p21(waf1/cip1) expression involves a post-transcriptional mechanism and activation of the mitogen-activated protein kinase pathway. Eur. J. Biochem., 245: 730-737, 1997.[Medline]
  23. Akashi M., Osawa Y., Koeffler H. P., Hachiya M. p21WAF1 expression by an activator of protein kinase C is regulated mainly at the post-transcriptional level in cells lacking p53: important role of RNA stabilization. Biochem. J., 337: 607-616, 1999.
  24. Gartel A. L., Tyner A. L. Transcriptional regulation of the p21((WAF1/CIP1)) gene. Exp. Cell Res., 246: 280-289, 1999.[CrossRef][Medline]
  25. Zeng Y. X., el-Deiry W. S. Regulation of p21WAF1/CIP1 expression by p53-independent pathways. Oncogene, 12: 1557-1564, 1996.[Medline]
  26. Kivinen L., Tsubari M., Haapajarvi T., Datto M. B., Wang X. F., Laiho M. Ras induces p21Cip1/Waf1 cyclin kinase inhibitor transcriptionally through Sp1-binding sites. Oncogene, 18: 6252-6261, 1999.[CrossRef][Medline]
  27. Carlson B., Lahusen T., Singh S., Loaiza-Perez A., Worland P. J., Pestell R., Albanese C., Sausville E. A., Senderowicz A. M. Downregulation of cyclin D1 by transcriptional repression in MCF-7 human breast carcinoma cells induced by flavopiridol. Cancer Res., 59: 4634-4641, 1999.[Abstract/Free Full Text]
  28. Marinissen M. J., Chiariello M., Gutkind J. S. Regulation of gene expression by the small GTPase Rho through the ERK6 (p38 gamma) MAP kinase pathway. Genes Dev., 15: 535-553, 2001.[Abstract/Free Full Text]
  29. Milanini-Mongiat J., Pouyssegur J., Pages G. Identification of two Sp1 phosphorylation sites for p42/p44 mitogen-activated protein kinases: their implication in vascular endothelial growth factor gene transcription. J. Biol. Chem., 277: 20631-20639, 2002.[Abstract/Free Full Text]
  30. Patel V., Senderowicz A. M., Pinto D., Igishi T., Raffeld M., Quintanilla-Martinez L., Ensley J. F., Sausville E. A., Gutkind J. S. Flavopiridol, a novel cyclin-dependent kinase inhibitor, suppresses the growth of head and neck as squamous cell carcinomas by inducing apoptosis. J. Clin. Invest., 102: 1674-1681, 1998.[Medline]
  31. Datto M. B., Li Y., Panus J. F., Howe D. J., Xiong Y., Wang X. F. Transforming growth factor ß induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA, 92: 5545-5549, 1995.[Abstract/Free Full Text]
  32. Bouwman P., Philipsen S. Regulation of the activity of Sp1-related transcription factors. Mol. Cell Endocrinol., 195: 27-38, 2002.[CrossRef][Medline]
  33. Lania L., Majello B., De Luca P. Transcriptional regulation by the Sp family proteins. Int. J. Biochem. Cell Biol., 29: 1313-1323, 1997.[CrossRef][Medline]
  34. Campbell S. L., Khosravi-Far R., Rossman K. L., Clark G. J., Der C. J. Increasing complexity of Ras signaling. Oncogene, 17: 1395-1413, 1998.[CrossRef][Medline]
  35. Whitmarsh A. J., Davis R. J. A central control for cell growth. Nature (Lond.), 403: 255-256, 2000.[CrossRef][Medline]
  36. Weston C. R., Lambright D. G., Davis R. J. Signal transduction. MAP kinase signaling specificity. Science (Wash. DC), 296: 2345-2347, 2002.[Abstract/Free Full Text]
  37. Weston C. R., Davis R. J. The JNK signal transduction pathway. Curr. Opin. Genet. Dev., 12: 14-21, 2002.[CrossRef][Medline]
  38. Yang S. H., Yates P. R., Whitmarsh A. J., Davis R. J., Sharrocks A. D. The Elk-1 ETS-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol. Cell Biol., 18: 710-720, 1998.[Abstract/Free Full Text]
  39. Noe V., Alemany C., Nicolas M., Ciudad C. J. Sp1 involvement in the 4ß-phorbol 12-myristate 13-acetate (TPA)-mediated increase in resistance to methotrexate in Chinese hamster ovary cells. Eur. J. Biochem., 268: 3163-3173, 2001.[Medline]
  40. Merchant J. L., Du M., Todisco A. Sp1 phosphorylation by Erk 2 stimulates DNA binding. Biochem. Biophys. Res. Commun., 254: 454-461, 1999.[CrossRef][Medline]
  41. Worman H. J., Courvalin J-C. The nuclear lamina and inherited disease. Trends Cell Biol., 12: 591-598, 2002.[CrossRef][Medline]
  42. Serrano M., Hannon G. J., Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4[see comments]. Nature (Lond.), 366: 704-707, 1993.[CrossRef][Medline]
  43. Parkinson E. K., Munro J., Steeghs K., Morrison V., Ireland H., Forsyth N., Fitzsimmons S., Bryce S. Replicative senescence as a barrier to human cancer. Biochem. Soc. Trans., 28: 226-233, 2000.[Medline]
  44. Paramio J. M., Segrelles C., Ruiz S., Martin-Caballero J., Page A., Martinez J., Serrano M., Jorcano J. L. The ink4a/arf tumor suppressors cooperate with p21cip1/waf in the processes of mouse epidermal differentiation, senescence, and carcinogenesis. J. Biol. Chem., 276: 44203-44211, 2001.[Abstract/Free Full Text]
