Cancer Research Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hazarika, P.
Right arrow Articles by Duvic, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hazarika, P.
Right arrow Articles by Duvic, M.
[Cancer Research 64, 7361-7369, October 15, 2004]
© 2004 American Association for Cancer Research

Regular Articles

Up-regulation of Flotillin-2 Is Associated with Melanoma Progression and Modulates Expression of the Thrombin Receptor Protease Activated Receptor 1

Parul Hazarika1, Marya F. McCarty2, Victor G. Prieto1,3, Saira George1, Daniel Babu1, Dimpy Koul4, Menashe Bar-Eli5 and Madeleine Duvic1

Departments of 1 Dermatology, 2 Surgical Oncology, 3 Pathology, 4 Neuro-Oncology, and 5 Cancer Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Flotillin 2 (flot-2) is a highly conserved protein isolated from caveolae/lipid raft domains that tether growth factor receptors linked to signal transduction pathways. Flot-2 protein and mRNA were increased in tumorigenic and metastatic melanoma cell lines in vitro, and the immunostaining intensity increased substantially across a tissue array of melanocytic lesions. Flot-2 transfection transformed SB2 melanoma cells from nontumorigenic, nonmetastatic to highly tumorigenic and metastatic in a nude mouse xenograft model. SB2 cells stably transfected with the flot-2 cDNA (SB2-flot)–2 cells proliferated faster in the absence of serum, and their migration through Matrigel was additionally enhanced by thrombin. When SB2-flot–2 cells were compared with SB2-vector–control cells on a cancer gene pathway array, SB2-flot–2 cells had increased expression of protease activated receptor 1 (PAR-1) mRNA, a transmembrane, G-protein–coupled receptor involved in melanoma progression. PAR-1 and flot-2 were coimmunoprecipitated from SB2-flot–2 cells. Up-regulation of PAR-1 was additionally confirmed in SB2-flot–2 cells and melanoma cell lines. SB2-flot–2 cells transfected with flot-2–specific small-interfering RNAs made substantially less flot-2 and PAR-1 mRNA. In conclusion, flot-2 overexpression is associated with melanoma progression, with increased PAR-1 expression, and with transformation of SB2 melanoma cells to a highly metastatic line. Flot-2 binds to PAR-1, a known upstream mediator of major signal transduction pathways implicated in cell growth and metastasis, and may thereby influence tumor progression.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although skin cancer represents 50% of all human cancers, only 4% are melanomas accounting for 79% of all skin cancer-related deaths. Melanoma has a propensity for early invasion and metastatic spread leading to poor overall survival (1) . Cutaneous melanomas arise from epidermal neural, crest-derived melanocytes. Recent studies support both genetic and epidemiologic factors causing melanoma, including specific mutations in cell signal pathway or DNA repair genes after exposure to UV light (2 , 3) . In contrast, factors leading to melanoma progression (vertical growth or invasion and metastatic spread) are less well understood and require additional elucidation. Loss of dependency on growth factors, increased ability to adhere and invade, and ability to form new blood vessels and vascular slits have been recognized as key properties in transformation and metastatic behavior (4, 5, 6, 7, 8, 9) . Understanding biology of melanoma progression may accelerate the development of more effective treatments for metastatic melanoma.

Caveolae and lipid rafts are microdomains of the inner plasma membrane that function to organize growth factor receptors and modulate downstream signal transduction pathways for cell growth and malignancy (10) . Lipid rafts were recently implicated in signal transduction initiated by integrins and mediated by the Rho family of GTPases (11) . Flotillins and caveolins are the two major protein families isolated from lipid raft/caveolae (12 , 13) . Caveolins are putative tumor suppressors that are down-regulated by oncogenic transformation (14) . Flotillin-2 (flot-2) is a very highly conserved, Mr 41,7000 protein first isolated by our laboratory as a cDNA from an epidermal keratinocyte library (15, 16, 17) . Flotillin-1 and flot-2 proteins isolated from lung caveolae (12) are homologues of goldfish proteins Reggie 2 and 1 isolated from regenerating goldfish optical neurons (18, 19, 20) . Flot-2 lacks a transmembrane domain and is associated with the inner membrane through myristoylation and palmitoylation (21) .

Normal melanocytes require growth factors to proliferate, but transformed melanocytes display loss of serum and growth factor dependency (22) . Constitutive activation of mitogen-activated protein kinase (MAPK) signaling, as represented by phosphorylation of extracellular signal-regulated kinase (ERK)1/2, and mutations in b-raf kinase are found in transformed melanoma cells (8 , 22) . For melanoma cells to enter vertical growth phase (tumorigenic phase in the dermis) and metastasize, cells must adhere to and degrade matrix and create new blood vessels (angiogenesis; ref. 23 ).

DNA microarrays profiling gene expression patterns have identified key molecules and pathways in melanoma (24) . In comparing a highly metastatic A375SM melanoma line cloned from pulmonary metastases in mice to its parental line, A375P, A375SM expressed increased levels of Rho-C, fibronectin, and thymosin B (25) . G-protein–coupled receptors in the MAPK pathway signal through Rho-GTP–ases that control actin cytoskeleton organization influencing cell shape and mobility (26 , 27) . In previous studies, we showed that overexpression of flot-2 will induce filopodia in Cos epithelial, and others have confirmed this observation (17 , 21) . Thus, the ability of flot-2 to alter cell shape is hypothesized to involve Rho GTP-ases, such as Rho-C coupled to a G-protein–coupled receptor.

The thrombin receptor, PAR-1, is a transmembrane G-protein–coupled receptor recognized to play a central role in melanoma progression (28, 29, 30) . PAR-1 is necessary and rate limiting for formation of thrombin-enhanced pulmonary melanoma metastases (28 , 31) . Of interest, PAR-1 transforms 3T3 cells through Rho-G–protein signaling (32 , 33) and also transforms SB2, a known nontumorigenic, nonmetastatic melanoma cell line, which has been studied extensively. Transformation by PAR-1 is associated with increased surface integrin expression and phosphorylation of focal adhesion kinase (34) . PAR-1 is negatively regulated by the transcription factor AP2 that decreases with melanoma progression and promotes angiogenesis through increased interleukin 8 and vascular endothelial growth factor protein levels (30 , 35) .

We present new evidence that overexpression of highly conserved flot-2 is associated with melanoma progression in cells and tissues, transforms SB2 cells, and is associated with expression of PAR-1.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Culture.
Human melanoma cell lines used are shown in (Table 1Citation ; Fig. 1Citation ) and include SB2, A375P, A375SM, TXM13 (36) , TXM18 (37) , MeWo, WM 266-4 (35) , WM793 (38) , DX3 (36) , Mel 501, and Mel 888 (5) . Lines were previously characterized for tumorigenicity and metastases in the nude mouse model (36, 37, 38) . Cells were grown in DMEM supplemented with 10% fetal bovine sera, sodium pyruvate, L-glutamine, nonessential amino acids, and penicillin-streptomycin.


