Cancer Research Targets  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, T.
Right arrow Articles by Yeatman, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, T.
Right arrow Articles by Yeatman, T. J.
[Cancer Research 64, 7412-7419, October 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Clusterin-Mediated Apoptosis Is Regulated by Adenomatous Polyposis Coli and Is p21 Dependent but p53 Independent

Tingan Chen1, Joel Turner1, Susan McCarthy1, Maurizio Scaltriti2, Saverio Bettuzzi2 and Timothy J. Yeatman1

1 Department of Interdisciplinary Oncology, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida; and 2 Dipartimento di Medicina Sperimentale, Sezione di Biochimica, Biochimica Clinica e Biochimica dell’Esercizio Fisico, Parma, Italy


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clusterin is a widely expressed glycoprotein that has been paradoxically observed to have both pro- and antiapoptotic functions. Recent reports suggest this apparent dichotomy of function may be related to two different isoforms, one secreted and cytoplasmic, the other nuclear. To clarify the functional role of clusterin in regulating apoptosis, we examined its expression in human colon cancer tissues and in human colon cancer cell lines. We additionally explored its expression and activity using models of adenomatous polyposis coli (APC)- and chemotherapy-induced apoptosis. Clusterin RNA and protein levels were decreased in colon cancer tissues largely devoid of wild-type APC when compared with matched normal tissue controls, suggesting a means for invasive cancers to avoid apoptosis. Conversely, induction of apoptosis by expression of wild-type APC or by treatment with chemotherapy led to increased clusterin RNA and protein levels localizing to apoptotic nuclei. We found that transient transfection of clusterin to colon cancer cell lines directly enhanced basal and chemotherapy-induced apoptosis. Clusterin-induced apoptosis was inhibited by antisense clusterin and was found to be highly dependent on p21 but not p53 expression, yet a deficit in p21 can be subverted by clusterin transfection. Collectively, these data support the hypothesis that nuclear clusterin function is proapoptotic when induced by APC or chemotherapy in the context of p21 expression. Absent of p21, clusterin in not induced, and apoptosis is significantly inhibited. These data support a potential therapeutic role for clusterin in enhancing chemotherapy-induced apoptosis and in promoting apoptosis in cells deficient in p21.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clusterin is a widely expressed glycoprotein whose function remains somewhat enigmatic. Also known as apolipoprotein J, clusterin was initially characterized as an apoptosis-associated transcript after it was identified as testosterone-repressed prostate message 2 (1) and sulfated glycoprotein 2 (2) that is overexpressed in the epithelial cells of the regressing rat ventral prostate (3) . Increases in clusterin mRNA and protein levels have since been consistently detected in apoptotic heart, brain, lung, liver, kidney, pancreas, and retinal tissue both in vivo and in vitro (1 , 4, 5, 6, 7, 8, 9, 10, 11) Moreover, clusterin-knockout mice show reductions of cell death in hypoxia-ischemia–induced brain damage (12, 13, 14) . Clusterin function, however, has also been reported to be antiapoptotic and has been found to be overexpressed in progressing breast carcinomas, where its expression correlated inversely with the apoptotic index. Similarly, clusterin-knockout mice show an increase in autoimmune myocardial damage, suggesting an antiapoptotic function.

Recent studies have shed some light on the dichotomous functions of clusterin, suggesting pro- and antiapoptotic functions may be related to nuclear and secreted isoforms, respectively, and that the function of clusterin may be context dependent. Overexpression of the secreted form of clusterin in human cancer cells caused drug resistance and protection against certain cytotoxic agents that induce apoptosis (15) . Additional data suggest that a secreted form of clusterin acts as a molecular chaperone, scavenging denatured proteins outside cells following specific stress-induced injury such as heat shock. Other data, show that overexpression of a specific nuclear form of clusterin acts as a prodeath signal (16) . Furthermore, studies of human colon cancer suggest a conversion from the nuclear form of clusterin to the cytoplasmic form, which may promote tumor progression (17) . Recently, a link between the accumulation of the nuclear form of clusterin and anoikis induction in prostate epithelial cells was shown (18) .

To better elucidate the functional role of clusterin, we examined its expression and localization in a panel of normal and neoplastic human colon cancer tissues, as well as a panel of human colon cancer cell lines. We then evaluated the effect of APC expression and chemotherapy, both known to induce apoptosis, on clusterin expression and associated apoptotic events. The effect of clusterin transfection, or alternatively, antisense clusterin transfection, on basal and chemotherapy-induced apoptosis was investigated. Because both p21 and p53 have been lined to regulation of apoptotic events, clusterin expression and induction of apoptosis was evaluated in the context of their expression using targeted knockout cell line models.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human Tissues.
Snap-frozen human colon cancers (Dukes’ stage C) and their cognate normal mucosal controls were obtained from the Moffitt Cancer Center tissue bank in a de-identified fashion with an Institution Review Board-approved protocol. Tissues were microdissected for purity and then exposed to cellular lysis buffers and Trizol for RNA extraction.