  45. Bulavin D. V., Tararova N. D., Aksenov N. D., Pospelov V. A., Pospelova T. V. Deregulation of p53/p21Cip1/Waf1 pathway contributes to polyploidy and apoptosis of E1A+cHa-ras transformed cells after gamma-irradiation. Oncogene, 18: 5611-5619, 1999.[CrossRef][Medline]
  46. Levkau B., Koyama H., Raines E. W., Clurman B. E., Herren B., Orth K., Roberts J. M., Ross R. Cleavage of p21Cip1/Waf1 and p27Kip1 mediates apoptosis in endothelial cells through activation of Cdk2: role of a caspase cascade. Mol. Cell, 1: 553-563, 1998.[CrossRef][Medline]
  47. Gorospe M., Wang X., Guyton K. Z., Holbrook N. J. Protective role of p21(Waf1/Cip1) against prostaglandin A2-mediated apoptosis of human colorectal carcinoma cells. Mol. Cell Biol., 16: 6654-6660, 1996.[Abstract]
  48. Steinman R. A., Hoffman B., Iro A., Guillouf C., Liebermann D. A., el-Houseini M. E. Induction of p21 (WAF-1/CIP1) during differentiation. Oncogene, 9: 3389-3396, 1994.[Medline]
  49. Di Cunto F., Topley G., Calautti E., Hsiao J., Ong L., Seth P. K., Dotto G. P. Inhibitory function of p21Cip1/WAF1 in differentiation of primary mouse keratinocytes independent of cell cycle control[see comments]. Science (Wash. DC), 280: 1069-1072, 1998.[Abstract/Free Full Text]
  50. Zhou B. P., Liao Y., Xia W., Spohn B., Lee M. H., Hung M. C. Cytoplasmic localization of p21Cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat. Cell Biol., 3: 245-252, 2001.[CrossRef][Medline]
  51. Kolch W. Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochem. J., 351: 289-305, 2000.
  52. Whitmarsh A. J., Davis R. J. Signal transduction by MAP kinases: regulation by phosphorylation-dependent switches. Sci. STKE, : PE1 1999.
  53. Yang S. H., Whitmarsh A. J., Davis R. J., Sharrocks A. D. Differential targeting of MAP kinases to the ETS-domain transcription factor Elk-1. EMBO J., 17: 1740-1749, 1998.[CrossRef][Medline]
  54. Davies S. P., Reddy H., Caivano M., Cohen P. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J., 351: 95-105, 2000.[CrossRef][Medline]
  55. Gidoni D., Kadonaga J. T., Barrera-Saldana H., Takahashi K., Chambon P., Tjian R. Bidirectional SV40 transcription mediated by tandem Sp1 binding interactions. Science (Wash. DC), 230: 511-517, 1985.[Abstract/Free Full Text]
  56. Kadonaga J. T., Carner K. R., Masiarz F. R., Tjian R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell, 51: 1079-1090, 1987.[CrossRef][Medline]
  57. Black A. R., Jensen D., Lin S. Y., Azizkhan J. C. Growth/cell cycle regulation of Sp1 phosphorylation. J. Biol. Chem., 274: 1207-1215, 1999.[Abstract/Free Full Text]
  58. Haidweger E., Novy M., Rotheneder H. Modulation of Sp1 activity by a cyclin A/CDK complex. J. Mol. Biol., 306: 201-212, 2001.[CrossRef][Medline]
  59. Grinstein E., Jundt F., Weinert I., Wernet P., Royer H. D. Sp1 as G1 cell cycle phase specific transcription factor in epithelial cells. Oncogene, 21: 1485-1492, 2002.[CrossRef][Medline]
  60. Saffer J. D., Jackson S. P., Annarella M. B. Developmental expression of Sp1 in the mouse. Mol. Cell Biol., 11: 2189-2199, 1991.[Abstract/Free Full Text]
  61. Han I., Kudlow J. E. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility. Mol. Cell Biol., 17: 2550-2558, 1997.[Abstract]
  62. Zhuang S., Hirai S., Mizuno K., Suzuki A., Akimoto K., Izumi Y., Yamashita A., Ohno S. Involvement of protein kinase C in the activation of extracellular signal-regulated kinase 1/2 by UVC irradiation. Biochem. Biophys. Res. Commun., 240: 273-278, 1997.[CrossRef][Medline]
  63. Bacus S. S., Gudkov A. V., Lowe M., Lyass L., Yung Y., Komarov A. P., Keyomarsi K., Yarden Y., Seger R. Taxol-induced apoptosis depends on MAP kinase pathways (ERK and p38) and is independent of p53. Oncogene, 20: 147-155, 2001.[CrossRef][Medline]
  64. Wang X., Martindale J. L., Holbrook N. J. Requirement for ERK activation in cisplatin-induced apoptosis. J. Biol. Chem., 275: 39435-39443, 2000.[Abstract/Free Full Text]
  65. Downward J. Ras signalling and apoptosis. Curr. Opin. Genet. Dev., 8: 49-54, 1998.[CrossRef][Medline]
  66. Ferbeyre G., de Stanchina E., Lin A. W., Querido E., McCurrach M. E., Hannon G. J., Lowe S. W. Oncogenic ras and p53 cooperate to induce cellular senescence. Mol. Cell Biol., 22: 3497-3508, 2002.[Abstract/Free Full Text]
  67. Berkovic D., Goeckenjan M., Luders S., Hiddemann W., Fleer E. A. Hexadecylphosphocholine inhibits phosphatidylinositol and phosphatidylcholine phospholipase C in human leukemia cells. J. Exp. Ther. Oncol., 1: 302-311, 1996.[Medline]
  68. Lu