| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Department of Interdisciplinary Oncology, H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida; and 2 Dipartimento di Medicina Sperimentale, Sezione di Biochimica, Biochimica Clinica e Biochimica dell’Esercizio Fisico, Parma, Italy
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recent studies have shed some light on the dichotomous functions of clusterin, suggesting pro- and antiapoptotic functions may be related to nuclear and secreted isoforms, respectively, and that the function of clusterin may be context dependent. Overexpression of the secreted form of clusterin in human cancer cells caused drug resistance and protection against certain cytotoxic agents that induce apoptosis (15) . Additional data suggest that a secreted form of clusterin acts as a molecular chaperone, scavenging denatured proteins outside cells following specific stress-induced injury such as heat shock. Other data, show that overexpression of a specific nuclear form of clusterin acts as a prodeath signal (16) . Furthermore, studies of human colon cancer suggest a conversion from the nuclear form of clusterin to the cytoplasmic form, which may promote tumor progression (17) . Recently, a link between the accumulation of the nuclear form of clusterin and anoikis induction in prostate epithelial cells was shown (18) .
To better elucidate the functional role of clusterin, we examined its expression and localization in a panel of normal and neoplastic human colon cancer tissues, as well as a panel of human colon cancer cell lines. We then evaluated the effect of APC expression and chemotherapy, both known to induce apoptosis, on clusterin expression and associated apoptotic events. The effect of clusterin transfection, or alternatively, antisense clusterin transfection, on basal and chemotherapy-induced apoptosis was investigated. Because both p21 and p53 have been lined to regulation of apoptotic events, clusterin expression and induction of apoptosis was evaluated in the context of their expression using targeted knockout cell line models.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cell Lines.
Four different human colon cancer cell lines were obtained from the American Type Culture Collection (HT29, KM12C, HCT116, and SW620), and two targeted knockout cell lines were a kind gift of Dr. B. Vogelstein (HCT116p21–/– and HCT116p53–/–). The HT29 cell line devoid of APC but engineered with a zinc-inducible wild-type APC vector (HT29APC) was also a gift of Dr. Bert Vogelstein. HT29, KM12C, HCT116, and SW620 cells were cultured in RPMI medium with 10% fetal bovine serum. HT29APC, HCT116p21–/–, HCT116p53–/–, and their parental cells were cultured in McCoy’s 5A medium with 10% fetal bovine serum. Cells were treated with Zn2+ (120 µmol/L) 4, 8, and 16 hours or with 5-flurouracil (5-FU; 5 µmol/L) and anti-Fas antibody (50 ng/mL) or with irinotecan (6 µmol/L) 24, 48, and 72 hours to induce apoptosis.
Transient Transfection of Clusterin.
The plasmids p4 empty vector and p4/SGP2 (containing human clusterin full-length cDNA) were obtained from Dr. Saverio Bettuzzi (Parma, Italy). Transient transfection of p4 empty vector (as a mock) or p4/SGP2 were performed using FuGENE 6 Transfection Reagent (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer’s protocol. After transfection with mock or clusterin 24 to 48 hours, cells were either harvested or treated by apoptotic stimuli for 48 hours, then harvested to detect clusterin protein expression by Western blotting or to perform apoptosis assays. Each transfection experiment was done in triplicate. Data are presented as a mean ± SE.
Western Blot Analyses.
Cells were harvested in protein lysis buffer [20 mmol/L Tris-HCl (pH 7.6), 150 mmol/L NaCl, 1 mmol/L EDTA, 0.5% NP40, 1 mmol/L DTT, 5 µmol/L trichostatin A, 1 mmol/L sodium orthovanadate, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L NaF, and complete protease inhibitors (Roche Applied Science, Indianapolis, IN)], and Western blotting was performed as described previously (19)
. All blots were performed in triplicate. Representative examples are shown in the figures. Antibodies used include clusterin (Alexis, San Diego, CA) and p53 and p21 (BD Biosciences, San Jose, CA).
Antisense Clusterin Oligonucleotide Transfection.