View this table:
[in this window]
[in a new window]

  		Table 1 Melanoma cell lines of variable tumorigenicity

 


View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Expression of flot-2 and PAR-1 in melanoma cell lines. A, Western blot of flot-2. Melanoma cell lysates (10 µg/lane) subjected to 10% SDS-PAGE were immunoblotted with actin monoclonal IgG (1:2,000) and PAR-1 (WEDE 15) monoclonal IgG (1:1,000) then horseradish peroxidase-conjugated goat antimouse IgG followed by ECL-S detection (Amersham; ref. 17 ). After stripping, membranes were rehybridized with flot-2 monoclonal IgG (1:5,000). Lanes are as follows: (1) SB2; (2) SB2-flot–2; (3) A375P; (4) A375SM; (5) TXM13; (6) TXM18; (7) MeWo; (8) WM266-4; (9) WM793; (10) DX3; (11) Mel 501; and (12) Mel 888. B. Densitometry analysis of the ratio of flot-2 to actin in cell lines. Flotillin-2 and actin protein signals in Fig. 1ACitation were measured with {alpha}-ease image analysis software. The ratio of percentage density of endogenous flot-2 to actin was calculated. C. PAR-1 protein in melanoma cell lines. Ratio of PAR-1 to actin signals plotted for each cell line are shown in A. D. Quantitative reverse transcriptase-PCR measurement of flot-2 mRNA from melanoma cell lines. Total RNA (1 µg) was reverse transcribed and amplified with flot-2–specific primers in triplicate. The PCR product was detected in real time with a third fluorogenic primer on ABI 7000 Taqman system. Mean ratios of flot-2 to 36B4 signals are plotted; bars, ±SD.

 
Western Immunoblotting.
Western blotting analysis was done as described previously (17) . Cells were lysed in 20 mmol/L Tris (pH7.5), 0.15 M NaCl, 1% Triton X-100, 60 mmol/L octyl-glucoside, and complete protease inhibitors cocktail (Roche Molecular Biochemicals, Indianapolis, IN). Soluble proteins were separated by centrifugation for 15 minutes at 14,000 rpm at 4°C. Ten micrograms of protein per lane were run on 10% SDS-PAGE, immunoblotted on nitrocellulose membranes, and blocked in 5% nonfat dry milk in PBS (pH7.4) and 0.1% Tween 20. The membranes were incubated with flot-2 antibody (1:5000; BD PharMingen, San Diego, CA) in PBS (pH7.4) and 0.1% Tween 20 for 2 hours at room temperature. The membranes were washed with PBS (pH7.4) and 0.1% Tween 20, incubated with horseradish peroxidase-labeled goat antimouse IgG (1:5,000; Jackson Immunoresearch, West Grove, PA) for 1 hour at room temperature, washed again, and visualized with ECL-S Western blotting detection kit (Amersham, Arlington Heights, IL). Antibody to PAR-1 (WEDE 15, Beckman Coulter/Immunotech, Miami, FL) was used at 1:1,000. Where applicable, membranes were stripped in 62.5 mmol/L Tris-HCl (pH6.7), 2% SDS, and 100 mmol/L 2-mercaptoethanol for 30 minutes at 50°C and washed with PBS containing 0.1% Tween 20 before rehybridization. Equivalent loading was confirmed by immunostaining with actin antibody at 1:2,000 (Santa Cruz Biotechnology, Santa Cruz, CA). The {alpha} Ease Image analysis software was used to measure intensity of signals.

Quantitative Reverse Transcriptase-PCR mRNA Analysis.
Total mRNA extracted from melanoma cells with Qiagen RNeasy kit (Qiagen Inc., Valencia, CA) was incubated with Dnase I in 4 mmol/L MgCl2 at 37°C for 30 minutes with termination at 75°C for 10 minutes. Flot-2 primers (F-CCCCAGATTGCTGCCAAA and R-TCCACTGAGGACCACAATCTCA) and fluorescent oligonucleotide probe (CGCTGCCCCACTTACCAAGGTCG) were designed from the published sequence, accession no. M60922 (15) with Primer Express Software (Perkin-Elmer, Boston, MA). Primers and probes for measuring PAR-1, 36B4, and glyceraldehyde-3-phosphate dehydrogenase mRNA by quantitative reverse transcriptase-PCR were published previously (39 , 40) . PCR primers for flot-2 and PAR-1 were purchased from Sigma Genosys (Woodlands, TX). Fluorescent detection probes were purchased from Applied Biosystems (Foster City, CA).

RNA (1 µg) was reverse transcribed with MuMLV reverse transcriptase (Promega, Madison, WI) and random hexamers in a 20 µL total volume reaction mixture [1x PCR buffer (Perkin-Elmer), 4 mmol/L MgCl2, and 500 µmol/L deoxynucleotide triphosphates] at 42°C for 15 minutes and terminated by incubation at 95°C for 5 minutes. PCR amplification was carried out in a total volume of 25 µL containing 1 µL reverse transcribed cDNA, 2.5 µL of 10x TaqMan buffer, 200 nmol/L of each forward and reverse primer, 100 nmol/L fluorescent probe, 3.5 mmol/L MgCl2, and Amplitaq gold 0.025 units/µl. PCR conditions in the ABI 7000 Prizm Sequence Detector (Perkin-Elmer) were preheating for 95°C for 1 minute, followed by 50 cycles of melting (94°C for 15 seconds), and annealing and extension (60°C for 60 secoonds). Glyceraldehyde-3-phosphate dehydrogenase or 36B4 mRNA was measured in the same reaction by quantitative reverse transcriptase-PCR for normalization standard.

Immunostaining of Melanocytic Lesion Tissue Array for Flot-2.
A human melanocytic tissue array of paraffin-embedded clinical specimens was constructed as described previously (41) . The array contained 182 sections from 96 different melanocytic lesions, including 19 benign nevi, 21 dysplastic nevi, 25 primary, radial growth phase melanomas, and 31 metastases (12 visceral and 19 nodal). Three slides were immunoreacted with antiflot-2 antibody (1:50) and detected by immunohistochemistry with a tyramine catalyzed amplification system (DAKO, Carpinteria, CA) and azure B counter-stain for melanin. The numbers of melanocytes expressing flot-2 were graded as 0 (<5%), 1 (5 to 25%), 2 (25 to 75%), or 3 (>75 to 100%). Immunoreaction intensity was graded with a semiquantitative scale: 0 = no staining; 3 = moderate staining; and 5 = most intense possible staining. Average staining intensities for each group are shown in Table 2ACitation . Random sampling with replacement among the records within each tissue sample was repeated to generate 1,000 data sets, each with 96 observations. To suit the analysis purpose, two cutoff points equally spaced from 1 to 5 were used to divide the intensity readings into three groups based on cutoffs of low (1 to 2.33), medium (2.34 to 3.67), and high (3.68 to 5.0). Fisher’s exact test was used for comparing the readings among the patient groups on the 1,000 data sets (Table 2B)Citation . The median of 1,000 Ps for each comparison was recorded. To avoid the reporting bias from the multiple comparisons, the adjusted Ps with the step-down Bonferroni method of Holm were reported.


View this table:
[in this window]
[in a new window]

  		Table 2 Expression of Flot-2 protein in melanocytic lesion tissue array

 
Overexpression of Flotillin-2 in SB2 Cells.
Full-length flot-2 mouse cDNA was ligated into the mammalian expression vector p-EGFPC2 (Clontech, Palo Alto, CA) driven by a cytomegalovirus (CMV) promoter (16 , 17) . SB2 cells (2 x 105) were transfected with 1.5 µg of DNA in 10 µL LipofectAMINE reagent (Life Technologies, Inc., Gaithersburg, MD). Transfections were done in parallel with enhanced green fluorescent protein (EGFP)-flot-2, EGFP neovector, and no DNA in 1 ml of OPTIMEM (Life Technologies, Inc.) for 5 hours. Cells were selected for 2 weeks in media containing 800 µg/ml neomycin (G418). Several independent neoresistant colonies were isolated by trypsinization and established by limiting dilution in culture. Expression of EGFP-flot–2-fusion protein was confirmed by Western blotting (17) .