Cell Lines.
Four different human colon cancer cell lines were obtained from the American Type Culture Collection (HT29, KM12C, HCT116, and SW620), and two targeted knockout cell lines were a kind gift of Dr. B. Vogelstein (HCT116p21–/– and HCT116p53–/–). The HT29 cell line devoid of APC but engineered with a zinc-inducible wild-type APC vector (HT29APC) was also a gift of Dr. Bert Vogelstein. HT29, KM12C, HCT116, and SW620 cells were cultured in RPMI medium with 10% fetal bovine serum. HT29APC, HCT116p21–/–, HCT116p53–/–, and their parental cells were cultured in McCoy’s 5A medium with 10% fetal bovine serum. Cells were treated with Zn2+ (120 µmol/L) 4, 8, and 16 hours or with 5-flurouracil (5-FU; 5 µmol/L) and anti-Fas antibody (50 ng/mL) or with irinotecan (6 µmol/L) 24, 48, and 72 hours to induce apoptosis.

Transient Transfection of Clusterin.
The plasmids p4 empty vector and p4/SGP2 (containing human clusterin full-length cDNA) were obtained from Dr. Saverio Bettuzzi (Parma, Italy). Transient transfection of p4 empty vector (as a mock) or p4/SGP2 were performed using FuGENE 6 Transfection Reagent (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer’s protocol. After transfection with mock or clusterin 24 to 48 hours, cells were either harvested or treated by apoptotic stimuli for 48 hours, then harvested to detect clusterin protein expression by Western blotting or to perform apoptosis assays. Each transfection experiment was done in triplicate. Data are presented as a mean ± SE.

Western Blot Analyses.
Cells were harvested in protein lysis buffer [20 mmol/L Tris-HCl (pH 7.6), 150 mmol/L NaCl, 1 mmol/L EDTA, 0.5% NP40, 1 mmol/L DTT, 5 µmol/L trichostatin A, 1 mmol/L sodium orthovanadate, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L NaF, and complete protease inhibitors (Roche Applied Science, Indianapolis, IN)], and Western blotting was performed as described previously (19) . All blots were performed in triplicate. Representative examples are shown in the figures. Antibodies used include clusterin (Alexis, San Diego, CA) and p53 and p21 (BD Biosciences, San Jose, CA).

Antisense Clusterin Oligonucleotide Transfection.
Preattached ~1 x 105 HT29, HCT11,6 and HT29APC cells in 100-mm culture dishes, respectively, for overnight. They were transfected with antisense clusterin oligonucleotides or mismatch clusterin oligonucleotides, respectively. Phosphorothioate oligonucleotides used in this study were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). The sequence of the clusterin antisense clusterin oligonucleotide used corresponded to the human clusterin translation initiation site (5'-CAGCAGCAGAGTCTTCATCAT-3'). A 2-base clusterin mismatch oligonucleotide (5'-CAGCAGCAGAGTATTTATCAT-3') was used as control. Transfections were performed using the Lipofectamine Plus reagent (Invitrogen, Carlsbad, CA). Cells were treated with either 500 and 1000 nmol/L antisense or mismatch clusterin oligonucleotides after preincubation for 20 minutes with 10 µg/mL lipofectin in serum-free OPTI-MEM (Life Technologies, Inc., Carlsbad, CA). Four hours after the beginning of the incubation, for HT29 and HCT116 cells, the medium containing oligonucleotides and lipofectin was replaced with standard culture medium plus 5-FU (5 µmol/L) and Fas (50 ng/mL) once daily for 3 days. For HT29APC cells, the medium was replaced with standard culture medium plus Zn2+ (120 µmol/L) for 16 hours. Cells were harvested to detect clusterin protein expression by Western blotting or to perform apoptosis assays. Each transfection experiment was done in triplicate and repeated at least three times. Data are presented as a mean ± SE.

cDNA Synthesis and Real-time PCR.
To measure clusterin mRNA expression, RNA was isolated from snap-frozen human colon cancers (Dukes’ stage C), and their cognate normal mucosal controls or colon cancer cells treated with different reagents by using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. A quantitative primer/probe set was designed to evaluate and to quantitate clusterin mRNA. Reverse transcription of RNA was performed using 15 units of Omniscript reverse transcriptase (Qiagen, Valencia, CA), 1x cDNA synthesis buffer, 40 units of RNase inhibitor (Life Technologies, Inc.), 5 mmol/L DTT, 1 mmol/L deoxynucleoside triphosphate mixture, 0.5 µg of Oligo(dt) primer, and 2 µg of RNA. Primers and probes for real-time PCR were designed using Primer Express software (Applied Biosystems, Inc., Foster City, CA). Each primer set consisted of standard PCR primers (temperature 58° to 60°C) designed to span gene exons to exclude any possible genomic DNA contamination. Detection and quantitation of each gene was accomplished using an amplicon-specific fluorescent oligonucleotide probe (temperature 68°C to 70°C), with a 5'-reporter dye (carboxyfluorescein) and a downstream 3'-quencher dye (6-carboxytetramethylrhodamine). The primers used for detection of clusterin had the following sequences, 5'-CTATCTGCGGGTCACCAC-3' (forward primer), 5'-CACAGTGACACCGGAAGGAAC-3' (reverse primer), and 5'-FAM/TGGCTTCCCACACTTCTGACTCGG A/TAMRA-3' (probe). During PCR, the 5'-3' nuclease activity of TaqDNA polymerase releases the reporter, whose fluorescent signal is then detected by the GeneAmp 5700 Sequence Detector System (ABI, Foster City, CA). The PCR reaction was performed in a 96-well optical reaction plate with optical caps. The reaction mixture consisted of 0.2 µmol/L each primer, 0.1 µmol/L fluorescent probe, 5 units of AmpliTaq Gold (ABI), 200 µmol/L each dATP, dCTP, and dGTP, 400 µmol/L dUTP, 5.5 mmol/L MgCl2, 8% glycerol, 1 unit of AmpErase uracil N-glycosylase and 1x TaqMan Buffer A. Amplification profile was as follows: 50°C for 2 minutes (for uracil N-glycosylase digest of contaminating PCR amplicons), 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, and 60°C for 1 minute, 2 µL of cDNA were assayed per well. Standards used for quantitation were plasmid vector DNA containing the primer-specific coding region for clusterin. Standard values were 106, 105, 104, 103, 102, and 10 DNA molecules per well. Two assays were performed on each cDNA sample, clusterin, and 3-histone H3.3 as a housekeeping gene to normalize mRNA values. Quantitative PCR was performed in an ABI 5700 sequence detection system.