Preattached 
1 x 105 HT29, HCT11,6 and HT29APC cells in 100-mm culture dishes, respectively, for overnight. They were transfected with antisense clusterin oligonucleotides or mismatch clusterin oligonucleotides, respectively. Phosphorothioate oligonucleotides used in this study were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). The sequence of the clusterin antisense clusterin oligonucleotide used corresponded to the human clusterin translation initiation site (5'-CAGCAGCAGAGTCTTCATCAT-3'). A 2-base clusterin mismatch oligonucleotide (5'-CAGCAGCAGAGTATTTATCAT-3') was used as control. Transfections were performed using the Lipofectamine Plus reagent (Invitrogen, Carlsbad, CA). Cells were treated with either 500 and 1000 nmol/L antisense or mismatch clusterin oligonucleotides after preincubation for 20 minutes with 10 µg/mL lipofectin in serum-free OPTI-MEM (Life Technologies, Inc., Carlsbad, CA). Four hours after the beginning of the incubation, for HT29 and HCT116 cells, the medium containing oligonucleotides and lipofectin was replaced with standard culture medium plus 5-FU (5 µmol/L) and Fas (50 ng/mL) once daily for 3 days. For HT29APC cells, the medium was replaced with standard culture medium plus Zn2+ (120 µmol/L) for 16 hours. Cells were harvested to detect clusterin protein expression by Western blotting or to perform apoptosis assays. Each transfection experiment was done in triplicate and repeated at least three times. Data are presented as a mean ± SE.
cDNA Synthesis and Real-time PCR.
To measure clusterin mRNA expression, RNA was isolated from snap-frozen human colon cancers (Dukes’ stage C), and their cognate normal mucosal controls or colon cancer cells treated with different reagents by using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. A quantitative primer/probe set was designed to evaluate and to quantitate clusterin mRNA. Reverse transcription of RNA was performed using 15 units of Omniscript reverse transcriptase (Qiagen, Valencia, CA), 1x cDNA synthesis buffer, 40 units of RNase inhibitor (Life Technologies, Inc.), 5 mmol/L DTT, 1 mmol/L deoxynucleoside triphosphate mixture, 0.5 µg of Oligo(dt) primer, and 2 µg of RNA. Primers and probes for real-time PCR were designed using Primer Express software (Applied Biosystems, Inc., Foster City, CA). Each primer set consisted of standard PCR primers (temperature 58° to 60°C) designed to span gene exons to exclude any possible genomic DNA contamination. Detection and quantitation of each gene was accomplished using an amplicon-specific fluorescent oligonucleotide probe (temperature 68°C to 70°C), with a 5'-reporter dye (carboxyfluorescein) and a downstream 3'-quencher dye (6-carboxytetramethylrhodamine). The primers used for detection of clusterin had the following sequences, 5'-CTATCTGCGGGTCACCAC-3' (forward primer), 5'-CACAGTGACACCGGAAGGAAC-3' (reverse primer), and 5'-FAM/TGGCTTCCCACACTTCTGACTCGG A/TAMRA-3' (probe). During PCR, the 5'-3' nuclease activity of TaqDNA polymerase releases the reporter, whose fluorescent signal is then detected by the GeneAmp 5700 Sequence Detector System (ABI, Foster City, CA). The PCR reaction was performed in a 96-well optical reaction plate with optical caps. The reaction mixture consisted of 0.2 µmol/L each primer, 0.1 µmol/L fluorescent probe, 5 units of AmpliTaq Gold (ABI), 200 µmol/L each dATP, dCTP, and dGTP, 400 µmol/L dUTP, 5.5 mmol/L MgCl2, 8% glycerol, 1 unit of AmpErase uracil N-glycosylase and 1x TaqMan Buffer A. Amplification profile was as follows: 50°C for 2 minutes (for uracil N-glycosylase digest of contaminating PCR amplicons), 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, and 60°C for 1 minute, 2 µL of cDNA were assayed per well. Standards used for quantitation were plasmid vector DNA containing the primer-specific coding region for clusterin. Standard values were 106, 105, 104, 103, 102, and 10 DNA molecules per well. Two assays were performed on each cDNA sample, clusterin, and 3-histone H3.3 as a housekeeping gene to normalize mRNA values. Quantitative PCR was performed in an ABI 5700 sequence detection system.
Apoptosis Assays.
To determine apoptotic fractions, cells were harvested at different time point after treatment by apoptotic stimuli. Cells were then analyzed by using the Annexin V-phycoerythrin plus 7-amino-actinomycin D (BD Biosciences) apoptosis detection kit according to the manufacturer’s protocol. The DNA damage experiments were done in triplicate for each cell line. Apoptotic fractions were determined by flow cytometry. Apoptosis was confirmed by terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) staining with the In Situ Cell Death Detection Kit (TMR red; Roche Applied Science) according to the manufacturer’s protocol and immunoblotting with human clusterin antibodies (Alexis).
Immunocytofluorescence and TUNEL Assay.