Xenograft Model.
Male athymic BALB/c nude mice were purchased from the Animal Production Area of National Cancer Institute, Frederick Cancer Research Facility (Frederick, MD) and housed in American Association for Accreditation of Laboratory Animal Care approved facilities in laminar flow cabinets under specific pathogen-free conditions. Animals were used at 8 weeks of age in accordance with current regulations and standards of the United States Department of Agriculture, Department of Health and Human Services, and NIH.

Tumorigenicity experiments were conducted with previously published methods (36 , 42) . Briefly, 1 x 106 flot-2–EGFP-transfected SB2 cells (SB2-flot–2) or empty vector control SB2 cells (SB2-V) were injected subcutaneously to each of five BALB/c nude mice for each group, and the size of the subcutaneous tumor nodule was monitored weekly until day 60.

Experimental Lung Metastasis in Nude Mice.
Cells (1 x 106) from each line were injected into the lateral vein of groups of five nude mice as described previously (36) . Mice were sacrificed after 60 days. Lungs were removed, washed in water, and fixed with Bouin’s solution for 24 hours to facilitate counting of tumor nodules by dissecting microscope. Lung sections were also stained with H&E to confirm that the nodules were melanoma and to monitor the presence of micrometastases.

Microvessel Density Assay.
Immunohistochemistry for microvessel density was done as described previously (42) on 8- to 10-µm sections of subcutaneous tumors embedded in OCT compound on positively charged Superfrost slides (Fisher Scientific, Houston, TX). Slides were fixed in –20°C acetone for 10 minutes, washed in PBS (pH 7.5), and blocked with PBS supplemented with 1% normal goat serum and 5% normal horse serum for 20 minutes at room temperature. Incubation with rat antimouse monoclonal CD31/platelet/endothelial cell adhesion molecule 1 antibody (PharMingen; 1:800) was overnight at 4°C in protein blocking solution. Slides were washed with PBS and incubated for 10 minutes in protein blocking solution before the addition of 1:5,000 horseradish peroxidase-conjugated goat antimouse F(ab')2 (Jackson Research Laboratories, West Grove, PA). After incubation for 1 hour at room temperature, slides were washed and incubated with 3,3-diaminobenzidine (Vector Laboratories, Burlingame, CA). The sections were washed three times with distilled water and counterstained with Gill’s hematoxylin (Sigma, St. Louis, MO). The slides were mounted with Universal Mount (Research Genetics, Huntsville, AL) and examined in a bright-field microscope. Controls included omission of primary antibody, incubation with normal mouse serum, or incubation with normal mouse IgG. Images of ten 0.159 mm2 fields at 100x magnification were digitized and stored for additional analysis. The number of blood vessels was counted with Scion program (Scion Corp., Fredrick, MD), and microvessel density was expressed as the mean number of blood vessels/100x field.

Matrigel Tube Formation Assay.
SB2, SB2-flot-2, and SB2-V cells were plated at 2 x 105/well in triplicate on 24-well plates coated with 200 µL Matrigel (Becton Dickinson, San Diego, CA) as described previously (43) . Cells were examined 24 hours later for tube formation under light microscopy (100x). Images were captured by Optronics TEC-470 camera and digitized using Optimas imaging software (Silver Springs, MD). Tube formation was quantified by manual counting of triplicate wells on low-power fields at 40x.

Cell Proliferation Assay.
Cells were plated at 2 x 105/well in triplicate on 24-well plates for 48 hours in media with or without serum. The cells were trypsinized and counted by trypan blue exclusion method.

Matrigel Invasion Assay.
The in vitro ability to invade Matrigel coated inserts was compared between SB2-flot-2 and SB2-V cells as described previously (44) . Briefly, 8-µm pore transwell inserts (Costar, Cambridge, MA) coated with Matrigel in cold serum-free medium were seeded with 2 x 105 cells per well and incubated in 5% CO2 at 37°C for 2 hours. Cells on the upper surface of the filter were removed by wiping with a cotton swab, and cells that had migrated to the to the lower surface of the membrane were stained with Hema-3 stain kit (Biochemical Science Inc., Swedsboro, NJ). Cells in five predetermined fields were counted under microscopy. Data were expressed as the average number of cells migrated through the filters.

Differential Gene Expression by SB2-Flot–2 Transfected Cells with DNA Microarray.
Total RNA was extracted from SB2-flot–2 cells and from EGFP-neovector control cells with RNA easy kit (Qiagen). RNA was converted to cDNA and labeled with Cy3 green (SB2-flot–2) or Cy5 red (SB2-vector). Labeled cDNAs (100 µg) were hybridized with a DNA cancer pathway array on poly-L–lysine-coated slides composed of 75 bp oligomers representing 1,100 unique genes (45) . Signals were detected with a laser scanner and quantified with Array Vision (Imaging Research, Inc., St. Catherine’s, Ontario, Canada).

Immunoprecipitation.
Confluent SB2-flot–2 cells in a 60-mm culture dish were solubilized for 1 hour on ice with 500 µL of TBS [10 mmol/L Tris (pH 8.0) and 0.15 M NaCl] containing 1% Triton X-100, 60 mmol/L octyl-glucoside, complete protease inhibitors cocktail (Roche Molecular Biochemicals), 1 mmol/L sodium vanadate, 1 mmol/L EDTA, and 1 mmol/L EGTA. Cell lysates were centrifuged for 15 minutes at 15,000 g at 4°C. Supernatants (800 µg protein) were precleared with Protein A/G PLUS Agarose (Santa Cruz Biotechnology) and then incubated with 3 µg PAR-1 (WEDE 15) primary antibody (1:1,000) at 4°C overnight. The immunocomplex was captured by incubation with Protein A/G PLUS-Agarose for 1 hour to overnight at 4°C. The immunoprecipitate was pelleted by centrifugation at 2,500 rpm for 5 minutes at 4°C and washed four times in ice-cold lysis buffer. The pellet was resuspended in 40 µL of SDS sample buffer, boiled for 3 minutes, and analyzed by Western blotting with flot-2 antibody (1:1,000).