Apoptosis Assays.
To determine apoptotic fractions, cells were harvested at different time point after treatment by apoptotic stimuli. Cells were then analyzed by using the Annexin V-phycoerythrin plus 7-amino-actinomycin D (BD Biosciences) apoptosis detection kit according to the manufacturer’s protocol. The DNA damage experiments were done in triplicate for each cell line. Apoptotic fractions were determined by flow cytometry. Apoptosis was confirmed by terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) staining with the In Situ Cell Death Detection Kit (TMR red; Roche Applied Science) according to the manufacturer’s protocol and immunoblotting with human clusterin antibodies (Alexis).

Immunocytofluorescence and TUNEL Assay.
Preattached ~1 x 104 cells/well were exposed to treatment conditions as planned (some cells were treated 48 hours by apoptotic stimuli, some cells were transiently transfected with clusterin 24 hours, and then treated another 48 hours with apoptotic stimuli). Cells were fixed with acetone-methanol (1:1; Sigma, St. Louis, MO) for 3 minutes, then were blocked with PBS +10% normal goat serum for 20 minutes. Cells were incubated with clusterin antibody (1:200; Alexis) in PBS +10% normal goat serum for 2 hours, then the slides were washed with PBS +0.1%Triton X-100 three times and were incubated with FITC (1:100; Vector Laboratories, Inc., Burlingame, CA) in PBS +10% normal goat serum for 1 hour and then washed again with PBS +0.1%Triton X-100. Some slides were dried and covered with coverslips in Vectashield mounting media of antifade/4',6-diamidino-2-phenylindole (1:1; Vector Laboratories, Inc.). Immunofluorescence was observed with a Leitz Orthoplan 2 microscope, and images were captured by a charge-coupled device camera with Smart Capture program (Vysis, Downers Grove, IL). Some slides were double staining by TUNEL assay with the In Situ Cell Death Detection Kit (TMR red; Roche Applied Science) according to the manufacturer’s protocol to record clusterin expression and apoptotic cell death co-localization.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clusterin Is Down-regulated in Human Colon Cancer.
To further explore the potential role of clusterin in colon cancer, the levels of clusterin mRNA and protein were assessed in human colon neoplastic specimens (Dukes’ stage C) relative to matched normal mucosal controls from 10 patients. Compared with the matched normal tissues, clusterin mRNA and protein expression were generally down-regulated in human colon cancers (Fig. 1, A and B)Citation . Both RNA and protein expression were consistently reduced by >50% in the majority of cases.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Clusterin is down-regulated in human colon cancer. A, real-time quantitative PCR assay of clusterin mRNA expression in human colon neoplastic specimens (Dukes’ stage C) relative to matched normal mucosal controls from 10 patients. B, Western blot analyses for clusterin protein expression in the same patient samples. Compared with the matched normal tissues, clusterin mRNA and protein expression were generally down-regulated in human colon cancers. Real-time PCR data were normalized by mRNA level to glyceraldehyde-3-phosphate dehydrogenase.

 
Clusterin Is Up-regulated in Chemotherapy-induced Colon Cancer Cell Apoptosis.
To determine whether clusterin expression was implicated with colon cancer cell apoptosis, we used two common chemotherapeutical agents for colon cancer, 5-FU (5 µmol/L) and irinotecan (6 µmol/L) for proapoptotic stimuli. Anti-Fas antibody (50 ng/mL) was added to 5-FU because we have previously shown that the combination enhances apoptotic responses in colon cancer cell lines. After treatment, HT29, HCT116, KM12C, but not SW620 had significant increases in apoptosis (Fig. 2A)Citation . Apoptosis was assessed by flow cytometric analysis using Annexin V-phycoerythrin. Quantitative PCR and Western blotting were then used to measure clusterin mRNA and protein expression. Clusterin protein expression at baseline was undetectable for all four cell lines and dramatically increased with chemotherapy exposure in all cell lines but SW620 (Fig. 2B)Citation . Fluorescence immunostaining and TUNEL staining were used to localize clusterin expression and apoptotic cell death. Clusterin was found to be primarily expressed in the nuclei in the TUNEL-positive stained apoptotic cells after chemotherapy treatment. The results indicated that the fraction of apoptotic cells was increased ~5-fold in those cells exposed to apoptotic stimuli relative to controls absent of apoptotic stimuli in HT29 (Fig. 2C)Citation and HCT116 (Fig. 2D)Citation , but again, no apoptosis was induced at SW620 colon cancer cell line (data not shown).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Clusterin is up-regulated in chemotherapy-induced colon cancer cell apoptosis. A. To determine whether clusterin expression was implicated with colon cancer cell apoptosis, we used 5-FU (5 µmol/L) plus anti-Fas antibody (50 ng/mL) as proapoptotic stimuli. After treatment for 48 hours, apoptotic cell death was measured by an FACS flow cytometer using Annexin V-phycoerythrin plus 7-amino-actinomycin D and analyzed by ModFitLT software. Each value represents the mean ± SE (n = 3). *Student t test, P < 0.01 versusuntreated control. HT29, HCT116, KM12C, but not SW620 had significant increases in apoptosis with treatment. B, real-time quantitative PCR results showed that clusterin mRNA was up-regulated for all cell lines except SW620, compared with untreated controls. A Western blot analysis showed that clusterin protein expression at baseline was undetectable for all four cell lines and dramatically increased with chemotherapy exposure in all cell lines but SW620. C and D, dual-staining immunofluorescence assay and TUNEL staining stained clusterin antigen (green), apoptotic cell death (red), and nuclei (blue). Clusterin was found to be primarily expressed in the nuclei in the TUNEL-positive stained apoptotic cells after chemotherapy treatment in HT29 and HCT116. DAPI, 4',6-diamidino-2-phenylindole.