Preattached 1 x 104 cells/well were exposed to treatment conditions as planned (some cells were treated 48 hours by apoptotic stimuli, some cells were transiently transfected with clusterin 24 hours, and then treated another 48 hours with apoptotic stimuli). Cells were fixed with acetone-methanol (1:1; Sigma, St. Louis, MO) for 3 minutes, then were blocked with PBS +10% normal goat serum for 20 minutes. Cells were incubated with clusterin antibody (1:200; Alexis) in PBS +10% normal goat serum for 2 hours, then the slides were washed with PBS +0.1%Triton X-100 three times and were incubated with FITC (1:100; Vector Laboratories, Inc., Burlingame, CA) in PBS +10% normal goat serum for 1 hour and then washed again with PBS +0.1%Triton X-100. Some slides were dried and covered with coverslips in Vectashield mounting media of antifade/4',6-diamidino-2-phenylindole (1:1; Vector Laboratories, Inc.). Immunofluorescence was observed with a Leitz Orthoplan 2 microscope, and images were captured by a charge-coupled device camera with Smart Capture program (Vysis, Downers Grove, IL). Some slides were double staining by TUNEL assay with the In Situ Cell Death Detection Kit (TMR red; Roche Applied Science) according to the manufacturer’s protocol to record clusterin expression and apoptotic cell death co-localization.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Both RNA and protein expression were consistently reduced by >50% in the majority of cases.
|
. Apoptosis was assessed by flow cytometric analysis using Annexin V-phycoerythrin. Quantitative PCR and Western blotting were then used to measure clusterin mRNA and protein expression. Clusterin protein expression at baseline was undetectable for all four cell lines and dramatically increased with chemotherapy exposure in all cell lines but SW620 (Fig. 2B)
. Fluorescence immunostaining and TUNEL staining were used to localize clusterin expression and apoptotic cell death. Clusterin was found to be primarily expressed in the nuclei in the TUNEL-positive stained apoptotic cells after chemotherapy treatment. The results indicated that the fraction of apoptotic cells was increased 5-fold in those cells exposed to apoptotic stimuli relative to controls absent of apoptotic stimuli in HT29 (Fig. 2C)
and HCT116 (Fig. 2D)
, but again, no apoptosis was induced at SW620 colon cancer cell line (data not shown).
|
. Similarly, protein levels of clusterin were shown to be up-regulated with induction of wild-type APC expression early after APC induction (Fig. 3B)
. This induction of clusterin and APC tightly correlate with the induction of apoptosis in these cells (data not shown).
|
. Similarly, apoptotic cell death induced by proapoptosis stimuli was decreased by ASO >50%, compared with mismatch control oligonucleotide (Fig. 4C)
. These results indicated that chemotherapy- or APC-induced colon cancer cell apoptosis is dependent on clusterin expression.
|
10-fold compared with mock-transfected or wild-type cells (Fig. 5A)
. We used fluorescence immunostaining and TUNEL staining to detect clusterin expression and cell apoptosis principally in nucleus of the transfected cells (Fig. 5B)
. Flow cytometric analysis also showed that transient transfection of clusterin induced apoptosis in >30% cells, as compared with the mock transfected or wild-type cells (Fig. 5C)
. We also found that transiently transfected clusterin enhanced apoptosis 2-fold in cells treated with 5-FU and Fas as compared with mock-transfected cells treated with 5-FU and Fas (Fig. 5D)
. These results indicated that transient transfection of clusterin to colon cancer cells either directly induced apoptosis or enhanced chemotherapy sensitivity in human colon cancer cells.
|
. Because we knew that these treatments also induced clusterin and apoptosis, we investigated clusterin expression in wild-type HCT116p21+/+ and knockout HCT116 p21–/– cells. When HCT116 p21+/+ cells were treated with proapoptotic stimuli (5-FU or irinotecan), both clusterin and p21expression were detected. Absent of p21 expression, however, clusterin was not expressed. Similarly, HCT116p21–/– cells showed significant resistance to 5-FU and Fas-induced apoptosis as compared with the parental cells (HCT116p21+/+; Fig. 6B
). These results demonstrated that without p21 expression, clusterin was not induced and apoptosis was inhibited. When clusterin was transiently transfected into HCT116 p21–/– cells, however, clusterin protein was overexpressed and colocalized in the nucleus with apoptotic cells. The percentage of apoptotic cells increased 6-fold as compared with control cells. Clusterin expression effectively bypassed the requirement for p21 expression, inducing basal levels of apoptosis, and enhancing chemotherapy-induced apoptosis (Fig. 6C)
. Using the colon cancer cell line SW620, we previously showed its resistance to chemotherapy-induced apoptosis (Fig. 2A)
and its absence of clusterin expression (Fig. 2B)
. Here, we show that the SW620 cell line has no detectable p21 expression nor clusterin expression either with or without chemotherapy treatment (Fig. 6D)
, potentially explaining why this cell line is resistant to chemotherapy induced apoptosis. Taken together, our results suggest that clusterin acts downstream of p21 and that clusterin overexpression in chemotherapy-induced apoptosis is p21 dependent.