Small-Interfering mRNA Treatment.
A cocktail of four small-interfering RNAs designed for flot-2 (SMARTpool) and nonspecific control small-interfering RNAs were purchased from Dharmacon (Lafayette, CO) and used according to the manufacturer’s protocols. One x105 SB2-flot–2 cells were plated in triplicate on 12-well plates in antibiotic-free DMEM (10% fetal bovine serum, 1% sodium pyruvate, 1% essential amino acids, 1% L-glutamine, and 1% HEPES buffer). One hundred 100 microliters Opti-MEM containing 100 pmol flot-2 small-interfering RNA SMARTpool or nonspecific control small-interfering RNA at 100 pmol (Dharmacon, Lafayette, CO) and 100 µL Opti-MEM containing 2 µL LipofectAMINE were mixed and allowed to complex for 25 minutes at room temperature. Cells were rinsed in Opti-MEM, and 200 µL of small-interfering RNA-LipofectAMINE complexes were added for 6 hours at 37°C before being replaced with antibiotic-free DMEM for another 48 hours. RNA was isolated from each well with RNeasy Mini Kit (Qiagen). Amount of mRNA after treatment with flot-2 or control small-interfering RNAs was analyzed by quantitative reverse transcriptase-PCR for flot-2 mRNA (A) or PAR-1 mRNA (B) with an ABI 7000 PRISM Sequence Detection System (Applied Biosystems). Values were normalized to the 36B4 standard. Data were expressed as mean of triplicate wells treated with small-interfering RNA-flot2 versus control small-interfering RNA-treated cells assigned as 100%. Student’s t test was used to compare the data for each condition.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Flotillin-2 Protein Expression Is Low in Nontumorigenic and High in Metastatic Melanoma Cell Lines in Vitro.
Flotillin-2 is a ubiquitously expressed, highly conserved protein previously shown in many cell lines (15 , 16 , 28) . In surveying benign and malignant melanoma cell lines by Western blotting (Fig. 1)Citation , low flot-2 protein level was found in a previously well-characterized, nontumorigenic and nonmetastatic cell line, SB2 (36) . Flot-2 and PAR-1 (thrombin receptor) protein levels normalized to actin were measured from eleven cultured melanoma cell lines selected to represent a range of tumorigenicity and metastatic behavior (Table 1Citation ; Fig. 1, A–CCitation ). All nonaggressive cell lines (SB2, DX3, Mel-501, and Mel-888) had lower levels of both flot-2 and PAR-1 than other cell lines that are known to form subcutaneous tumors and metastases in nude mice (TXM13, TXM 18, and WM266-4). Of interest, the most aggressive line, A375SM, derived from pulmonary metastases of parental A375P, exhibited higher levels of both flot-2 protein and mRNA than did the parental A375P.

To confirm the protein data, we measured flot-2 mRNA levels by a quantitative assay (Fig. 1D)Citation . Flot-2 mRNA was more abundant in the most aggressive tumor cell lines (A375SM, TXM13, and WM266-4) compared with poorly tumorigenic lines (SB2, A375P MeWo, DX3, Mel 501, and Mel 888). These data first suggested transcriptional regulation of flot-2 expression in melanoma cell lines as well as possible correlation between biological behavior and flot-2 expression. One exception was the WM793 line, originally derived from a vertical growth phase melanoma and known to exhibit high tumorigenicity with low metastatic behavior. Although WM793 had high PAR-1 protein and flot-2 mRNA levels, its expression of flot-2 protein was low.

Overexpression of Flotillin-2 Is Significantly Associated with Progression of Human Melanoma in Vivo.
To verify the in vitro observation in cells, we next stained for flot-2 on a melanocytic lesion tissue array (41) . The clinical lesions were divided into four major groups (all nevi, primary melanoma, invasive melanoma or nodal metastases, and visceral metastases). Representative samples are shown in Fig. 2, A–DCitation . The average staining intensities for each group are shown in Table 2ACitation . Cytoplasmic staining for flot-2 in epidermal and follicular keratinocytes was less intense than in nests of melanocytes, dendritic cells, and endothelium. The intensity of flot-2 did not distinguish between benign (Fig. 2A)Citation or dysplastic nevi (Fig. 2B)Citation . In nevi, flot-2 expression was often more intense in epidermal melanocyte nests than in dermal melanocytes. In contrast, very strong homogeneous expression was observed in almost all of the melanoma cells from invasive melanomas and metastases (Fig. 2, C and D)Citation . By four-way comparisons of staining intensity, there was a highly significant difference between overall comparison of lesion groups (P < 0.0001 adjusted; Table 2BCitation ). Metastatic melanomas from nodal or visceral sites were significantly higher in flot-2 staining than all nevi and primary melanomas.



View larger version (143K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Cytoplasmic expression of flot-2 in melanocytic lesions by immunohistochemistry. Antiflot-2 (1:50), diaminobenzidine, and azure B counterstain. Scale bar = 200 µm; photos 20x magnification; inserts, 40x magnification. A, benign intradermal nevus. Expression by many melanocytes located close to the epidermis. Langerhans cells (arrowhead) also express flot-2. Note expression of flot-2 by endothelial cells (arrow). B, dysplastic nevus. Stronger expression of flot-2 by melanocytes in the epidermis (arrows) than in the dermis (arrowhead). C, primary invasive melanoma. Diffuse, strong expression of flot-2 in both in situ (thick arrow) and invasive (thin arrow) melanoma cells. Note expression of flot-2 by endothelial cells (arrowhead). D, melanoma metastatic to lung. Strong and homogeneous cytoplasmic expression of flotillin by most melanoma cells with no nuclear staining.

 
Overexpression of Mouse Flotillin-2 cDNA in Nontumorigenic SB2 Cells Induces Tumorigenicity and Metastases.
To examine the hypothesis that flot-2 overexpression leads to melanoma progression, we selected the SB2 line with low flot-2 protein levels and known poor tumorigenicity in the nude mouse xenograft model for forced overexpression (36) . A construct containing mouse flot-2 cDNA in a CMV-EGFP neovector (17) and empty EGFP-neovector plasmid DNA were transfected into SB2 cells. Two independently derived stable SB2-flot–2 clones and one vector control line (SB2-V) were selected for additional characterization of in vivo tumor and metastasis formation. SB2-flot–2 lines in culture had normal morphology and expressed 2- to 3-fold more green fluorescent flot-2 fusion protein of Mr 69,000 than endogenous flot-2 of Mr 41,700 (Fig. 3ACitation , Lanes 2 and 3). Overexpression of recombinant protein in SB2 cells (Fig. 1ACitation , lane 2; Fig. 3ACitation ) did not alter the expression of native flot-2 protein compared with the vector control (Fig. 3ACitation , Lane 1).



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Increased tumorigenicity of SB2–flot-2 cells. A, Western blot of transfected SB2 lines. Protein lysates were immunoblotted and detected with flot-2 antibody (1:5,000) as described in Table 1Citation . Lane 1, empty vector transfected SB2 cells; Lane 2, SB2 EGFP flot-2 clone 1; and Lane 3, SB2 EGFP flot-2 clone 2. B. increased tumorigenicity of SB2-flot–2-transfected clones in nude mice. SB2 tumor cells (1 x 106) in 0.2 ml of HBSS were injected over the right scapular region of BALB/c nude mice. Measurements of s.c. tumors from two SB2-flot–2 lines, and the SB2-V control were monitored weekly and are plotted as mean tumor volume observed in five animals per group; bars, ±SD.

 
The time course of tumors formed by subcutaneous injections of 1 x 106 SB2-vector or flot-2–transfected cells are plotted in Fig. 3BCitation . Only 1 of 5 mice injected with SB2-vector cells formed a small palpable tumor by day 36 in contrast to injections of each SB2-flot–2 clone that formed rapidly growing tumors by day 20 in 3 of 5 mice. The mean tumor volume over the time course showed higher tumor volumes from two SB2-flot–2 lines compared with the SB2-vector control. There was no significant difference in the tumor volumes between the two SB2-flot–2 clones at day 24 and day 36 (P = 0.52 and P = 0.09, respectively).