 
Clusterin Is Up-regulated in Wild-type APC-Induced Colon Cancer Apoptosis.
Because most colon cancers lack functional APC protein and the data suggest diminished clusterin expression in these samples, we turned to a well-described in vitro cell line model in which wild-type APC protein can be induced to cause apoptosis. A null APC–/– human colon cancer cell line (HT-29) stably transfected with a Zn2+-inducible wild-type APC vector or a ß-galactosidase control, was used to additionally investigate the relationship between clusterin expression and APC. As demonstrated by real-time quantitative PCR, the clusterin mRNA levels dramatically increased in cells as early as 4 hours after induction of wild-type APC expression (Fig. 3A)Citation . Similarly, protein levels of clusterin were shown to be up-regulated with induction of wild-type APC expression early after APC induction (Fig. 3B)Citation . This induction of clusterin and APC tightly correlate with the induction of apoptosis in these cells (data not shown).



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Clusterin is up-regulated in wild-type APC-induced colon cancer apoptosis. A null APC–/– human colon cancer cell line (HT-29) stably transfected with a Zn2+-inducible wild-type APC vector or a ß-galactosidase control was used to investigate the relationship between clusterin expression and APC. A. As demonstrated by real-time quantitative PCR, the clusterin mRNA levels dramatically increased in cells, as early as 4 h after induction of wild-type APC expression. (B) Similarly, protein levels of clusterin were shown to be up-regulated with induction of wild-type APC expression early after APC induction.

 
Antisense Clusterin Oligonucleotide Reduced Chemotherapy- or APC-Induced Apoptosis.
To understand if clusterin expression directly linked to chemotherapy- or APC-induced apoptosis, we used previously described (20) antisense clusterin oligonucleotides to test whether blocking clusterin expression by antisense clusterin oligonucleotide could reduce apoptosis induced by chemotherapy or APC. The results showed that clusterin antisense clusterin oligonucleotides (1 mmol/L), but not mismatch control oligonucleotides, significantly decreased clusterin mRNA and protein expression induced by pro-apoptotic stimuli (Fig. 4, A and B)Citation . Similarly, apoptotic cell death induced by proapoptosis stimuli was decreased by ASO >50%, compared with mismatch control oligonucleotide (Fig. 4C)Citation . These results indicated that chemotherapy- or APC-induced colon cancer cell apoptosis is dependent on clusterin expression.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Antisense clusterin oligonucleotide (ASO) reduced chemotherapy- or APC-induced apoptosis. A and B. Real-time PCR data showed that clusterin ASO (1 mmol/L), but not mismatch (MM) control oligonucleotides (1 mmol/L), significantly decreased clusterin mRNA (*P < 0.01 ASO versus MM control oligonucleotides), and protein expression induced by proapoptotic stimuli. C. Similarly, apoptotic cell death induced by proapoptotic stimuli was decreased by ASO >50%, compared with MM control oligonucleotides in HT29, HCT116, and HT29 APC cells.

 
Transient Transfection of Clusterin Localized to the Nucleus and Directly Induced Apoptosis or Enhanced Chemotherapy-Induced Apoptosis in Colon Cancer Cells.
Given the correlation between clusterin overexpression and cell death, we investigated whether clusterin directly contributed to colon cancer cell death. We transiently transfected clusterin to the wild-type HT29 cell line. After 24 or 48 hours, clusterin protein expression increased ~10-fold compared with mock-transfected or wild-type cells (Fig. 5A)Citation . We used fluorescence immunostaining and TUNEL staining to detect clusterin expression and cell apoptosis principally in nucleus of the transfected cells (Fig. 5B)Citation . Flow cytometric analysis also showed that transient transfection of clusterin induced apoptosis in >30% cells, as compared with the mock transfected or wild-type cells (Fig. 5C)Citation . We also found that transiently transfected clusterin enhanced apoptosis ~2-fold in cells treated with 5-FU and Fas as compared with mock-transfected cells treated with 5-FU and Fas (Fig. 5D)Citation . These results indicated that transient transfection of clusterin to colon cancer cells either directly induced apoptosis or enhanced chemotherapy sensitivity in human colon cancer cells.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Transient transfection of clusterin localized to the nucleus and directly induced apoptosis or enhanced chemotherapy-induced apoptosis in colon cancer cells. A. Western blot analysis showed that transiently transfection clusterin to the wild-type HT29 cell line, and after 24 or 48 hours, clusterin protein expression increased ~10-fold compared with mock-transfected or wild-type cells. B, fluorescence immunostaining and TUNEL staining to detect clusterin expression and cell apoptosis principally in nucleus of the transfected cells. Clusterin antigen (green), apoptosis cell death (red), and nuclei (blue). C. Flow cytometric analysis showed that transient transfection of clusterin induced apoptosis in >30% cells, as compared with the mock-transfected or wild-type cells, and (D) transiently transfected clusterin enhanced apoptosis by ~2-fold in cells treated with 5-FUand Fas, as compared with mock-transfected cells treated with 5-FU and Fas. *P < 0.01 clusterin transfection versus mock transfection.