|
. We also detected p21 and clusterin expression in HCT116 p53–/– cells after treatment with chemotherapy (Fig. 7B)
. The results suggest that clusterin and p21 up-regulation by chemotherapeutic treatment is independent of p53 expression.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our investigations sought to clarify the functional role of clusterin in human colon cancer. Only recently has it come to light that two forms of clusterin, a secreted and a nuclear form, may be responsible for this divergent behavior. It is now apparent that the endogenous nuclear clusterin is a product of alternative splicing. The shorter mRNA coding for nuclear clusterin produces a Mr 49,000 precursor protein that acts as a prodeath signal, inhibiting cell survival and cell growth. It contains a nuclear localization signal with potential for targeting it to the nucleus where it can become activated as a mature Mr 55,000 death protein under conditions of significant stress (16)
. Previous studies of colon cancer found an overexpression of secretory clusterin in the cytoplasm but a concordant decrease in nuclear clusterin (17)
. Although our data show a decrease in clusterin in cancers relative to normal mucosal controls, they are consistent with these results in that we identified a significant decrease in clusterin expression, using antibodies recognizing the nuclear isoform of clusterin, when comparing Dukes’ stage C colon cancers to their matched normal tissues. This decrease in expression linked to tumor progression is also consistent with the role of clusterin as a tumor suppressor gene, normally providing proapoptotic function. Taken together, these results suggest that the discrepancies in previous studies of human cancer clusterin expression are likely related to the type of clusterin measured.
We sought to additionally investigate the relationship between clusterin expression and apoptotic function by examining clusterin expression in the context of APC expression and chemotherapy exposure. Because APC is mutated in the vast majority (>95%) of sporadic colon cancers and APC expression has been linked to the induction of apoptotic events (19) , we investigated the role of clusterin in APC-induced apoptosis. We identified that apoptosis induced by APC in APC-null colon cancer cells or by chemotherapy was linked to significant increases in clusterin expression. These data suggested that it was the nuclear form of clusterin (proapoptotic form) that contributes to human colon cancer apoptosis by colocalizing clusterin to apoptotic nuclei. In addition, we found that the stress induced by chemotherapies readily elevated clusterin levels and produced apoptosis.
Because clusterin has been proposed to regulate the cell cycle, increasing the accumulation of cells in the G0-G1 phases of the cell cycle (14)
, we elected to evaluate the potential relationship between p21 and p53 and clusterin expression. The finding that targeted inactivation of p21 enhances Apc-initiated tumor formation (26)
also led us to study this relationship further. Our data suggest that clusterin is induced in cells undergoing apoptosis stimulated by APC expression or by chemotherapy exposure. Moreover, we found a coordinate up-regulation of p21 and clusterin expression in cells undergoing apoptosis in response to these stimuli. The question then arose as to whether p21 expression was necessary for clusterin expression. To examine this question, we evaluated human colon cancer cells with a targeted deletion of p21 (HCT116p21–/–) and found that when treated with proapoptotic stimuli, no clusterin overexpression was seen and significantly less apoptosis was induced. Interestingly, the only cell line that was not susceptible to chemotherapy-induced apoptosis, SW620, was also incapable of mounting a p21 response, presumably preventing clusterin expression. Furthermore, when clusterin was transiently transfected into HCT116 p21–/– cells, clusterin protein was overexpressed in the nucleus and colocalized with TUNEL staining in the apoptotic cells. The percentage of apoptotic cells increased 6-fold as compared with control cells, suggesting that clusterin can effectively bypass the action of p21 and induce apoptosis in the absence of p21. We also found that p21 and clusterin were overexpressed, but p53 levels were unaffected in cells after chemotherapeutic treatment. Similarly, p21 and clusterin were overexpressed in HCT116 p53–/–cells after stimulation by chemotherapy (Fig. 6, I and J)
. Taken together, these results suggest that clusterin acts downstream of p21 and that clusterin overexpression in chemotherapy-induced apoptosis was p21 dependent and p53 independent. This work is the first to demonstrate a novel link between the nuclear form of clusterin overexpression and the induction of p21.