To determine whether flot-2 transfection also induces metastasis formation, SB2-flot–2 and SB2-V cells were injected intravenously into mice (Table 3)Citation . Although 3 of 5 mice injected with neovector-control transfected SB2 cells developed metastases in the lungs, the numbers were very low (mean = 1.5 lung metastasis per animal). In contrast, all five of the animals injected with each SB2-flot–2-transfected cell line formed >100 lung metastases by day 60. Differences between SB2-flot–2 and SB2-vector control lines were highly significant (F = 109.61; P < 0.01; ANOVA). In addition, large intracardiac metastases arose in mice injected with SB2-flot–2 cells but not with SB2-V controls (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 3 Increased lung metastasis of SB2-Flot-2 cells in nude mice

 
Overexpression of Flot-2 in SB2 Cells Is Associated with Increased Tumor Microvessel Density and with Increased Cellular Proliferation, Vasculogenic Mimicry.
We observed that flot-2 staining was prominent on the vascular endothelium of melanomas (Fig. 2)Citation , and thus flot-2 may be associated with angiogenesis. Frozen sections of subcutaneous tumors from mice were stained for CD31 and analyzed as described previously (42) . SB2-flot–2-derived tumors had significantly increased microvessel density compared with SB2-V tumors (P ≤ 0.01; Fig. 4, A–CCitation ). We also investigated vasculogenic mimicry defined as the ability of cancer cells to spontaneously form vascular slits previously associated with aggressive ocular melanomas (46) . To test vasculogenic mimicry tube formation, cells were plated on Matrigel-coated membranes and observed under light microscopy. Both SB2-flot–2 clones formed significantly more elongated three-dimensional tubular structures than the parental line or vector control cells (P ≤ 0 0.001; Fig. 4, D and ECitation ).



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. SB2-flot–2 cells make tumors with increased microvessel density have increased tube formation in vitro and proliferate in sera-free media. A and B, immunohistochemistry staining of tumors for CD31. Frozen sections of day 60 s.c. tumors formed in nude mice were stained with antibody to CD31/platelet/endothelial cell adhesion molecule 1 (1:800) A, tumors formed by SB2-vector control cells. B, tumors formed by SB2-flot–2-EGFP cells (100x magnification). C, Graph of average number of vessels per 100 x tumor calculated from digitized images and Scion program. SB2-flot–2 cell tumors had significantly more microvessel density than tumors from SB2-vector control cells (Student’s t test, P < 0.01). D and E. SB2-flot–2 cells plated on Matrigel show increased tube formation. D. Tube formation by living parental SB2 cells, vector transfected controls, versus two clones of flot-2 transfected SB2 cells was observed at 24 hours by light microscopy (100x magnification). Cells were plated in triplicate at 20,000 cells per well on Matrigel-coated wells. Images were captured by Optronics TEC-470 camera and digitized with Optimas imaging software (Silver Spring, MD). E. Number of tubes were counted in triplicate wells at low-power fields (magnification 40x) and expressed as percentage cell elongation (Y-axis) resulting in tube formation. SB2-flot–2 clones had significantly higher tube formation than either SB2 parental or SB2 vector (Student’s t test, P < 0.001). F. Cell proliferation in serum-free media is higher in SB2-flot–2 cells. SB2-vector versus SB2-flot–2 cells were plated in triplicate at 2 x 105 cells on 24-well plates and grown in media with or without serum for 48 hours. Cells were trypsinized and counted by trypan blue exclusion. In serum-free media, proliferation of SB2-flot–2 cells was higher than controls (data are express as triplicates; bars, ±SD; P = 0.001).

 
SB2-Flot–2 Cell Proliferation Is Higher in Serum-free Media.
To determine whether flot-2 transformation promotes cell proliferation, we compared one SB2-flot–2 line to the control cells. Although proliferation was similar in the presence of 10% fetal bovine serum, in the absence of serum, SB2-flot–2 cells proliferated significantly faster than control SB2 cells (P = 0.001; Fig. 4FCitation ). Although metastatic melanomas acquire invasive properties mediated through induction of metalloproteases-2, no difference in metalloproteases-2 was seen in SB2-flot–2 cells by zymography (data not shown).

Overexpression of Flot-2 in SB2 Cells Is Associated with Increased Expression of the Thrombin Receptor, PAR-1.
To study whether flot-2 transformation of SB2 cells induced the expression of any new genes, we compared the differential mRNA expression to that of SB2-V cells with an oligonucleotide DNA cancer pathway microarray (45) . PAR-1, the thrombin receptor, was the only gene initially found to be up-regulated by >2-fold in flot-2–transfected SB2 cells (data not shown). Western blotting (Fig. 5, A and B)Citation and quantitative reverse transcriptase-PCR (Fig. 5C)Citation measurements also confirmed increase in PAR-1 protein and mRNA expression in SB2-flot–2 cells compared with SB2-V control cells. PAR-1 protein expression was at least 2-fold higher in SB2-flot–2 lines than parental or vector-control cells, whereas PAR-1 mRNA levels were increased by 3-fold. As shown in Fig. 1CCitation , PAR-1 levels were higher in SB2-flot–2-transfected cells and aggressive melanoma lines, with the exception of WM793, compared with low tumorigenic lines.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Flot-2 modulates the level of PAR-1 expression, and Matrigel invasion is enhanced by thrombin in SB2-flot–2 cells. A–C. PAR-1 expression is increased by the overexpression of flot-2 in SB2 cells. A, Western blot. SB2 vector (Lane 1), SB2-flot–2 clone 1 (Lane 2), and SB2-flot–2 clone 2 (Lane 3). Cell lysates (10 µg/lane) were electrophoresed on 10% SDS-PAGE and immunoblotted with antibody to PAR-1 (WEDE15; 1:1,000) and to actin (1:2,000). Signals were detected with horseradish peroxidase-conjugated goat antimouse IgG at 1:5,000 and ECL-S (Amersham). B. densitometry ratio of PAR-1 to actin protein signal. PAR-1 and actin bands were measured by {alpha}-ease image analysis densitometry software. Ratios represent percent density of PAR-1 to actin. C. quantitative reverse transcriptase-PCR of PAR-1 mRNA from melanoma cell lines. Total RNA (1 µg) extracted with RNA easy kit from parental SB2 or SB2-flot–2 cells was reverse transcribed, amplified, and detected by a third fluorogenic primer in triplicate samples with ABI 7000 TaqMan system. D and E. Small-interfering RNAs to flot-2 decrease both flot-2 and PAR-1 mRNA levels. SB2-flot–2 cells were treated with either flot-2 small-interfering RNA SMARTpool or nonspecific control small-interfering RNAs at 100 pmol (Dharmacon) in 2 µL LipofectAMINE-2000 for 6 hours at 37°C. After growth in antibiotic-free DMEM for 48 hours, RNA was isolated with RNeasy Mini Kit (Qiagen). Quantitative reverse transcriptase-PCR measurements of flot-2 mRNA (E) and PAR-1 mRNA (F) were normalized to 36B4. Data are expressed as triplicate wells, and control small-interfering RNA treated cells are assigned as 100%. Student’s t test was used to compare each condition. F. Flot-2 and PAR-1 are coimmunoprecipitated from SB2-flot–2 cells. SB2-flot–2 cell lysates (800 µg) were precleared with Protein A/G plus Agarose, incubated with PAR-1 antibody (3 µg) or with mouse IgG at 4°C overnight, and captured by Protein A/G plus Agarose at 4°C overnight. After SDS-PAGE and Western blotting, immunoprecipitated proteins were detected with flot-2 antibody (1:5,000) followed by ECL-S. G. Matrigel invasion is higher in SB2-flot–2 cells and additionally enhanced by thrombin activation. SB2 parental and SB2-flot–2 cells grown in serum-free medium for 24 hours were left untreated or were activated by 1 unit/ml thrombin (Sigma) for 1 hour. Cells were trypsinized, resuspended in serum-free medium, and plated at 2 x 105 cells on triplicate Matrigel-coated inserts (44) . After 2 hours, cells from five separate fields on lower surface of the membrane were counted and plotted as the average number of cells migrating through filters. SB2-flot–2 cells showed significantly higher invasion after thrombin activation (P = 0.002). Bars, ±SD.