 
Clusterin Induction in Chemotherapy or APC-Induced Colon Cancer Cell Apoptosis Was p21 Dependent.
As a broad-acting cyclin-dependent kinase inhibitor, p21 (WAF1) occupies a central position in the cell cycle regulation of self-renewing tissues. In addition to regulating normal cell cycle progression decisions, p21 integrates genotoxic insults into growth arrest and apoptotic signaling pathways that ultimately determine epithelial cell fate. We have found that chemotherapeutical agents or APC were able to substantially up-regulate p21 expression (Fig. 6A)Citation . Because we knew that these treatments also induced clusterin and apoptosis, we investigated clusterin expression in wild-type HCT116p21+/+ and knockout HCT116 p21–/– cells. When HCT116 p21+/+ cells were treated with proapoptotic stimuli (5-FU or irinotecan), both clusterin and p21expression were detected. Absent of p21 expression, however, clusterin was not expressed. Similarly, HCT116p21–/– cells showed significant resistance to 5-FU and Fas-induced apoptosis as compared with the parental cells (HCT116p21+/+; Fig. 6BCitation ). These results demonstrated that without p21 expression, clusterin was not induced and apoptosis was inhibited. When clusterin was transiently transfected into HCT116 p21–/– cells, however, clusterin protein was overexpressed and colocalized in the nucleus with apoptotic cells. The percentage of apoptotic cells increased ~6-fold as compared with control cells. Clusterin expression effectively bypassed the requirement for p21 expression, inducing basal levels of apoptosis, and enhancing chemotherapy-induced apoptosis (Fig. 6C)Citation . Using the colon cancer cell line SW620, we previously showed its resistance to chemotherapy-induced apoptosis (Fig. 2A)Citation and its absence of clusterin expression (Fig. 2B)Citation . Here, we show that the SW620 cell line has no detectable p21 expression nor clusterin expression either with or without chemotherapy treatment (Fig. 6D)Citation , potentially explaining why this cell line is resistant to chemotherapy induced apoptosis. Taken together, our results suggest that clusterin acts downstream of p21 and that clusterin overexpression in chemotherapy-induced apoptosis is p21 dependent.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Clusterin induction in chemotherapy- or APC-induced colon cancer cell apoptosis was p21 dependent. A. Western blot analysis showed that chemotherapeutic agents or APC were able to substantially up-regulate p21 protein expression. B. Western blot analysis showed that when HCT116 p21+/+ cells were treated with proapoptotic stimuli (5-FU or irinotecan), both clusterin and p21expression were detected. Absent of p21 expression, however, clusterin was not expressed in HCT116 p21–/– cells. Flow cytometric data showed that HCT116p21–/– cells showed significant resistance to 5-FU and Fas-induced apoptosis, as compared with the parental cells (HCT116p21+/+). C. Western blot analysis showed that with transient transfection of clusterin into HCT116 p21–/– cells, clusterin protein was overexpressed. Fluorescence immunostaining and TUNEL staining showed that the overexpression of clusterin was colocalized in the nucleus with apoptotic cells. Flow cytometric data showed that the percentage of apoptotic cells increased ~6-fold as compared with control cells. D. Western blot analysis showed that the SW620 cell line had no detectable p21 expression nor clusterin expression either with or without chemotherapy treatment.

 
Clusterin and p21 Induction in Chemotherapy-Induced Colon Cancer Cell Apoptosis Are p53 Independent.
The tumor suppresser gene p53 is the primary transcription factor for the induction of p21. To determine whether p53 expression is implicated to p21-clusterin signal transduction pathway, we evaluated p53 expression in HT29 (p53 mutant) and HCT116 (p53 wild-type) colon cancer cell lines. We found that p21 and clusterin were overexpressed, but p53 levels were unaffected in cells after chemotherapeutic treatment (Fig. 7A)Citation . We also detected p21 and clusterin expression in HCT116 p53–/– cells after treatment with chemotherapy (Fig. 7B)Citation . The results suggest that clusterin and p21 up-regulation by chemotherapeutic treatment is independent of p53 expression.