The p21 signaling pathway that regulates the nuclear form of clusterin expression after chemotherapy exposure is unknown. Induction of the cyclin-dependent kinase inhibitor p21 is a common mechanism of growth arrest in different physiologic situations. Ectopic overexpression of p21 leads to cell growth arrest in G1 and G2, possibly by inhibition of cyclinB1/cyclin-dependent kinase 1 as demonstrated in prostate cancer cells. This arrest is accompanied by apoptotic cell death. Although p21 is not a transcription factor, it is conceivable that indirect effects of p21 on cellular gene expression may mediate some of its functions. For example, transient transfection assays showed that p21 could stimulate nuclear factor-
B–mediated transcription; this effect of p21 has been explained through the interaction of cyclin-dependent kinase 2 with transcriptional cofactor p300 that augments nuclear factor-B and other inducible transcription factors. p21 interactions with proteins other than CDK may also have a potential effect on gene expression. For example, p21 was reported to bind c-Jun NH2-terminal kinases, apoptosis signal-regulating kinase 1, and Gadd45 (27)
. It was already shown that clusterin promoter region has AP-1 protein (c-Jun and c-Fos) binding sites. In a study by Jin et al. (28)
, transforming growth factor-ß induced clusterin expression in a variety of cell types via a consensus AP-1 binding site.
Collectively, the presented data demonstrate that overexpression of the nuclear form of clusterin either enhanced chemotherapy sensitivity or directly induced colon cancer apoptosis. The induction of clusterin by chemotherapy was p21 dependent but p53 independent. Because clusterin transfection subverted the absence of p21 and caused apoptosis, clusterin protein appears to be an important protein for regulating chemotherapy-induced apoptosis and may have a potential therapeutic role.
|
FOOTNOTES |
|---|
Requests for reprints: Timothy J. Yeatman, 12902 Magnolia Drive, SRB-2, Tampa, FL 33612-9497. Phone: (813) 979-7292; Fax: (813) 632-1433; E-mail: yeatman{at}moffitt.usf.edu
Received 6/11/04. Revised 8/ 4/04. Accepted 8/19/04.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  R. B. Halberg, X. Chen, J. M. Amos-Landgraf, A. White, K. Rasmussen, L. Clipson, C. Pasch, R. Sullivan, H. C. Pitot, and W. F. Dove The Pleiotropic Phenotype of Apc Mutations in the Mouse: Allele Specificity and Effects of the Genetic Background Genetics, September 1, 2008; 180(1): 601 - 609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Moretti, M. M. Marelli, S. Mai, A. Cariboni, M. Scaltriti, S. Bettuzzi, and P. Limonta Clusterin Isoforms Differentially Affect Growth and Motility of Prostate Cells: Possible Implications in Prostate Tumorigenesis Cancer Res., November 1, 2007; 67(21): 10325 - 10333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Andersen, T. Schepeler, K. Thorsen, K. Birkenkamp-Demtroder, F. Mansilla, L. A. Aaltonen, S. Laurberg, and T. F. Orntoft Clusterin Expression in Normal Mucosa and Colorectal Cancer Mol. Cell. Proteomics, June 1, 2007; 6(6): 1039 - 1048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M.E.I. Hellebrekers, V. Melotte, E. Vire, E. Langenkamp, G. Molema, F. Fuks, J. G. Herman, W. Van Criekinge, A. W. Griffioen, and M. van Engeland Identification of Epigenetically Silenced Genes in Tumor Endothelial Cells Cancer Res., May 1, 2007; 67(9): 4138 - 4148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Aneja, A. M. Ghaleb, J. Zhou, V. W. Yang, and H. C. Joshi p53 and p21 Determine the Sensitivity of Noscapine-Induced Apoptosis in Colon Cancer Cells Cancer Res., April 15, 2007; 67(8): 3862 - 3870. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Rodriguez-Pineiro, M. P. de la Cadena, A. Lopez-Saco, and F. J. Rodriguez-Berrocal Differential Expression of Serum Clusterin Isoforms in Colorectal Cancer Mol. Cell. Proteomics, September 1, 2006; 5(9): 1647 - 1657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sato, H. Matsubayashi, T. Abe, N. Fukushima, and M. Goggins Epigenetic Down-Regulation of CDKN1C/p57KIP2 in Pancreatic Ductal Neoplasms Identified by Gene Expression Profiling Clin. Cancer Res., July 1, 2005; 11(13): 4681 - 4688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Ghobrial, T. E. Witzig, and A. A. Adjei Targeting Apoptosis Pathways in Cancer Therapy CA Cancer J Clin, May 1, 2005; 55(3): 178 - 194. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