 
Small-interfering RNAs for Flot-2 Decrease Expression of Both Flotillin-2 and PAR-1.
To additionally study the relationship between flot-2 and PAR-1 expression, we used a cocktail of four small-interfering RNAs against flot-2 compared with control small-interfering RNAs to transiently transfect SB2-flot–2 cells in triplicate. After 48 hours, mRNAs were extracted and flot-2 and PAR-1 mRNA signals were measured by quantitative reverse transcriptase-PCR. Flot-2 small-interfering RNA treatment was associated not only with significantly decreased expression of flot-2 mRNA (P = 0.044) but also of PAR-1 mRNA levels (P = 0.022; Fig. 5, D and ECitation ).

Flot-2 Is Coimmunoprecipitated with PAR-1 in SB2-Flot–2 Cells.
Immunoprecipitation of SB2-flot–2 cell extracts with antibodies to flot-2 (data not shown) and to PAR-1 coprecipitated both proteins, as detected by Western blotting (Fig. 5F)Citation . A physical association between flot-2 and PAR-1 proteins is therefore likely within SB2-flot–2 cells.

Matrigel Invasion Is Higher in SB2-Flot–2 Cells and Additionally Enhanced by Thrombin Activation.
Because PAR-1 activation can enhance cell migration, and this property is important for tumor cell metastasis, we next studied SB2-flot–2 cells versus control cells plated on Matrigel-coated filters. The SB2-flot–2 cells had significantly higher migration detected at 2 hours, compared with the control SB2 cells (Fig. 5GCitation ; P = 0.007), and was significantly enhanced by pretreatment with 1 unit/ml thrombin for one hour before plating (P = 0.002). There was no significant difference in migration of SB2 cells after treatment with thrombin.


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We demonstrate for the first time that overexpression of flotillin-2, a novel and highly conserved caveolae/lipid raft-associated protein, alters the phenotype of SB2 melanoma cells and is associated with up-regulation of the G-protein-coupled receptor for thrombin, PAR-1. Although flot-2 is also expressed in normal melanocytes (15) , these data suggest that the levels of flot-2 increase with melanoma progression in cell lines and in melanocytic lesions. The A375 lines showed increased flot-2 expression in the more metastatic derivative. To test the hypothesis that overexpression of flot-2 facilitates melanoma tumors and metastases, we established and characterized two independently derived SB2-flot–2 cell lines in the mouse model and showed significantly increased tumorigenicity and metastases.

We do not attribute the findings to clonal differences among SB2 cells, as the SB2 line has been well characterized as a very low tumorigenic line (34 , 37) . On the basis of our data, it may not be a coincidence that overexpression of PAR-1 also transforms SB2 cells to become highly tumorigenic and metastatic (34) . SB2-flot–2 cells also acquired properties of increased cell invasion enhanced by thrombin, increased proliferation in absence of serum, as well as increased angiogenesis. These properties are considered critical for melanoma progression and formation of metastases.

Differential gene expression by microarray first suggested that SB2-flot–2-transfected lines also overexpressed the thrombin receptor, PAR-1. Two methods confirmed higher PAR-1 in SB2-flot–2 cell lines. In addition, a correlation between high flot-2 and high PAR-1 protein levels and more aggressive cell lines was suggested by quantitative Western blotting analysis. Flot-2 overexpression in SB2 cells was found to be associated with a 2- to 3-fold increase in PAR-1 protein and mRNA, respectively. This increased level of PAR-1 expression should be sufficient to transform SB2 cells alone.

Although PAR-1 transfection has also been shown to induce malignant transformation in SB2 melanoma cells (34) , PAR-1 has not previously been linked to flot-2. Thrombin treatment enhanced invasion of SB2-flot–2 cells so that activation of the PAR-1 receptor by thrombin appears to be synergistic with overexpression of flot-2 in SB2 melanoma cells. Furthermore, flot-2 and PAR-1 were immunoprecipitated from SB2-flot–2 cells, suggesting physical interactions. Not only was flot-2 overexpression associated with increased PAR-1 expression, but surprisingly small-interfering RNA to flot-2 also was associated with a significant decrease in PAR-1 mRNA. One vertical growth phase melanoma, WM793, that is nonmetastatic but highly tumorigenic, expressed low flot-2 but had high flot-2 mRNA and highest PAR-1 protein. It is possible that flot-2 mRNA and PAR-1 mRNA expression are coordinately regulated.

Thrombin has a multitude of actions, many of which relate to its ability to activate the PAR-1 (31) . If flot-2 transformation is mediated through PAR-1 interaction, this would be a key discovery in understanding PAR-1–mediated signal transduction. PAR-1 interacts with several signal transduction pathways including MAPK with Rho-GTPase intermediates (8 , 31 , 47 , 48) . Constitutive activation of MAPK through mutations in the kinase b-raf and phosphorylation of ERK1/2 was previously implicated in melanoma progression (2 , 8) .

When thrombin cleaves the NH2-terminal extra-cellular tail of PAR-1, a tethered ligand activates the receptor, distinguishing it from growth factor receptors activated by extracellular ligands (31) . PAR-1 must then be inactivated, and this is thought to occur through phosphorylation or modification of key sequences at the cytoplasmic COOH terminus (ref. 48 ; Fig. 6Citation ). PAR-1 can also be recycled through cell trafficking pathways that are not fully elucidated (48) . Because the ability to transform SB2 cells has been shown to involve the cytoplasmic carboxyl tail of PAR-1 (34) , it is possible that flot-2 binds to this region of the receptor with functional consequences. Unlike PAR-1, flot-2 contains no transmembrane domain but interacts with the lipid membrane through myristoylation and palmitylation (21) . Flot-2, attached to the inner membrane in lipid domains or caveolae, should be in a position to interact with the cytoplasmic COOH-terminal domain of PAR-1 that is critical for SB2-PAR–1-induced transformation. Flot-2 binding might stabilize PAR-1 by blocking inactivation or degradation of an activated PAR-1 receptor. Cytoplasmic flot-2 might also modulate PAR-1 trafficking within the cell or stabilize PAR-1 mRNA. Any of these activities by flot-2 might promote PAR-1-induced constitutive signaling through MAPK or other signal transduction pathways.



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Schematic of hypothetical interaction between flot-2 and PAR-1. PAR-1 is a transmembrane G-protein-coupled receptor activated by thrombin at the extracelluar NH2 terminus. The cytoplasmic COOH domain contains sequences implicated in degradation and in transformation. Both flot-2 and Ras are attached to the membrane through modifications. PAR-1 can signal through Rho-Ras family of GTPases, activating the mitogen-activated protein kinase pathway. The intermediate b-Raf kinase is commonly mutated in melanomas. PAR-1 can also signal through other pathways including tyrosine kinases (focal adhesion kinase) and IP3.