View larger version (62K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Clusterin and p21 induction in chemotherapy-induced colon cancer cell apoptosis are p53 independent. A. Western blot analysis showed that p21 and clusterin were overexpressed, but p53 levels were unaffected in HT29 (p53 mutant) and HCT116 (p53 wild-type) cells after chemotherapeutic treatment. B. Western blot analysis also showed that p21 and clusterin were overexpressed in HCT116 p53–/– cells after chemotherapeutic treatment.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although clusterin was originally proposed to be a marker for programmed cell death, it has variously been proposed to provide both pro- and antiapoptotic functions. Studies of clusterin-transfected renal carcinoma cells suggest that clusterin expression may increase cell survival, motility, invasive capacity, and contribute to metastasis (14) . In ApcMin models of colon neoplasia, tumor cells undergoing apoptosis expressed low levels of clusterin (21) . In cancer patients, overexpression of clusterin has been linked to tumor progression in both breast and colon cancer (17 , 22) . These data support an antiapoptotic role for clusterin. Conversely, a number of studies also support a proapoptotic role for this molecule. Previous studies suggest that cl usterin expression decreases the proliferation rate of prostate epithelial cells (23) and is reduced in human prostate cancer (24) , consistent with a proapoptotic function. In addition, knockout studies show reductions in cell death under stress conditions (14 , 25) .

Our investigations sought to clarify the functional role of clusterin in human colon cancer. Only recently has it come to light that two forms of clusterin, a secreted and a nuclear form, may be responsible for this divergent behavior. It is now apparent that the endogenous nuclear clusterin is a product of alternative splicing. The shorter mRNA coding for nuclear clusterin produces a Mr 49,000 precursor protein that acts as a prodeath signal, inhibiting cell survival and cell growth. It contains a nuclear localization signal with potential for targeting it to the nucleus where it can become activated as a mature Mr ~55,000 death protein under conditions of significant stress (16) . Previous studies of colon cancer found an overexpression of secretory clusterin in the cytoplasm but a concordant decrease in nuclear clusterin (17) . Although our data show a decrease in clusterin in cancers relative to normal mucosal controls, they are consistent with these results in that we identified a significant decrease in clusterin expression, using antibodies recognizing the nuclear isoform of clusterin, when comparing Dukes’ stage C colon cancers to their matched normal tissues. This decrease in expression linked to tumor progression is also consistent with the role of clusterin as a tumor suppressor gene, normally providing proapoptotic function. Taken together, these results suggest that the discrepancies in previous studies of human cancer clusterin expression are likely related to the type of clusterin measured.

We sought to additionally investigate the relationship between clusterin expression and apoptotic function by examining clusterin expression in the context of APC expression and chemotherapy exposure. Because APC is mutated in the vast majority (>95%) of sporadic colon cancers and APC expression has been linked to the induction of apoptotic events (19) , we investigated the role of clusterin in APC-induced apoptosis. We identified that apoptosis induced by APC in APC-null colon cancer cells or by chemotherapy was linked to significant increases in clusterin expression. These data suggested that it was the nuclear form of clusterin (proapoptotic form) that contributes to human colon cancer apoptosis by colocalizing clusterin to apoptotic nuclei. In addition, we found that the stress induced by chemotherapies readily elevated clusterin levels and produced apoptosis.

Because clusterin has been proposed to regulate the cell cycle, increasing the accumulation of cells in the G0-G1 phases of the cell cycle (14) , we elected to evaluate the potential relationship between p21 and p53 and clusterin expression. The finding that targeted inactivation of p21 enhances Apc-initiated tumor formation (26) also led us to study this relationship further. Our data suggest that clusterin is induced in cells undergoing apoptosis stimulated by APC expression or by chemotherapy exposure. Moreover, we found a coordinate up-regulation of p21 and clusterin expression in cells undergoing apoptosis in response to these stimuli. The question then arose as to whether p21 expression was necessary for clusterin expression. To examine this question, we evaluated human colon cancer cells with a targeted deletion of p21 (HCT116p21–/–) and found that when treated with proapoptotic stimuli, no clusterin overexpression was seen and significantly less apoptosis was induced. Interestingly, the only cell line that was not susceptible to chemotherapy-induced apoptosis, SW620, was also incapable of mounting a p21 response, presumably preventing clusterin expression. Furthermore, when clusterin was transiently transfected into HCT116 p21–/– cells, clusterin protein was overexpressed in the nucleus and colocalized with TUNEL staining in the apoptotic cells. The percentage of apoptotic cells increased ~6-fold as compared with control cells, suggesting that clusterin can effectively bypass the action of p21 and induce apoptosis in the absence of p21. We also found that p21 and clusterin were overexpressed, but p53 levels were unaffected in cells after chemotherapeutic treatment. Similarly, p21 and clusterin were overexpressed in HCT116 p53–/–cells after stimulation by chemotherapy (Fig. 6, I and J)Citation . Taken together, these results suggest that clusterin acts downstream of p21 and that clusterin overexpression in chemotherapy-induced apoptosis was p21 dependent and p53 independent. This work is the first to demonstrate a novel link between the nuclear form of clusterin overexpression and the induction of p21.

