Cancer Research Cell Death Mechanisms and Cancer Therapy  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, Q.
Right arrow Articles by Stolz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, Q.
Right arrow Articles by Stolz, A.
[Cancer Research 64, 7610-7617, October 15, 2004]
© 2004 American Association for Cancer Research


Endocrinology

Selective Loss of AKR1C1 and AKR1C2 in Breast Cancer and Their Potential Effect on Progesterone Signaling

Qing Ji1, Chisa Aoyama5, Yih-Dar Nien2, Paul I. Liu5, Peter K. Chen5, Lilly Chang3, Frank Z. Stanczyk3,4 and Andrew Stolz1

Departments of 1 Medicine, 2 Surgery, 3 Obstetrics and Gynecology, and 4 Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California; and 5 Department of Pathology, Olive View-UCLA Medical Center, University of California Los Angeles, Sylmar, California


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Progesterone plays an essential role in breast development and cancer formation. The local metabolism of progesterone may limit its interactions with the progesterone receptor (PR) and thereby act as a prereceptor regulator. Selective loss of AKR1C1, which encodes a 20{alpha}-hydroxysteroid dehydrogenase [20{alpha}-HSD (EC 1.1.1.149)], and AKR1C2, which encodes a 3{alpha}-hydroxysteroid dehydrogenase [3{alpha}-HSD (EC 1.1.1.52)], was found in 24 paired breast cancer samples as compared with paired normal tissues from the same individuals. In contrast, AKR1C3, which shares 84% sequence identity, and 5{alpha}-reductase type I (SRD5A1) were minimally affected. Breast cancer cell lines T-47D and MCF-7 also expressed reduced AKR1C1, whereas the breast epithelial cell line MCF-10A expressed AKR1C1 at levels comparable with those of normal breast tissues. Immunohistochemical staining confirmed loss of AKR1C1 expression in breast tumors. AKR1C3 and AKR1C1 were localized on the same myoepithelial and luminal epithelial cell layers. Suppression of ARK1C1 and AKR1C2 by selective small interfering RNAs inhibited production of 20{alpha}-dihydroprogesterone and was associated with increased progesterone in MCF-10A cells. Suppression of AKR1C1 alone or with AKR1C2 in T-47D cells led to decreased growth in the presence of progesterone. Overexpression of AKR1C1 and, to a lesser extent, AKR1C2 (but not AKR1C3) decreased progesterone-dependent PR activation of a mouse mammary tumor virus promoter in both prostate (PC-3) and breast (T-47D) cancer cell lines. We speculate that loss of AKR1C1 and AKR1C2 in breast cancer results in decreased progesterone catabolism, which, in combination with increased PR expression, may augment progesterone signaling by its nuclear receptors.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In women, breast cancer is the most common noncutaneous malignancy, and lifetime exposure to ovarian hormones is a well-recognized risk factor for breast cancer development (1 , 2) . The actions of both estrogen and progesterone are required for normal growth and maturation of breast tissues, and progesterone is required for terminal duct formation required for lactation (3) . Estrogen can also regulate expression of the progesterone receptor (PR), linking the action of both these two hormones and suggesting a complex interplay between estrogen and regulation of progesterone-dependent genes. Inconsistent results in breast cancer cell lines and animal studies have made it difficult to assess a role of progesterone in either development or promotion of breast cancer (4, 5, 6) . However, women receiving progestin are at greater risk for development of increased mammographic breast density, suggesting greater cellular proliferation (1 , 7) , and women in the Women’s Health Initiative trial receiving estrogen and a progestin had increased incidence of breast cancer compared with those receiving estrogen alone. These findings strongly suggest that exogenous progestin may be a causative factor for breast tumor development (1 , 2 , 7 , 8) .

The local regulation of hormone synthesis and catabolism are key modifiers for the development and growth of hormone-dependent tumors, including breast cancer (9, 10, 11) . For example, induction of aromatase in breast cancer results in the in situ synthesis of estrogen, promoting tumor growth, and aromatase inhibitors effectively prevent breast cancer recurrence (10 , 12) . Thus, estrogen is an effective target for chemoprevention. Similarly, progesterone and/or its metabolites may provide novel targets for chemoprevention of breast cancer or treatment strategies for breast cancer because they act as either growth promoters or cell cycle inhibitors in breast cancer cells (4 , 6) . Little is known about the pathways responsible for catabolism of progesterone in the human breast, but in rat placenta, robust induction of 20{alpha}-hydroxysteroid dehydrogenase [20{alpha}-HSD (EC 1.1.1.149)] expression immediately precedes reduction in local progesterone levels at parturition (13 , 14) . In humans, a similar increase in placental 20{alpha}-HSD activity occurs, but not in other pathways, implying a common mechanism for the local elimination of progesterone (15 , 16) .

The 20{alpha}-HSDs are members of a newly emerging family of NADPH-dependent cytosolic oxidoreductases, known as the aldo-keto reductase super gene family (17 , 18) . AKR1C1 is one of four highly related human hydroxysteroid dehydrogenases that share >84% sequence identity but have distinctive substrate specificities and tissue distributions. Three of these AKR1C family members are expressed in the human breast and catalyze the following reactions: (a) AKR1C1 reduces the carbonyl group at the 20 position, and their products are weaker activators of the transcriptional activity of PR (19) ; (b) AKR1C2 encodes for a 3{alpha}-hydroxysteroid dehydrogenase [3{alpha}-HSD (EC 1.1.1.52)] that reduces the carbonyl group at the 3 position of progesterone metabolites that are also weak PR activators (20) ; and (c) AKR1C3, also referred to as 17ß-HSD type V, has minimal 20{alpha}-HSD or 3{alpha}-HSD activity for progesterone (21) . Remarkably, AKR1C2 differs by only 7 of 323 amino acids from AKR1C1 (20 , 22) , and all three genes are in close proximity on chromosome 10p14, suggesting evolution by gene duplication (18 , 23) .

To assess whether AKR1C may act as a prereceptor regulator of hormone activity by adjusting the availability of hormones to act with their cognate receptors, we recently demonstrated significant reduction of AKR1C2, which catalyzes reduction of dihydrotestosterone to the weak androgen 3{alpha}-androstanediol, in prostate cancer as compared with unaffected tissue (24) . We hypothesized that selective reduction of this key androgen-catabolizing gene would result in maintenance of intracellular levels of dihydrotestosterone in prostate tumors and thereby provide a selective growth advantage for these malignant cells. Because progesterone is likely to modify growth of breast cancer cells (4 , 5) , we now report the relative expression of three AKR1C family members in paired breast cancer and normal tissue samples using our recently developed real-time polymerase chain reaction (PCR) methodology (24) . Effects of small interfering RNA (siRNA) suppression of AKR1C1 alone or with AKR1C2 on progesterone metabolism and cellular proliferation were also determined in MCF-10A and T-47D cell lines, indicating that AKR1C1 and AKR1C2 may act as prereceptor regulators of PR activity. The significance of these findings has been extended to assess whether changes in expression of AKR1C family members could modify progesterone-dependent transcriptional activity of the mouse mammary tumor virus (MMTV) promoter by PR-B.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and Supplies.
All chemicals were of molecular biology grade or higher and were purchased from Sigma (St. Louis, MO), unless otherwise stated. Molecular biology reagents were purchased from Promega (Madison, WI), Roche Molecular Biochemicals (Indianapolis, IN), and Life Technologies, Inc. (Gaithersburg, MD). Cell culture supplies were purchased from Invitrogen (Carlsbad, CA).

Breast Tissues and RNA Extraction.
Human breast samples were processed according to our previously described method (24) . Twenty-four paired breast tumors and their paired surrounding unaffected tissues were selected from the University of Southern California/Norris Comprehensive Cancer Center (Los Angeles, CA) or Olive View-University of California Los Angeles Medical Center (Sylmar, CA) after institutional review board approval. Samples were fresh frozen in liquid nitrogen, and sections (5 µm) were subsequently reviewed by pathologists for pathological diagnosis along with immunohistochemistry staining for estrogen receptor (ER), PR, Ki-67, and Her2/neu status. Only paired samples in which breast tumors contained >90% tumor cells and normal tissue lacking any tumor cells were used. Clinical information and surgical pathology reports were available without any patient identifiers. The frozen tissues were homogenized with tissue pulverizers (Spectrum Laboratories, Rancho Dominguez, CA), and total RNA was prepared using the RNeasy Mini Kit (Qiagen, Valencia, CA) as described previously (24) .

Quantitative Real-Time Polymerase Chain Reaction Assay.
Real-time PCR for AKR1C1, AKR1C2, AKR1C3, and SRD5A1 was performed as described previously (24) . SRD5A1 (forward primer, 5'-ATCCTCCTGGCCATGTTCC-3'; reverse primer, 5'-TCGCATCAGAAACGGGTAAAT-3'; probe, fluorescein amidite-5'CGTCCACTACGGGCATCGGTGC-3'-black hole quencher) was designed using Primer Express version 2.0 software (Applied Biosystems, Foster City, CA). Random primed cDNA libraries were prepared for TaqMan quantitative PCR by using the Omniscript Kit (Qiagen) with random hexamers (Applied Biosystems), and relative expression was calculated as described previously (24) .

Cell Culture.
MCF-7, MCF-10A, T-47D, and PC-3 cell lines were all purchased from American Type Culture Collection (Rockville, MD). Cell lines were cultured in RPMI 1640 with 10% fetal bovine serum (FBS), except for MCF-10A, which was grown in Clonetics Mammary Epithelial Growth Medium (MEGM Bullet Kit, CC-3051, serum-free) supplemented with 100 ng/mL cholera toxin. Total RNA was isolated as described above for quantitative real-time PCR assays. Stable PC-3 prostate cancer cell lines expressing either AKR1C1, AKR1C2, or AKR1C3 were developed as described previously (24) and used to assess activation of MMTV luciferase reporter assays.

Development and Characterization of AKR1C Polyclonal Antibodies.
Polyclonal antibodies from rabbits for individual AKR1C family members were developed using peptides and recombinant protein as immunogens. An AKR1C3-specific antiserum was developed as described previously (25) using peptide sequence N-GLDRNLHYFNSDSFASHPNYPYS to generate antiserum {alpha}7548. Rabbits injected with the peptide N-FNHRLLEMIL(C) were used to generate antiserum {alpha}6621, which recognizes both AKR1C1 and AKR1C3, but not AKR1C2. Bacterial-expressed protein was used to immunize rabbits, and the resultant antisera, {alpha}1850, recognizes all family members (24) . Specificity of antisera was assessed by Western blots with lysates of PC-3 cell lines that stably express individual AKR1C family members. Western blots were performed as described previously (24) using a 1:2,000 dilution for all antisera.

Immunohistochemical Staining of Breast Tissues.
Immunohistochemical (IHC) staining was performed according to the previously described method (26) with the following modifications. Five-micrometer sections of paraffin-embedded breast tissues were cut and pretreated for 5 minutes with serum-free protein blocking solution (Dako, Carpinteria, CA) and then incubated with the primary antihuman AKR1C polyclonal antisera ({alpha}6621, {alpha}7548, or {alpha}1850) at 1:1,000 to 1:2,000 dilution overnight in a humidified chamber at 4°C. Slides were then incubated with antirabbit horseradish peroxidase secondary antibody, and color was developed using AEC Substrate Pack (NeoMarkers, Fremont, CA), according to the manufacturer’s protocols. Sections were counterstained with Meyer’s hematoxylin (NeoMarkers) and mounted in Glycergel (Dako). Both preimmune sera and peptide-preabsorbed antisera were used as controls for IHC staining specificity.

Suppression of AKR1C1 and/or AKR1C2 Expression by Small Interfering RNAs.
Four siRNAs were designed by Qiagen, and the resultant sequence was compared with the human genome to assess their cross-reactivity with other AKR1C family members. Ultimately, the following ARK1C1 sequences from M86609 were used and are listed with their percentage similarity to the other AKR1C family members expressed in human breast tissue: Seq-A, AAGCTTTAGAGGCCACCAAAT (85% sequence identity to both AKR1C2 and AKR1C3); Seq-B, AACTGCTGGATTTCTGCAAGT (100% sequence identity to AKR1C2 and 90% sequence identity to AKR1C3); Seq-C, AAAGCCAGGTGAGGAAGTGAT (100% sequence identity to AKR1C2 and 81% sequence identity to AKR1C3); and Seq-D, AAGGTCACTGAAAAATCTTCA (100% sequence identity with AKR1C2 and 71% sequence identity with AKR1C3). Transfection of siRNA (Qiagen) was performed according to the manufacturer’s protocol, and quantitative real-time PCR was used to monitor suppression of AKR1C family members.

MCF-10A cells (8 x 104) were seeded onto 6-well plates and grown for 24 hours to approximately 50% confluence. Small interfering RNAs (4.5 µg) were diluted in 100 µL of suspension buffer, vortexed, and mixed with 15 µL of RNAiFect. Cells were incubated with the samples for 5 to 10 minutes at room temperature, the medium was exchanged with 300 µL of growth medium, and then cells were allowed to recover for 24 hours. Nonsilencing fluorescein-labeled siRNA (Qiagen) was used as the control for siRNA transfections.

Progesterone Metabolism.
MCF-10A cells (8 x 104) were seeded in 6-well tissue culture plates and cultured 24 hours before siRNA transfections. Twenty-four hours after siRNA treatments, 0.2 mCi of [3H]progesterone (Perkin-Elmer Life Science, Boston, MA) was added to the media, and cells were then grown for an additional 16 hours. Medium and cells were harvested separately, and metabolites were separated by thin-layer chromatography. Aliquots (0.5 mL) of lysed cells and supernatants were extracted twice with ethyl acetate:hexane (3:2) and evaporated under nitrogen at 40°C to remove the solvent, and 10 µg of progesterone and 20{alpha}-dihydroprogesterone were added as carriers. Extracts were applied to a thin-layer chromatography chromatography plate (Silica gel 60F254 on 20 x 20-cm aluminum sheet; EM Science, Gibbstown, NJ) and run for 1.5 hours using chloroform:diethyl ether (10:3) as solvent mixture. Locations of progesterone and 20{alpha}-dihydroprogesterone were identified by ultraviolet light, the regions were scraped, and radioactivity was determined by liquid scintigraphy.

T-47D Proliferation Studies.
T-47D cells were grown in RPMI 1640 without phenol red with 4% charcoal dextran-treated FBS (HyClone, Logan, UT) and treated with different concentrations of progesterone [0.1% in ethanol (v/v)] or with 0.1% (v/v) ethanol as controls. Cell proliferation assays were performed as described previously (27 , 28) with the following modifications: Twenty-four hours before initiation of growth studies, cells were treated with siRNA as described above. A total of 1.5 x 104 cells were then seeded into 12-well tissue culture dishes from a common cell culture and grown for an additional 24 hours. Progesterone was then added, and half of the media was replaced on a daily basis. The number of cells in quadruplet wells was then determined daily with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay using Bio-Rad Microplate Reader Model 3550 (Bio-Rad, Hercules, CA) after a standard curve confirmed a linear relationship between cell number and absorbance.

PR-B–Dependent Transactivation Assay.
Permanently transfected PC-3 cell lines with varying stable expression levels of AKR1C1, AKR1C2, or AKR1C3 were used for progesterone-dependent transactivation experiments with cotransfection of human PR-B. These PC-3 cell lines were individually transiently transfected with 2 µg of pMMTV-Luc (kindly provided by Dr. Gerhard A. Coetzee, Keck School of Medicine at University of Southern California, Los Angeles, CA), 0.2 µg of pCMV-hPR-B expression plasmid (kindly provided by Dr. Michael R. Stallcup, Keck School of Medicine at University of Southern California), and 5 ng of Renilla luciferase plasmid pRL-SV40 (Promega) to control for transfection efficiency. Cells were transfected with 15 µL of SuperFect (Qiagen) in 600 µL of RPMI 1640 and allowed to recover for 36 hours in RPMI 1640 with 4% charcoal dextran-treated FBS. Cells were then washed with PBS and treated for 16 hours with 100 pmol/L progesterone in 4% charcoal dextran-treated fetal calf serum. Luciferase activity was measured using the Luminoskan Ascent instrument (Labsystems, Franklin, MA) and the Dual Luciferase Activity Kit (Promega). The ratio of firefly to Renilla luciferase activity was normalized to total protein, and luciferase activity of control PC-3 cells was arbitrarily defined as 100 ± SD.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Relative Expression Profile of AKR1C Family Members and SRD5A1 in Paired Breast Tissue Samples.
The relative expression profiles of AKR1C1, AKR1C2, AKR1C3, and SRD5A1 were determined in 24 paired breast cancer and normal tissue samples using RNase P as the internal control. RNase P expression was equivalent in tumor and normal tissue (data not shown). Table 1Citation lists the relative changes in gene expression for AKR1C family members and SRD5A1 in individual pairs of tissue samples, along with clinical features and PR, ER, Her2/neu, and Ki-67 status. A substantial (defined as >5-fold) decrease in AKR1C1 expression was found in 13 of 24 cases. AKR1C2 expression was absent in tumors or reduced in 6 of these 13 cases. AKR1C3 expression was only significantly reduced in one case without a significant decrease in AKR1C1. SRD5A1 expression was significantly decreased in only four cases and increased (>5-fold) in three cases, and no apparent relationship existed between reduced expression of SRD5A1 and that of AKR1C1. No consistent pattern was found in the expression profile for AKR1Cs or SRD5A1 and PR, ER, Her2/neu, or Ki-67 status. Thus, reduced gene expression of ARK1C1 appears to be unrelated to PR or ER status.


View this table:
[in this window]
[in a new window]

 
Table 1 Clinical features and changes in relative expression of AKR1C family members and SRD5A1 mRNAs in paired samples of breast tumors versus unaffected tissues

 
Development of AKR1C-Specific Antisera and Immunohistochemical Staining in Breast Tissue Samples.
Rabbits received injection with synthesized peptides to develop antisera that recognize specific family members, despite the high sequence homology of family members. Lysates harvested from permanently transfected PC-3 cells expressing AKR1C1, AKR1C3, or AKR1C2 (24) were used to assess specificity of rabbit antisera by Western blot. As illustrated in Fig. 1ACitation , {alpha}1850 recognized all transfected AKR1C family members expressed in PC-3 cells. We confirmed that {alpha}7548, designed according to Pelleiter et al. (25) , selectively recognized only ARK1C3, whereas {alpha}6621 recognized both AKR1C1 and AKR1C3, but not AKR1C2. As shown in Fig. 1BCitation , both {alpha}6621 and {alpha}7548, but not their preimmune sera, stained normal myoepithelial and luminal epithelial cells in the alveoli, which was blocked by preincubation with excess peptide, thereby confirming the specificity of IHC staining.



View larger version (99K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. IHC staining of {alpha}6621 and {alpha}7548 in paired breast cancer and normal tissue samples. A and B, specificity of {alpha}6621 and {alpha}7548 used for IHC localization of AKR1C family members in breast tissues. A. Specificity of antipeptide antibodies {alpha}6621 and {alpha}7548 compared with {alpha}1850, generated against the entire AKR1C1, was determined by Western blot using lysates (30 µg) from PC-3 cells stably expressing AKR1C1, AKR1C2, or AKR1C3 compared with nontransfected PC-3 cells. B. Specificity and localization of IHC staining with {alpha}6621 and {alpha}7548 was determined by respectively staining normal breast tissue from samples BN13 and BN9 with preimmune, immune, and immune sera preabsorbed with corresponding peptides. Absence of staining with preimmune sera and by preabsorption of sera with peptide confirms the specificity of IHC staining for each antiserum. C–F, comparison between IHC staining of {alpha}6621 and {alpha}7548 in paired breast tissues and mRNA levels. C. Tissue localization of AKR1C1 was determined in paired samples BN6 and BT6 because neither tumor nor normal tissue expressed AKR1C3. {alpha}7548 lacked IHC staining, confirming the absence of AKR1C3. In normal tissue, {alpha}6621 staining is seen on myoepithelial and luminal epithelial cells, which is lost in the corresponding tumor sample. Real-time PCR data for each of the IHC samples are listed to compare IHC staining with relative changes in mRNA expression. Relative changes in AKR1C1 or AKR1C3 expression in tumor as compared with unaffected tissue are included (–, reduced tumor expression; ND, not detectable). D, decreased {alpha}6621 staining in two pairs of samples in which AKR1C3 staining and gene expression are minimally affected. Staining with {alpha}6621 paralleled changes in gene expression for AKR1C1, whereas {alpha}7548 staining remained relatively unchanged. E, IHC staining with {alpha}6621 in two paired tissue samples that express varying amounts of AKR1C1 and AKR1C3. F, IHC staining of {alpha}7548 in paired tissue samples that express varying amounts of AKR1C3.

 
As illustrated in Fig. 1BCitation , IHC staining with both {alpha}6621 and {alpha}7548 revealed predominant staining on the myoepithelial and luminal epithelial cells. Because {alpha}6621 cross-reacts with both AKR1C1 and ARK1C3, selective localization for AKR1C1 was determined in paired BT6 and BN6 tissue samples that lacked AKR1C3 expression. In Fig. 1CCitation , no IHC staining with {alpha}7548 was observed, confirming the lack of expression of AKR1C3. IHC staining with {alpha}6621, which could only correspond to AKR1C1, was localized on the myoepithelial and luminal epithelial cells. Endothelial cells were also stained with this antiserum (data not shown). Decreased IHC staining was observed on the corresponding tumor sample, in close agreement with the 48-fold decrease in relative expression of AKR1C1. Thus, AKR1C1 is normally expressed in the same location as AKR1C3, with staining observed on a majority of myoepithelial and luminal epithelial cells, the latter being the same site of PR expression (3 , 29) .

IHC staining with {alpha}6621 and {alpha}7548 was then performed on all available samples to determine the relationship between relative gene expression profile and protein levels. Fig. 1DCitation illustrates two examples of paired tissue samples in which AKR1C1 mRNA expression was reduced or absent in tumor samples associated with minimal changes in AKR1C3. Decreased staining of {alpha}6621 in both cases corresponds with AKR1C1 expression levels, whereas {alpha}7548 staining for AKR1C3 was unchanged in accordance with the real-time PCR data. These cases suggest that decreased {alpha}6621 staining closely parallels AKR1C1 mRNA expression patterns and confirm the selectivity of {alpha}7548 IHC staining for AKR1C3. Fig. 1ECitation demonstrates additional cases in which {alpha}6621 IHC staining matches AKR1C1 expression but not ARK1C3 expression. Finally, Fig. 1FCitation confirms that {alpha}7548 staining corresponds with relative changes in AKR1C3 expression. Pathologists, who were unaware of relative expression patterns, then independently compared the IHC staining intensity of {alpha}6621 and {alpha}7548 for all available cases. Table 2Citation demonstrates that approximately two thirds of the {alpha}7548 and {alpha}6621 IHC staining corresponded with relative expression of AKR1C1 and AKR1C3. Taken together, these findings confirm that decreased expression of AKR1C1 mRNA identified in the tumor samples closely corresponds with loss of protein expression. Due to the lack of AKR1C2-specific antisera, we suspect (but cannot confirm) that decreased AKR1C2 mRNA will be associated with loss of protein expression.


View this table:
[in this window]
[in a new window]

 
Table 2 Immunohistochemical staining of {alpha}6621 and {alpha}7548 in paired breast samples compared with AKR1C1 and AKR1C3 gene expression profile.

 
Reduced Relative Expression of AKR1C1 in Human Breast Cancer Cell Lines.
Gene and protein levels of AKR1Cs were determined in the established human breast cancer cell lines MCF-7 and T-47D as well as in human breast epithelial cell line MCF-10A (30) . As shown in Fig. 2ACitation , significantly less AKR1C1 was found in MCF-7 and T-47D cell lines as compared with MCF-10A, whereas AKR1C3 was equivalently expressed in all cell lines. {alpha}7548 Western blot data in Fig. 2BCitation confirmed that AKR1C3 was equally expressed in all cell lines, whereas use of {alpha}6621 showed significantly less AKR1C1 expression in MCF-7 and T-47D cell lines as compared with MCF-10A, which paralleled the AKR1C1 gene expression profile.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Suppression of AKR1C1 and AKR1C1/AKR1C2 in T-47D cells enhanced progesterone-mediated inhibition of cellular growth. A and B, reduced expression of AKR1C1 in established breast cancer cell lines. Expression levels of AKR1C1 and AKR1C3 in the breast cancer cell lines MCF-7 and T-47D and breast epithelial cell line MCF-10A were determined at both the mRNA and protein levels by real-time PCR and Western blot. A. Relative expression of AKR1C1 and AKR1C3 was determined using real-time PCR in triplicate compared with relative levels of MCF-7 cells (arbitrarily defined as 1 ± SD). Relative expression is compared with a normal breast tissue. Substantially lower AKR1C1 levels were found in MCF-7 and T-47D breast cancer cell lines as compared with breast epithelial cell line MCF-10A and a normal breast tissue. No substantial changes in AKR1C3 expression were noted in all three cell lines. B. Protein levels in breast cell lines were determined by Western blot with {alpha}7548 and {alpha}6621. Relative equivalent amounts of AKR1C3 were found in all three cell lines, whereas decreased expression of AKR1C1 was found in MCF-7 and T-47D compared with MCF-10A. C–E. Suppression of AKR1C1 alone or with AKR1C2 reduces formation of 20{alpha}-dihydroprogesterone from progesterone in MCF-10A. C. AKR1C1-specific siRNA (Seq-A) substantially suppressed AKR1C1 expression but not AKR1C2 and AKR1C3 in MCF-10A cells compared with nonspecific siRNA (Ns)-treated MCF- 10A cells as a control. The other siRNA (Seq-D) was able to significantly suppress both AKR1C1 and AKR1C2 as compared with nonspecific siRNA-treated MCF-10A cells. AKR1C3 expression was relatively unaltered by either siRNA. D. Production of 20{alpha}-dihydroprogesterone from progesterone in MCF-10A cells treated with AKR1C1-specific siRNA (Seq-A) or AKR1C1/AKR1C2-specific siRNA (Seq-D) was able to substantially reduce 20{alpha}-dihydroprogesterone in both media and cell lysates. Note that the majority of the metabolite was distributed in the media. E. Decrease in 20{alpha}-dihydroprogesterone is associated with increased progesterone in siRNA-treated cells. Suppression of both AKR1C1 and AKR1C2 leads to more unmetabolized progesterone in both cell lysates and media. F–I. Suppression of AKR1C1 and AKR1C1/AKR1C2 in T-47D cells enhanced the suppression of cellular proliferation by progesterone. F. AKR1C1-specific siRNA (Seq-A) selectively suppressed AKR1C1 with minimal reduction of AKR1C2, whereas siRNA (Seq-D) suppressed both AKR1C1 and AKR1C2 in T-47D cells. AKR1C3 expression was not affected with either treatment. G. Cellular proliferation of T-47D treated with siRNA (Ns, nonspecific siRNA) demonstrated no significant changes in cellular growth with suppressed AKR1C1 alone or with suppressed AKR1C2 expression when progesterone was not presented. H and I. Growth of T-47D cells with siRNA treatments in the presence of 10–10 (H) or 10–9 mol/L (I) progesterone demonstrated a substantial decrease in cell numbers, with loss of AKR1C1 alone or in combination with AKR1C2. Concentrations of 10–10 and 10–9 mol/L progesterone were selected based on our pilot study of the effects of progesterone on T-47D growth inhibition. It confirmed that 10–11 and 10–8 mol/L progesterone had effects on T-47D growth inhibition similar to published studies (refs. 41 , 42 ; data not shown).

 
Progesterone Metabolism Catalyzed by AKR1C1 and AKR1C2.
To assess the role of AKR1C1 and AKR1C2 on progesterone metabolism, siRNAs were developed. Pilot results showed that Seq-A selectively suppressed AKR1C1, whereas Seq-D suppressed both AKR1C1 and AKR1C2 without affecting expression of AKR1C3, as illustrated in Fig. 2CCitation . The ability of these two siRNAs to alter progesterone metabolism was then monitored in MCF-10A cells, which express levels of AKR1C1 comparable with those found in normal tissue. In Fig. 2D and ECitation , suppression of AKR1C1 in MCF-10A cells significantly reduced the conversion of progesterone to 20{alpha}-dihydroprogesterone in media and cell lysates.

Suppression of AKR1C1 and AKR1C2 leads to additional and significant inhibition of 20{alpha}-dihydroprogesterone formation. This reduction in 20{alpha}-dihydroprogesterone correlated with a significant increase in progesterone in both media and cell lysates.

Suppression of AKR1C1 Alone or with ARK1C2 Affects Progesterone-Mediated Inhibition of Cellular Growth of T-47D.
To assess potential loss of AKR1C1 and AKR1C2 on progesterone-dependent growth, siRNA suppression of AKR1C1 and AKR1C1/AKR1C2 in T-47D cells was determined because they endogenously express PRs. In Fig. 2FCitation , suppression of AKR1C1 alone or with AKR1C2 is illustrated. The same cells were then used for proliferation assays with progesterone treatments. As shown in Fig. 2GCitation , no significant changes were found in those cell lines treated with siRNAs in the absence of progesterone In Fig. 2H and ICitation , progressive inhibition of cellular proliferation was observed with suppression of both AKR1C1 and AKR1C1/AKR1C2 in the presence of 10–9 or 10–10 mol/L progesterone, suggesting that reduced metabolism of progesterone in T-47D is responsible for progesterone-mediated inhibition of cellular growth.

Inhibition of Progesterone-Dependent Transactivation by AKR1C1 and AKR1C2.
To determine whether progesterone catabolism can alter PR-B ligand-dependent activity, the activity of a MMTV luciferase reporter gene was evaluated in the prostate cancer cell line PC-3 stably expressing AKR1C1, AKR1C2, or AKR1C3. These cells, along with PC-3 cells stably transfected with vector alone, were transiently transfected with pCMV-hPR-B, a luciferase reporter driven by the MMTV promoter, as well as a Renilla luciferase to control for transfection efficiency. In the absence of progesterone or PR-B, no activity was detectable (data not shown). In Fig. 3ACitation , two different expression levels of AKR1C1 and AKR1C2, but not AKR1C3, in PC-3 cells were able to inhibit progesterone-dependent activation of the MMTV promoter, indicating that AKR1C1 and AKR1C2 metabolize progesterone to weaker activators of PR-B (17) . Despite low levels of AKR1C1 expression, AKR1C1 completely inhibited luciferase activity, confirming that 20{alpha}-HSD can effectively block PR-B activation. Despite adequate levels of AKR1C3, AKR1C3 failed to inhibit progesterone-dependent activation, confirming that progesterone is a poor substrate for AKR1C3. These findings were extended to T-47D, which endogenously expresses PRs. As shown in Fig. 3BCitation , different amounts of AKR1C1 plasmid transfected into T-47D cells together with MMTV luciferase reporter plasmid significantly inhibited luciferase activity.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Effect of AKR1C1, AKR1C2, and AKR1C3 on PR-B–dependent transactivation of MMTV promoter. A. Prostate cancer PC-3 cell lines stably expressing different amounts of AKR1C1, AKR1C2, and AKR1C3 as determined by Western blot with {alpha}1850, along with vector-transfected PC-3 cell line as a negative control, were transiently transfected with pMMTV-Luc (2 µg), pCMV-hPR-B expression plasmid (0.2 µg), and Renilla luciferase plasmid pRL-SV40 (5 ng) to control for transfection efficiency. Progesterone (100 pmol/L) was used to treat transfected cells for 16 hours before luciferase assays. Ratio of firefly to Renilla luciferase activities was normalized to total protein to compare relative promoter activity from different cell lines. Luciferase activity of control PC-3 cells was arbitrarily defined as 100 ± SD in three independent experiments performed in triplicate. Relative luciferase activities of modified PC-3 cell lines expressing different levels of AKR1C family members are compared with those of control PC-3 cells. Statistical significance was determined by comparing changes in luciferase activity of the PC-3 cells expressing AKR1C family members versus PC-3 control cells using Student’s t test. B. T-47D was used to confirm the findings presented in A by transient transfection with pMMTV-Luc (1 µg) and two concentrations of pSVL-AKR1C1 using 100 pmol/L progesterone for 16 hours before luciferase assays. Luciferase activity of control T-47D cells was arbitrarily defined as 100 ± SD in two independent experiments performed in triplicate. Relative luciferase activity of the T-47D cell line transfected with different amounts AKR1C1 plasmid was compared with control cells. Student’s t test compared changes in luciferase activities between each T-47D cell line transfected with AKR1C1 and the T-47D control.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Catabolism of steroid hormones can modulate availability of critical ligands for their cognate transcription factors and thereby function as effective prereceptor regulators of gene expression. This type of regulation is best characterized for the mineralocorticoid receptor, in which selective expression of 11ß-hydroxysteroid dehydrogenase type II in aldosterone target tissue prevents inappropriate activation of the mineralocorticoid receptor by cortisol (31) . A similar paradigm is also developing for the prereceptor regulation of progesterone activity by AKR1C1 (17 , 31) . For example, as the human placenta comes to term, increased 20{alpha}-HSD (but not 3{alpha}-HSD or 17ß-hydroxysteroid dehydrogenase) activity is observed, implicating it as the major catabolic pathway for progesterone elimination (15 , 16) . Besides the placenta, studies in the human kidney further support this concept because expression of AKR1C1 protects the mineralocorticoid receptor from binding with progesterone, an effective aldosterone antagonist (32 , 33) . This may be especially important during pregnancy, when serum progesterone levels may reach up to 300 to 700 nmol/L by the end of the third trimester (34) . The function of AKR1C1 in the kidney may thus imitate that of 11ß-hydroxysteroid dehydrogenase type II to prevent inappropriate occupation of ligand-dependent transcription factor.

We initially assessed the relative expression of ARK1C1 and two highly related family members using a gene-specific real-time PCR. Although mRNA levels of the AKR1C family members had been quantified by semiquantitative reverse transcription-PCR and RNase protection methods (35 , 36) , real-time PCR provides a reliable and highly reproducible method to monitor large changes in relative gene expression. On average, we noticed that approximately half of the 24 cases demonstrated a substantial loss of AKR1C1 expression, defined as a >5-fold reduction in tumor as compared with paired unaffected tissue. A similar reduction in AKR1C2 expression was also found in half of these cases, whereas AKR1C3 expression was relatively unchanged. Reduction in AKR1C1 expression was observed in a previous microarray study of human breast cancer, and loss of 20{alpha}-HSD activity occurs in 7,12- dimethylbenz(a)anthracene-induced breast tumors in rats (37 , 38) . Others reported a similar reduction in AKR1C1 and AKR1C2 gene expression by reverse transcription-PCR in nine breast cancer tumors as compared with unaffected surrounding tissue from the same individuals (39) . They also noted a significant increase in SRD5A1 expression in tumors as compared with normal breast tissues in contrast to our findings, which may be due to differences in the tissue sample pool sizes, stage of tumor samples, and accuracy of the RNA quantitative techniques. We confirmed that decreased protein expression of AKR1C1 was associated with the previously reported reduction in AKR1C1 gene expression in the MCF-7 and T-47D breast cancer cell lines in contrast to the breast epithelial cell line MCF-10A (35) . This pattern differed from that of AKR1C3, which was equally expressed in all cell lines. Furthermore, reduced AKR1C1 and AKR1C2 expression in MCF-10A cells by siRNA suppression leads to decreased production of 20{alpha}-hydroxyl or 3{alpha}-hydroxyl progesterone metabolites. Thus, decreased expression of AKR1C1 and AKR1C2 observed in human samples is mimicked in certain breast cancer cell lines, which will prove useful for future studies on the AKR1C gene family.

Cellular localization of specific AKR1C members is difficult to determine due to their high sequence similarity. Immunohistochemistry with AKR1C3-specific antiserum {alpha}7548 prominently stained myoepithelial and luminal epithelial cells as observed previously (25) , and AKR1C1 was localized to the same epithelial layers in samples that lacked ARK1C3 expression (25) . Although {alpha}6621 was able to recognize both AKR1C1 and AKR1C3 using the Western blot technique, {alpha}6621 IHC staining closely matched AKR1C1 gene expression, and {alpha}6621 IHC staining could be used to evaluate relative AKR1C1 expression in pathological samples.

The MCF-10A cell line was used to assess the physiologic function of AKR1C1 because it expresses AKR1C1 at levels comparable with those found in normal breast tissues. Selective reduction of AKR1C1 by siRNA suppression in MCF-10A leads to a decrease in conversion of progesterone to 20{alpha}-dihydroprogesterone, present in both cell lysate and media, which was further reduced with loss of AKR1C2. Substantial decrease in 20{alpha}-dihydroprogesterone production was associated with a corresponding increase in progesterone levels in MCF-10A cells. Progesterone-mediated inhibition of growth in T-47D cells was also observed with suppression of AKR1C1, which was further enhanced in the absence of AKR1C2 expression. The loss of these catabolic enzymes in breast cancer presumably leads to increased progesterone levels, which, in combination with increased PR, could enhance progesterone-responsive gene expression.

Confounding findings have been reported in the literature on the proliferative effects of progesterone in established human breast cell lines, with a majority of studies reporting growth-inhibitory effects (6 , 28 , 40, 41, 42, 43) . However, progesterone was found to cause cells to enter one mitotic cycle with induction of genes associated with cell growth (44 , 45) . Although progestins are proliferative when administered in a transient or sequential manner, sustained treatment results in growth arrest (46) . Our data demonstrated that suppression of AKR1C1 or AKR1C1 and AKR1C2 can significantly inhibit cellular proliferation by progesterone as compared with control cell lines.

The role of progesterone as an antiproliferative agent in cell lines does not mimic its function in vivo. A majority of studies in animals and humans find that progestin treatment promotes growth in vivo (40 , 47 , 48) . In the recent Women Health Initiative Study, increased incidence of total and invasive breast cancer was observed in the estrogen + progestin group as compared with the placebo group (7) . The risks of invasive lobular carcinoma and invasive ductal carcinoma were also significantly increased among women who used combined estrogen + progestin therapy (with continuous or sequential progestin use), but not among those who solely used estrogen therapy (49) , strongly implicating progesterone in combination with estrogen as stimulating cellular proliferation.

To explain how loss of AKR1C1 and AKR1C2 expression could modify progesterone-dependent PR-B activation, a progesterone-dependent MMTV reporter activity was monitored in two different cell lines. Prostate cancer PC-3 cells stably expressing either AKR1C1 or AKR1C2, but not AKR1C3, were able to reduce progesterone-dependent transactivation of the MMTV reporter construct with cotransfected PR-B. AKR1C1 was able to completely inhibit progesterone-dependent activity, despite its low level of expression. Increasing concentrations of progesterone were able to overcome this kind of inhibition (data not shown), indicating that metabolism, not some nonspecific process, is responsible for reduced PR-B activation. Studies in the T-47D cell line confirmed that AKR1C1 was able to inhibit progesterone-dependent PR-B activation in a breast-derived cell line. In addition to 20{alpha}-HSD, the 3{alpha}-HSD of AKR1C2 can also inhibit progesterone-dependent activation of PR-B, although not as effectively as AKR1C1.

In normal breast tissues, AKR1C1 is localized predominately in the myoepithelial cells and in the luminal epithelial cells, which also express PR (3 , 50) . We speculate that expression of AKR1C1 and possibly AKR1C2 in normal tissue may regulate progesterone-dependent gene expression by limiting progesterone’s interactions with nuclear PRs. This observation resembles our recent finding of selective reduction in AKR1C2 expression, but not ARK1C3, in prostate cancer samples (24) , suggesting that specific yet highly related AKR1C family members can act as prereceptor regulators for ligand-dependent transcription factors. Thus, AKR1C1 may limit progesterone-dependent signaling of nuclear PRs and thereby indirectly regulate gene expression. This is compatible with the role of AKR1C1 to limit the inhibitory interactions of progesterone with mineralocorticoid receptor.

We hypothesize that loss of key catabolic enzymes in breast cancer tissues in combination with increased expression of PR may enhance progesterone-dependent gene expression. In addition to increased progesterone levels and differences in progesterone metabolites as a result of loss of AKR1C1 or AKR1C2, changes in relative expression of PR-A and PR-B in breast cancer could also alter the spectrum of progesterone-regulated genes (51) . Wiebe et al. (28 , 35) have also reported a differential effect of specific progesterone metabolites as either growth promoters or inhibitors of the cell cycle in the MCF-7 cell line, suggesting a specific role for progesterone metabolites. The appearance of specific progesterone metabolite binding sites on MCF-7 membranes further supports a role for progesterone metabolites as signaling molecules (52) . Thus, metabolites of progesterone may also have unsuspected effects on cell growth. Fig. 4Citation illustrates the potential role of AKR1C1 and AKR1C2 functioning as a prereceptor regulator of progesterone interactions with PRs. Loss of AKR1C1 in combination with increased PR in selective breast cancers could therefore provide therapeutic opportunities to block ligand-dependent activation of PRs by using antiprogestational agents.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Potential role of AKR1C1 as prereceptor regulator of progesterone-dependent gene expression. Potential role of AKR1C1 in regulating availability of progesterone ({bullet}) to interact with nuclear PRs by shunting a certain percentage of progesterone to metabolites ({triangleup}) that are weaker transcriptional activators and thereby reduce PR signaling by progesterone.

 


    ACKNOWLEDGMENTS
 
We thank Dr. Mike Stallcup and Dr. Michael Press (Keck School of Medicine at University of Southern California) for their thoughtful discussions and review of the manuscript.


    FOOTNOTES
 
Grant support: University of Southern California/Norris Comprehensive Cancer Center grant 5P30 CA14089–29 from the National Cancer Institute; Robert E. and Mary R. Wright Foundation; Margaret E. Early Medical Research Foundation; and University of Southern California Research Center for Liver Disease DK98-016. This work was presented in part at the 85th ENDO Annual Meeting in Philadelphia, Pennsylvania on June 21, 2003.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Andrew Stolz, Hoffman Medical Research, Room 101A, 2011 Zonal Avenue, Los Angeles, CA 90033. Phone: 323-442-2699; Fax: 323-442-5425; E-mail: astolz{at}hsc.usc.edu

Received 5/11/04. Revised 7/12/04. Accepted 8/11/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ross RK, Paganini-Hill A, Wan PC, et al Effect of hormone replacement therapy on breast cancer risk: estrogen versus estrogen plus progestin. J Natl Cancer Inst (Bethesda) 2000;92:328-32.[Abstract/Free Full Text]
  2. Pike MC, Spicer DV, Dahmoush L, et al Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiol Rev 1993;15:17-35.[Free Full Text]
  3. Soyal S, Ismail PM, Li J, et al Progesterone’s role in mammary gland development and tumorigenesis as disclosed by experimental mouse genetics. Breast Cancer Res 2002;4:191-6.[CrossRef][Medline]
  4. Lange CA, Richer JK, Horwitz KB Hypothesis: progesterone primes breast cancer cells for cross-talk with proliferative or antiproliferative signals. Mol Endocrinol 1999;13:829-36.[Free Full Text]
  5. Pasqualini JR, Paris J, Sitruk-Ware R, et al Progestins and breast cancer. J Steroid Biochem Mol Biol 1998;65:225-35.[CrossRef][Medline]
  6. Clarke CL, Sutherland RL Progestin regulation of cellular proliferation. Endocr Rev 1990;11:266-301.[Abstract/Free Full Text]
  7. Chlebowski RT, Hendrix SL, Langer RD, et al Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women’s Health Initiative Randomized Trial. JAMA 2003;289:3243-53.[Abstract/Free Full Text]
  8. Rossouw JE, Anderson GL, Prentice RL, et al Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative Randomized Controlled Trial. JAMA 2002;288:321-33.[Abstract/Free Full Text]
  9. Zhu BT, Conney AH Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis (Lond) 1998;19:1-27.[Abstract/Free Full Text]
  10. Harada N Aromatase and intracrinology of estrogen in hormone-dependent tumors. Oncology (Basel) 1999;57(Suppl 2):7-16.
  11. Sasano H, Suzuki T, Harada N From endocrinology to intracrinology. Endocr Pathol 1998;9:9-20.[Medline]
  12. Chen S, Zhou D, Okubo T, et al Prevention and treatment of breast cancer by suppressing aromatase activity and expression. Ann N Y Acad Sci 2002;963:229-38.[Medline]
  13. Stocco CO, Zhong L, Sugimoto Y, et al Prostaglandin F2 alpha-induced expression of 20alpha-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 2000;275:37202-11.[Abstract/Free Full Text]
  14. Wiest WG, Kidwell WR, Balogh K Progesterone catabolism in the rat ovary: a regulatory mechanism for progestational potency during pregnancy. Endocrinology 1968;82:844-59.[Abstract/Free Full Text]
  15. Milewich L, Gant NF, Schwarz BE, et al Initiation of human parturition. IX. Progesterone metabolism by placentas of early and late human gestation. Obstet Gynecol 1978;51:278-80.[Medline]
  16. Diaz-Zagoya JC, Wiest WG, Arias F Metabolism of progesterone by placentas from several mammalian species in vitro. Am J Obstet Gynecol 1979;135:809-13.[Medline]
  17. Penning TM Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr Rev 1997;18:281-305.[Abstract/Free Full Text]
  18. Vergnes L, Phan J, Stolz A, et al A cluster of eight hydroxysteroid dehydrogenase genes belonging to the aldo-keto reductase supergene family on mouse chromosome 13. J Lipid Res 2003;44:503-11.[Abstract/Free Full Text]
  19. Wilks JW, Spilman CH, Campbell JA Steroid binding specificity of the hamster uterine progesterone receptor. Steroids 1980;35:697-706.[CrossRef][Medline]
  20. Hara A, Matsuura K, Tamada Y, et al Relationship of human liver dihydrodiol dehydrogenases to hepatic bile-acid-binding protein and an oxidoreductase of human colon cells. Biochem J 1996;313:373-6.
  21. Higaki Y, Usami N, Shintani S, et al Selective and potent inhibitors of human 20alpha-hydroxysteroid dehydrogenase (AKR1C1) that metabolizes neurosteroids derived from progesterone. Chem Biol Interact 2003;143–144:503-13.
  22. Zhang Y, Dufort I, Rheault P, et al Characterization of a human 20alpha-hydroxysteroid dehydrogenase. J Mol Endocrinol 2001;25:221-8.
  23. Lou H, Hammond L, Sharma V, et al Genomic organization and chromosomal localization of a novel human hepatic dihydrodiol dehydrogenase with high affinity bile acid binding. J Biol Chem 1994;269:8416-22.[Abstract/Free Full Text]
  24. Ji Q, Chang L, VanDenBerg D, et al Selective reduction of AKR1C2 in prostate cancer and its role in DHT metabolism. Prostate 2003;54:275-89.[CrossRef][Medline]
  25. Pelletier G, Luu-The V, Tetu B, et al Immunocytochemical localization of type 5 17beta-hydroxysteroid dehydrogenase in human reproductive tissues. J Histochem Cytochem 1999;47:731-8.[Abstract/Free Full Text]
  26. Han YP, Nien YD, Garner WL Recombinant human platelet-derived growth factor and transforming growth factor-beta mediated contraction of human dermal fibroblast populated lattices is inhibited by Rho/GTPase inhibitor but does not require phosphatidylinositol-3' kinase. Wound Repair Regen 2002;10:169-76.[CrossRef][Medline]
  27. Syed V, Ulinski G, Mok SC, et al M. Expression of gonadotropin receptor and growth responses to key reproductive hormones in normal and malignant human ovarian surface epithelial cells. Cancer Res 2001;61:6768-76.[Abstract/Free Full Text]
  28. Wiebe JP, Muzia D, Hu J, et al The 4-pregnene and 5alpha-pregnane progesterone metabolites formed in nontumorous and tumorous breast tissue have opposite effects on breast cell proliferation and adhesion. Cancer Res 2000;60:936-43.[Abstract/Free Full Text]
  29. Anderson E The role of oestrogen and progesterone receptors in human mammary development and tumorigenesis. Breast Cancer Res 2002;4:197-201.[CrossRef][Medline]
  30. Soule HD, Maloney TM, Wolman SR, et al Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res 1990;50:6075-86.[Abstract/Free Full Text]
  31. Tomlinson JW, Stewart PM Cortisol metabolism and the role of 11beta-hydroxysteroid dehydrogenase. Best Pract Res Clin Endocrinol Metab 2001;15:61-78.[CrossRef][Medline]
  32. Bumke-Vogt C, Bahr V, Diederich S, et al Expression of the progesterone receptor and progesterone-metabolising enzymes in the female and male human kidney. J Endocrinol 2002;175:349-64.[Abstract]
  33. Quinkler M, Johanssen S, Bumke-Vogt C, et al Enzyme-mediated protection of the mineralocorticoid receptor against progesterone in the human kidney. Mol Cell Endocrinol 2001;171:21-4.[CrossRef][Medline]
  34. Johansson ED, Jonasson LE Progesterone levels in amniotic fluid and plasma from women. I. Levels during normal pregnancy. Acta Obstet Gynecol Scand 1971;50:339-43.[Medline]
  35. Wiebe JP, Lewis MJ Activity and expression of progesterone metabolizing 5alpha-reductase, 20alpha-hydroxysteroid oxidoreductase and 3alpha(beta)-hydroxysteroid oxidoreductases in tumorigenic (MCF-7, MDA-MB-231, T-47D) and nontumorigenic (MCF-10A) human breast cancer cells. BMC Cancer 2003;3:9[CrossRef][Medline]
  36. Burczynski ME, Lin HK, Penning TM Isoform-specific induction of a human aldo-keto reductase by polycyclic aromatic hydrocarbons (PAHs), electrophiles, and oxidative stress: implications for the alternative pathway of PAH activation catalyzed by human dihydrodiol dehydrogenase. Cancer Res 1999;59:607-14.[Abstract/Free Full Text]
  37. Perou CM, Jeffrey SS, Van de Rijn M, et al Distinctive gene expression patterns in human mammary epithelial cells and breast cancers. Proc Natl Acad Sci USA 1999;96:9212-7.[Abstract/Free Full Text]
  38. Mori M, Tominaga T, Tamaoki BI Steroid metabolism in normal mammary gland and in the dimethylbenzanthracene-induced mammary tumor of rats. Endocrinology 1978;102:1387-97.[Abstract/Free Full Text]
  39. Lewis MJ, Wiebe JP, Heathcote JG Expression of progesterone metabolizing enzyme genes (AKR1C1, AKR1C2, AKR1C3, SRD5A1, SRD5A2) is altered in human breast carcinoma. BMC Cancer 2004;4:27[CrossRef][Medline]
  40. Horwitz KB The molecular biology of RU486. Is there a role for antiprogestins in the treatment of breast cancer?. Endocr Rev 1992;13:146-63.[Abstract/Free Full Text]
  41. Schoonen WG, Joosten JW, Kloosterboer HJ Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells. II. T47D cell lines. Steroid Biochem Mol Biol 1995;55:439-44.
  42. Schoonen WG, Joosten JW, Kloosterboer HJ Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells. I. MCF-7 cell lines. Steroid Biochem Mol Biol 1995;55:423-37.
  43. Lin VC, Ng EH, Aw SE, Tan MG, et al Progestins inhibit the growth of MDA-MB-231 cells transfected with progesterone receptor complementary DNA. Clin Cancer Res 1999;5:395-403.[Abstract/Free Full Text]
  44. Musgrove EA, Lee CS, Sutherland RL Progestins both stimulate and inhibit breast cancer cell cycle progression while increasing expression of transforming growth factor alpha, epidermal growth factor receptor, c-fos, and c-myc genes. Mol Cell Biol 1991;11:5032-43.[Abstract/Free Full Text]
  45. Hissom JR, Moore MR Progestin effects on growth in the human breast cancer cell line T-47D: possible therapeutic implications. Biochem Biophys Res Commun 1987;145:706-11.[CrossRef][Medline]
  46. Eden J Progestins and breast cancer. Am J Obstet Gynecol 2003;188:1123-31.[CrossRef][Medline]
  47. Longacre TA, Bartow SA A correlative morphologic study of human breast and endometrium in the menstrual cycle. Am J Surg Pathol 1986;10:382-93.[CrossRef][Medline]
  48. Graham JD, Clarke CL Physiological action of progesterone in target tissues. Endocr Rev 1997;18:502-19.[Abstract/Free Full Text]
  49. Li CI, Malone KE, Porter PL, et al Relationship between long durations and different regimens of hormone therapy and risk of breast cancer. JAMA 2003;289:3254-63.[Abstract/Free Full Text]
  50. Conneely OM, Mulac-Jericevic B, DeMayo F, et al Reproductive functions of progesterone receptors. Recent Prog Horm Res 2002;57:339-55.[Abstract/Free Full Text]
  51. Richer JK, Jacobsen BM, Manning NG, et al Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J Biol Chem 2002;277:5209-18.[Abstract/Free Full Text]
  52. Weiler PJ, Wiebe JP Plasma membrane receptors for the cancer-regulating progesterone metabolites, 5alpha-pregnane-3,20-dione and 3alpha-hydroxy-4-pregnen-20-one in MCF- 7 breast cancer cells. Biochem Biophys Res Commun 2000;272:731-7.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am J EpidemiolHome page
K. W. Reding, C. I. Li, N. S. Weiss, C. Chen, C. S. Carlson, D. Duggan, K. E. Thummel, J. R. Daling, and K. E. Malone
Genetic Variation in the Progesterone Receptor and Metabolism Pathways and Hormone Therapy in Relation to Breast Cancer Risk
Am. J. Epidemiol., November 15, 2009; 170(10): 1241 - 1249.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Z. Steiner, L. Chang, Q. Ji, M. Ookhtens, A. Stolz, R. J. Paulson, and F. Z. Stanczyk
3{alpha}-Hydroxysteroid Dehydrogenase Type III Deficiency: A Novel Mechanism for Hirsutism
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1298 - 1303.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Q. Ji, L. Chang, F. Z. Stanczyk, M. Ookhtens, A. Sherrod, and A. Stolz
Impaired Dihydrotestosterone Catabolism in Human Prostate Cancer: Critical Role of AKR1C2 as a Pre-Receptor Regulator of Androgen Receptor Signaling
Cancer Res., February 1, 2007; 67(3): 1361 - 1369.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Yee, V. Balsanek, D. R. Bauman, T. M. Penning, and D. Sames
Fluorogenic metabolic probes for direct activity readout of redox enzymes: Selective measurement of human AKR1C2 in living cells
PNAS, September 5, 2006; 103(36): 13304 - 13309.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J. P Wiebe
Progesterone metabolites in breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 717 - 738.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. Lou, S. Du, Q. Ji, and A. Stolz
Induction of AKR1C2 by Phase II Inducers: Identification of a Distal Consensus Antioxidant Response Element Regulated by NRF2
Mol. Pharmacol., May 1, 2006; 69(5): 1662 - 1672.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
T. Suzuki, Y. Miki, Y. Nakamura, T. Moriya, K. Ito, N. Ohuchi, and H. Sasano
Sex steroid-producing enzymes in human breast cancer
Endocr. Relat. Cancer, December 1, 2005; 12(4): 701 - 720.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, Q.
Right arrow Articles by Stolz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, Q.
Right arrow Articles by Stolz, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online