 
PAR-1 induces phosphorylation of focal adhesion kinase and integrin expression in SB2 cells (34) . Focal adhesion kinase is a tyrosine kinase that also modulates cytoskeletal reorganization. Previous studies have shown that flot-2 and its homologue Reggie 1 alter cell morphology and induce filopodia formation after transfection (17 , 21) . Changes in cell shape result from changes in actin stress fibers and focal adhesions and are mediated through the Rho family of GTPases (27) . Rho-Ras proteins are found downstream to PAR-1 as intermediates of the ERK1/2 MAPK pathway (26 , 49) implicated in melanoma progression (8 , 50) .

The transforming and angiogenic properties of PAR-1 are thought to be mediated through MAPK signaling (32 , 33 , 47) . The transcription factor AP2 decreases with melanoma progression and negatively regulates PAR-1, increasing interleukin-8 and vascular endothelial growth factor levels (30 , 35) . SB2-flot–2 melanoma cells like SB2-PAR–1 transfected cells displayed enhanced angiogenic properties, including increased microvessel density and vasculogenic mimicry, that have been associated with aggressive melanomas and expression of VE-cadherin (46) . SB2-flot–2 cells were more invasive than control SB2 cells, and their ability to invade Matrigel membranes was enhanced by thrombin. This additionally supports a functional cooperation between PAR-1 and flot-2 overexpression in melanoma that may relate to increased angiogenic properties of the transformed cells (Fig. 6)Citation .

In conclusion, these data suggest the existence of an important and novel relationship between the highly conserved, lipid raft/caveolae associated protein flot-2 and the G-protein coupled receptor, thrombin receptor, PAR-1. PAR-1 is upstream to the b-raf- MAPK-ERK pathway implicated in melanoma progression (8) . Why overexpression of either flot-2 or PAR-1 can transform SB2 cells and how flot-2 overexpression regulates PAR-1 transcription are not yet known. Others have reported that transforming and regulatory sequences of PAR-1 reside in the COOH-terminal cytoplasmic domain (48) . As shown in Fig. 6Citation , flot-2 is well positioned to interact with the cytoplasmic tail of PAR-1, which could stabilize and prevent degradation of the activated-PAR-1 molecule. We would also expect that flot-2 may influence other G-protein coupled receptor, so that modulation of PAR-1 by flot-2 may have significance for signal transduction beyond one specific tumor model. Additional studies are underway to elucidate the relationship between flot-2 and PAR-1 and to determine the general significance to cancer biology as well as to melanoma.


   FOOTNOTES
 
Grant support: Dermatology Foundation Research Grant (P. Hazarika), Advanced Research Program ARP, Texas Higher Education Board (M. Duvic and P. Hazarika), and CA-16672 and CA086814-K24 (M. Duvic). NCI, National Cancer Institute.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Menashe Bar-Eli and Madeleine Duvic are senior coauthors.

Requests for reprints: Madeleine Duvic, Department of Dermatology, Box 434, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030. Phone: (713)745-3597; Fax: (713) 745-1115; E-mail: mduvic{at}mdanderson.org