The p21 signaling pathway that regulates the nuclear form of clusterin expression after chemotherapy exposure is unknown. Induction of the cyclin-dependent kinase inhibitor p21 is a common mechanism of growth arrest in different physiologic situations. Ectopic overexpression of p21 leads to cell growth arrest in G1 and G2, possibly by inhibition of cyclinB1/cyclin-dependent kinase 1 as demonstrated in prostate cancer cells. This arrest is accompanied by apoptotic cell death. Although p21 is not a transcription factor, it is conceivable that indirect effects of p21 on cellular gene expression may mediate some of its functions. For example, transient transfection assays showed that p21 could stimulate nuclear factor-{kappa}B–mediated transcription; this effect of p21 has been explained through the interaction of cyclin-dependent kinase 2 with transcriptional cofactor p300 that augments nuclear factor-{kappa}B and other inducible transcription factors. p21 interactions with proteins other than CDK may also have a potential effect on gene expression. For example, p21 was reported to bind c-Jun NH2-terminal kinases, apoptosis signal-regulating kinase 1, and Gadd45 (27) . It was already shown that clusterin promoter region has AP-1 protein (c-Jun and c-Fos) binding sites. In a study by Jin et al. (28) , transforming growth factor-ß induced clusterin expression in a variety of cell types via a consensus AP-1 binding site.

Collectively, the presented data demonstrate that overexpression of the nuclear form of clusterin either enhanced chemotherapy sensitivity or directly induced colon cancer apoptosis. The induction of clusterin by chemotherapy was p21 dependent but p53 independent. Because clusterin transfection subverted the absence of p21 and caused apoptosis, clusterin protein appears to be an important protein for regulating chemotherapy-induced apoptosis and may have a potential therapeutic role.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Timothy J. Yeatman, 12902 Magnolia Drive, SRB-2, Tampa, FL 33612-9497. Phone: (813) 979-7292; Fax: (813) 632-1433; E-mail: yeatman{at}moffitt.usf.edu

Received 6/11/04. Revised 8/ 4/04. Accepted 8/19/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Leger JG, Montpetit ML, Tenniswood MP Characterization and cloning of androgen-repressed mRNAs from rat ventral prostate. Biochem Biophys Res Commun 1987;147:196-203.[CrossRef][Medline]
  2. Bettuzzi S, Hiipakka RA, Gilna P, Liao ST Identification of an androgen-repressed mRNA in rat ventral prostate as coding for sulphated glycoprotein 2 by cDNA cloning and sequence analysis. Biochem J 1989;257:293-6.[Medline]
  3. Montpetit ML, Lawless KR, Tenniswood M Androgen-repressed messages in the rat ventral prostate. Prostate 1986;8:25-36.[Medline]
  4. Wong P, Borst DE, Farber D, et al Increased TRPM-2/clusterin mRNA levels during the time of retinal degeneration in mouse models of retinitis pigmentosa. Biochem Cell Biol 1994;72:439-46.[Medline]
  5. Adel Moallem S, Hales BF Transglutaminase and clusterin induction during normal and abnormal limb development in the mouse. Biol Reprod 1996;55:281-90.[Abstract]
  6. Bursch W, Gleeson T, Kleine L, Tenniswood M Expression of clusterin (testosterone-repressed prostate message-2) mRNA during growth and regeneration of rat liver. Arch Toxicol 1995;69:253-8.[CrossRef][Medline]
  7. Buttyan R, Olsson CA, Pintar J, et al Induction of the TRPM-2 gene in cells undergoing programmed death. Mol Cell Biol 1989;9:3473-81.[Abstract/Free Full Text]
  8. Danik M, Chabot JG, Mercier C, et al Human gliomas and epileptic foci express high levels of a mRNA related to rat testicular sulfated glycoprotein 2, a purported marker of cell death. Proc Natl Acad Sci USA 1991;88:8577-81.[Abstract/Free Full Text]
  9. Leger JG, Le Guellec R, Tenniswood MP Treatment with antiandrogens induces an androgen-repressed gene in the rat ventral prostate. Prostate 1988;13:131-42.[Medline]
  10. Tenniswood MP, Guenette RS, Lakins J, Mooibroek M, Wong P, Welsh JE Active cell death in hormone-dependent tissues. Cancer Metastasis Rev 1992;11:197-220.[CrossRef][Medline]
  11. Ahuja HS, Tenniswood M, Zakeri ZF Differential expression of clusterin in the testis and epididymis of postnatal and germ cell deficient mice. J Androl 1996;17:491-501.[Abstract/Free Full Text]
  12. Viard I, Wehrli P, Jornot L, et al Clusterin gene expression mediates resistance to apoptotic cell death induced by heat shock and oxidative stress. J Investig Dermatol 1999;112:290-6.[CrossRef][Medline]
  13. French LE, Wohlwend A, Sappino AP, Tschopp J, Schifferli JA Human clusterin gene expression is confined to surviving cells during in vitro programmed cell death. J Clin Investig 1994;93:877-84.
  14. Jones SE, Jomary C Clusterin. Int J Biochem Cell Biol 2002;34:427-31.[CrossRef][Medline]
  15. Hara I, Miyake H, Gleave ME, Kamidono S Introduction of clusterin gene into human renal cell carcinoma cells enhances their resistance to cytotoxic chemotherapy through inhibition of apoptosis both in vitro and in vivo. Jpn J Cancer Res 2001;92:1220-4.[CrossRef][Medline]
  16. Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA Synthesis and functional analyses of nuclear clusterin, a cell death protein. J Biol Chem 2003;278:11590-600.[Abstract/Free Full Text]
  17. Pucci S, Bonanno E, Pichiorri F, Angeloni C, Spagnoli LG Modulation of different clusterin isoforms in human colon tumorigenesis. Oncogene 2004;23:2298-304.[CrossRef][Medline]
  18. Caccamo AE, Scaltriti M, Caporali A, et al Cell detachment and apoptosis induction of immortalized human prostate epithelial cells are associated with early accumulation of 45 kDa nuclear isoform of clusterin. Biochem J 2004;382(Pt 1):157-68.
  19. Chen T, Yang I, Irby R, et al Regulation of caspase expression and apoptosis by adenomatous polyposis coli. Cancer Res 2003;63:4368-74.[Abstract/Free Full Text]
  20. Zellweger T, Chi K, Miyake H, et al Enhanced radiation sensitivity in prostate cancer by inhibition of the cell survival protein clusterin. Clin Cancer Res 2002;8:3276-84.[Abstract/Free Full Text]
  21. Chen X, Halberg RB, Ehrhardt WM, Torrealba J, Dove WF Clusterin as a biomarker in murine and human intestinal neoplasia. Proc Natl Acad Sci USA 2003;100:9530-5.[Abstract/Free Full Text]
  22. Redondo M, Villar E, Torres-Munoz J, Tellez T, Morell M, Petito CK Overexpression of clusterin in human breast carcinoma. Am J Pathol 2000;157:393-9.[Abstract/Free Full Text]
  23. Bettuzzi S, Scorcioni F, Astancolle S, Davalli P, Scaltriti M, Corti A Clusterin (SGP-2) transient overexpression decreases proliferation rate of SV40-immortalized human prostate epithelial cells by slowing down cell cycle progression. Oncogene 2002;21:4328-34.[CrossRef][Medline]
  24. Scaltriti M, Brausi M, Amorosi A, et al Clusterin (SGP-2, ApoJ) expression is down-regulated in low- and high-grade human prostate cancer. Int J Cancer 2004;108:23-30.[CrossRef][Medline]
  25. McLaughlin L, Zhu G, Mistry M, et al Apolipoprotein J/clusterin limits the severity of murine autoimmune myocarditis. J Clin Investig 2000;106:1105-13.[Medline]
  26. Yang WC, Mathew J, Velcich A, et al Targeted inactivation of the p21(WAF1/cip1) gene enhances Apc-initiated tumor formation and the tumor-promoting activity of a Western-style high-risk diet by altering cell maturation in the intestinal mucosal. Cancer Res 2001;61:565-9.[Abstract/Free Full Text]
  27. Weinberg WC, Denning MF p21Waf1 control of epithelial cell cycle and cell fate. Crit Rev Oral Biol Med 2002;13:453-64.[Abstract/Free Full Text]
  28. Jin G, Howe PH Transforming growth factor beta regulates clusterin gene expression via modulation of transcription factor c-Fos. Eur J Biochem 1999;263:534-42.[Medline]



This article has been cited by other articles:


Home page
GeneticsHome page
R. B. Halberg, X. Chen, J. M. Amos-Landgraf, A. White, K. Rasmussen, L. Clipson, C. Pasch, R. Sullivan, H. C. Pitot, and W. F. Dove
The Pleiotropic Phenotype of Apc Mutations in the Mouse: Allele Specificity and Effects of the Genetic Background
Genetics, September 1, 2008; 180(1): 601 - 609.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. M. Moretti, M. M. Marelli, S. Mai, A. Cariboni, M. Scaltriti, S. Bettuzzi, and P. Limonta
Clusterin Isoforms Differentially Affect Growth and Motility of Prostate Cells: Possible Implications in Prostate Tumorigenesis
Cancer Res., November 1, 2007; 67(21): 10325 - 10333.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
C. L. Andersen, T. Schepeler, K. Thorsen, K. Birkenkamp-Demtroder, F. Mansilla, L. A. Aaltonen, S. Laurberg, and T. F. Orntoft
Clusterin Expression in Normal Mucosa and Colorectal Cancer
Mol. Cell. Proteomics, June 1, 2007; 6(6): 1039 - 1048.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. M.E.I. Hellebrekers, V. Melotte, E. Vire, E. Langenkamp, G. Molema, F. Fuks, J. G. Herman, W. Van Criekinge, A. W. Griffioen, and M. van Engeland
Identification of Epigenetically Silenced Genes in Tumor Endothelial Cells
Cancer Res., May 1, 2007; 67(9): 4138 - 4148.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Aneja, A. M. Ghaleb, J. Zhou, V. W. Yang, and H. C. Joshi
p53 and p21 Determine the Sensitivity of Noscapine-Induced Apoptosis in Colon Cancer Cells
Cancer Res., April 15, 2007; 67(8): 3862 - 3870.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
A. M. Rodriguez-Pineiro, M. P. de la Cadena, A. Lopez-Saco, and F. J. Rodriguez-Berrocal
Differential Expression of Serum Clusterin Isoforms in Colorectal Cancer
Mol. Cell. Proteomics, September 1, 2006; 5(9): 1647 - 1657.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Sato, H. Matsubayashi, T. Abe, N. Fukushima, and M. Goggins
Epigenetic Down-Regulation of CDKN1C/p57KIP2 in Pancreatic Ductal Neoplasms Identified by Gene Expression Profiling
Clin. Cancer Res., July 1, 2005; 11(13): 4681 - 4688.
[Abstract] [Full Text] [PDF]


Home page
CA Cancer J ClinHome page
I. M. Ghobrial, T. E. Witzig, and A. A. Adjei
Targeting Apoptosis Pathways in Cancer Therapy
CA Cancer J Clin, May 1, 2005; 55(3): 178 - 194.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, T.
Right arrow Articles by Yeatman, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, T.
Right arrow Articles by Yeatman, T. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online