Received 3/ 6/04. Revised 7/ 1/04. Accepted 8/19/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Balch CM, Soong SJ, Gershenwald JE, et al Prognostic factors analysis of 17,600 melanoma patients: validation of the American Joint Committee on Cancer melanoma staging system. J Clin Oncol 2001;19:3622-34.[Abstract/Free Full Text]
  2. Davies H, Bignell GR, Cox C, et al Mutations of the BRAF gene in human cancer. Nature (Lond) 2002;417:949-54.[CrossRef][Medline]
  3. Wei Q, Lee JE, Gershenwald JE, et al Repair of UV light-induced DNA damage and risk of cutaneous malignant melanoma. J Natl Cancer Inst (Bethesda) 2003;95:308-15.[Abstract/Free Full Text]
  4. Halaban R Melanoma cell autonomous growth: the Rb/E2F pathway. Cancer Metastasis Rev 1999;18:333-43.[CrossRef][Medline]
  5. Huang S, Jean D, Luca M, Tainsky MA, Bar-Eli M Loss of AP-2 results in downregulation of c-KIT and enhancement of melanoma tumorigenicity and metastasis. EMBO 1998;17:4358-69.[CrossRef][Medline]
  6. Johnson JP Cell adhesion molecules in the development and progression of malignant melanoma. Cancer Metastasis Rev 2000;18:345-57.
  7. Hendrix MJ, Seftor EA, Melzer PS, et al Expression and functional significance of VE-cadherin in aggressive human melanoma cells: role in vasculogenic mimicry. Proc Natl Acad Sci USA 2001;98:8018-23.[Abstract/Free Full Text]
  8. Satyamoorthy K, Li G, Gerrero MR, et al Constitutive mitogen activated protein kinase activation in melanoma is mediated by both BRAF mutations and autocrine growth factor stimulation. Cancer Res 2003;63:756-9.[Abstract/Free Full Text]
  9. Smalley KS A pivotal role for ERK in the oncogenic behaviour of malignant melanoma. Int J Cancer 2003;104:527-32.[CrossRef][Medline]
  10. Carver LA, Schnitzer JE, Anderson RG, Mohla S Role of caveolae and lipid rafts in cancer: workshop summary and future needs. Cancer Res 2003;63:6571-4.[Free Full Text]
  11. Guan JL Integrins, Rafts, Rac, and Rho. Science (Wash DC) 2004;303:773-4.[Abstract/Free Full Text]
  12. Bickel PE, Scherer PE, Schnitzer JE, et al Flotillin and epidermal surface antigen define a new family of caveolae-associated integral membrane proteins. J Biol Chem 1997;272:13793-802.[Abstract/Free Full Text]
  13. Volonte D, Galbiati F, Li S, et al Flotillins/cavatellins are differentially expressed in cells and tissues and form a hetero-oligomeric complex with caveolin n vivo. J Biol Chem 1999;274:12702-9.[Abstract/Free Full Text]
  14. Engleman JA, Zhang X, Galbiati F, et al Molecular genetics of the caveolin gene family: implications for human cancers, diabetes, Alzheimer disease and muscular dystrophy. Am J Hum Genet 1998;63:1578-87.[CrossRef][Medline]
  15. Schroeder WT, Stewart-Galetka S, Mandavilli S, et al Cloning and characterization of a novel epidermal cell surface antigen (ESA). J Biol Chem 1994;269:19983-91.[Abstract/Free Full Text]
  16. Cho YJ, Chema D, Moskow JJ, et al Epidermal surface antigen (MS17S1) cDNA and chromosomal localization is highly conserved between mouse and human and is not altered in the nude mouse. Genomics 1995;27:251-8.[CrossRef][Medline]
  17. Hazarika P, Dham N, Patel P, et al Flotillin 2 is distinct from epidermal surface antigen (ESA) and is associated with filopodia formation. J Cell Biochem 1999;75:147-59.[CrossRef][Medline]
  18. Stuermer CA, Lang DM, Kirsch F, et al Glycosylphosphatidyl inositol-anchored proteins and fyn kinase assemble in noncaveolar plasma membrane microdomains defined by reggie-1 and -2. Mol Biol Cell 2001;12:3031-45.[Abstract/Free Full Text]
  19. Schulte T, Paschke KA, Leassing U, Lottspeich F, Stuermer CA Reggie-1 and reggie-2, two cell surface proteins expressed by retinal ganglion cells during axon regeneration. Development (Camb) 1997;124:577-87.[Abstract]
  20. Solomon S, Masilamani M, Rajendran L, et al The lipid raft microdomain-associated protein reggie-1/flotillin-2 is expressed in human B cells and localized at the plasma membrane and centrosome in PBMCs. Immunobiology 2002;205:108-19.[CrossRef][Medline]
  21. Neumann-Giesen C, Falkenbach B, Beicht P, et al Membrane and raft association of reggie-1/flotillin-2: role of myristoylation, palmitoylation and oligomerization and induction of filopodia by overexpression. Biochem J 2004;378:509-518.[CrossRef][Medline]
  22. Satyamoorhty K Insulin-like growth factor-1 induces survival and growth of biologically early melanoma cells through both the mitogen-activated protein kinase pathway and beta-catenin. Cancer Res 2001;61:7318-23.[Abstract/Free Full Text]
  23. Fidler IJ Angiogenesis and melanoma metastasis. The Melanoma Letter 1998;16:1-4.
  24. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM Expression profiling using cDNA microarrays. Nat Genet 1999;21:10-4.[CrossRef][Medline]
  25. Clark E, Golub TR, Lander ES, Hynes RO Genomic analysis of metastasis reveals an essential role for RhoC. Nature (Lond) 2000;406:532-5.[CrossRef][Medline]
  26. Hall A Rho GTPases and the actin skeleton. Science (Wash DC) 1998;279:509-13.[Abstract/Free Full Text]
  27. Vial E, Sahai E, Marshall CJ ERK-MAPK signaling coordinately regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell 2003;4:67-79.[CrossRef][Medline]
  28. Nierodzik ML, Chen K, Takeshita K, et al Protease-activated receptor 1 (PAR-1) is required and rate-limiting for thrombin-enhanced experimental pulmonary metastasis. Blood 1998;92:3694-700.[Abstract/Free Full Text]
  29. Even-Ram S, Uziely B, Cohen P, et al Thrombin receptor overexpression in malignant and physiological invasion processes. Nat Med 1998;4:909-14.[CrossRef][Medline]
  30. Tellez C, Bar-Eli M Role and regulation of the thrombin receptor (PAR-1) in human melanoma. Oncogene 2003;22:3130-7.[CrossRef][Medline]
  31. Grand RJA, Turnell AS, Grabham PW Cellular consequences of thrombin-receptor activation. Biochem J 1996;313:353-68.
  32. Martin CB, Mahon GM, Klinger MB, et al The thrombin receptor, PAR-1, causes transformation by activation of Rho-mediated signaling pathways. Oncogene 2001;20:1953-63.[CrossRef][Medline]
  33. Nguyen QD, Faivre S, Bruyneel E, et al Rho-A and Rho-dependent regulatory switch of Ga subunit signaling by PAR-1 receptors in cellular invasion. FASEB J 2002;16:565-76.[Abstract/Free Full Text]
  34. Even-Ram S, Maoz M, Pokaroy E, et al Tumor cell invasion is promoted by activation of protease activated receptor-1 in cooperation with the avb5 integrin. J Biol Chem 2001;276:10952-62.[Abstract/Free Full Text]
  35. Tellez C, McCarty M, Ruiz M, Bar-Eli M Loss of activator protein-2 alpha results in overexpression of protease-activated receptor-1 and correlates with the malignant phenotype of human melanoma. J Biol Chem 2003;279:46632-42.
  36. Xie S, Luca M, Huang S, et al Expression of MCAM/MUC18 by human melanoma cells leads to increased tumor growth and metastasis. Cancer Res 1997;57:2295-303.[Abstract/Free Full Text]
  37. Zhang RD, Price JE, Schackert G, Itoh K, Fidler IJ Malignant potential of cells isolated from lymph node or brain metastases of melanoma patients and implications for prognosis. Cancer Res 1991;51:2029-35.[Abstract/Free Full Text]
  38. Ge K, DuHadaway J, Du W, et al Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. Proc Natl Acad Sci USA 1999;96:9689-94.[Abstract/Free Full Text]
  39. Hamilton JR, Frauman AG, Cock TM Increased expression of protease-activated receptor-2 (PAR2) and PAR4 in human coronary artery by inflammatory stimuli unveils endothelium-dependent relaxations to PAR2 and PAR4 agonists. Circ Res 2001;89:92-8.[Abstract/Free Full Text]
  40. Duvic M, Helekar B, Schulz C, et al Expression of a retinoid-inducible tumor suppressor, tazarotene-inducible gene-3, is decreased in psoriasis and skin cancer. Clin Cancer Res 2000;6:3249-59.[Abstract/Free Full Text]
  41. Shen SS, Zhang PS, Eton O, Prieto VG Analysis of protein tyrosine kinase expression in melanocytic lesions by tissue array. J Cutan Pathol 2003;30:539-47.[CrossRef][Medline]
  42. Huang S, Mills L, Mian B, et al Fully humanized neutralizing antibodies to interleukin-8 (ABX-IL8) inhibit angiogenesis, tumor growth, and metastasis of human melanoma. Am J Pathol 2002;161:125-34.[Abstract/Free Full Text]
  43. Troyanovsky B, Bevchenko T, Mansson G, Matvijenko O, Homgren L Angiomotin: an angiostatin binding protein that regulates endothelial cell migration and tube formation. J Cell Biol 2001;152:1247-54.[Abstract/Free Full Text]
  44. Koul D, Parthasarathy R, Shen R, et al Suppression of matrix metalloproteinase-2 gene expression and invasion in human glioma cells by MMAC/PTEN. Oncongene 2001;20:6669-78.
  45. Hu L, Wang J, Baggerly K, et al Obtaining reliable information from minute amounts of RNA using cDNA microarrays. BMC Genomics 2002;3:16[CrossRef][Medline]
  46. Hendrix MJ, Seftor EA, Seftor REB, et al Biological determinants of uveal melanoma metastatic phenotype: role of intermediate filaments as predictive markers. Lab Investig 1998;78:153-63.[Medline]
  47. Yin YJ, Salah Z, Maoz M, et al Oncogenic transformation induces tumor angiogenesis: a role for PAR1 activation. FASEB J 2003;17:163-74.[Abstract/Free Full Text]
  48. Shapiro MJ, Coughlin SR Separate signals for agonist-independent and agonist-triggered trafficking of protease-activated receptor 1. J Biol Chem 1998;273:29009-14.[Abstract/Free Full Text]
  49. Ridley AJ, Hall A The small GTP-binding protein Rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 1992;70:389-99.[CrossRef][Medline]
  50. Conner SR, Scott G, Aplin AE Adhesion dependent activation of the ERK1/2 cascade is by-passed in melanoma cells. J Biol Chem 2003;278:34548-54.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
C. Neumann-Giesen, I. Fernow, M. Amaddii, and R. Tikkanen
Role of EGF-induced tyrosine phosphorylation of reggie-1/flotillin-2 in cell spreading and signaling to the actin cytoskeleton
J. Cell Sci., February 1, 2007; 120(3): 395 - 406.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
N. Nguyen, A. Kuliopulos, R. A. Graham, and L. Covic
Tumor-Derived Cyr61(CCN1) Promotes Stromal Matrix Metalloproteinase-1 Production and Protease-Activated Receptor 1-Dependent Migration of Breast Cancer Cells.
Cancer Res., March 1, 2006; 66(5): 2658 - 2665.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar