Cancer Research Meeting Calendar  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pascale, E.
Right arrow Articles by D’Ambrosio, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pascale, E.
Right arrow Articles by D’Ambrosio, E.
[Cancer Research 64, 7702-7705, November 1, 2004]
© 2004 American Association for Cancer Research


Advances in Brief

Tumor Cells Fail to trans-Induce Telomerase in Human Umbilical Vein Endothelial Cell Cultures

Esterina Pascale1, Graziella Cimino Reale2 and Ettore D’Ambrosio2

1 Dipartimento di Medicina Sperimentale e Patologia, Università "La Sapienza", Roma, Italy; and 2 Istituto di Neurobiologia e Medicina Molecolare, Consiglio Nazionale delle Ricerche, Roma, Italy


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The shortening of the telomeres that occurs in most somatic cells and untransformed cell cultures is considered a hallmark of cellular senescence. Re-activation of telomerase, which is usually present in immortal cells, avoids telomere shortening and considerably extends the culture life span. Normal human endothelial cells are characterized by an accelerated rate of telomere shortening and reach replicative senescence after a limited number of cell divisions. It has recently been reported that human telomerase reverse transcriptase expression may be strongly up-regulated in human endothelial cells cocultivated with tumor cells. Due to the important implications of this finding on tumor progression, we have extensively analyzed for the presence of telomerase in primary human endothelial cells either cocultivated with tumor cells or grown with tumor-conditioned medium. We found modest, but readily detectable, amounts of telomerase in all human endothelial cell cultures analyzed that disappeared as the cultures approached senescence. Quantitative reverse transcription-PCR also showed a direct correlation between human telomerase reverse transcriptase expression and the proliferative index of the cultures. Nevertheless, we did not find any evidence of induction of telomerase activity by tumor cells in any of the tested conditions. All data indicate that telomerase in human endothelial cells follows an activation program that is strictly associated to the culture growth rate.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Endothelial cell cultures derived from human umbilical vein (human endothelial cells) represent a suitable model to investigate the mechanisms involved in endothelial cell responses to various stimuli. Normal human endothelial cells, like other somatic cells in culture, undergo a limited number of cell divisions and enter a state called replicative senescence. It is believed that a relevant factor in regulating the life span of the cells is the shortening of the telomeres, the specialized structures that seal the chromosome ends (1) . Telomere shortening is contrasted by telomerase that is virtually absent in most somatic cells and tissues (2) , but it is re-activated by up-regulation of the catalytic component human telomerase reverse transcriptase (hTERT) in the vast majority of tumor cells (3) and confers on them unlimited proliferative potential. Human endothelial cell cultures have a relatively high rate of telomere shortening, double that of fibroblasts, and they reach replicative senescence earlier in agreement with the telomere hypothesis. Nevertheless, telomerase has also been found in cycling cells, although it seems to be present only at early stages of subculturing (4 , 5) , and the replicative senescence of these cells can be bypassed by ectopic expression of hTERT with considerable extension of the culture life span (6) .

Tumor cell growth induces the sprouting of vessels from division of differentiated endothelial cells with contribution of endothelial progenitors (7) . When tissues grow beyond the limit of oxygen diffusion, hypoxia triggers vessels to grow by indirectly up-regulating many angiogenic genes, the most remarkable of which is the vascular endothelial growth factor (8) . Recently, it has been suggested that among the factors that tumor cells release to induce the angiogenic program, there are some that re-activate the telomerase. This claim was sustained by cocultivation experiments in which it was shown that glioblastoma tumor cells induce de novo telomerase activity in human endothelial cells by diffusible factors (9) .

The potentially important theoretical and practical implication of this finding induced us to extensively analyze telomerase activity in human endothelial cells cultivated up to the end of their proliferative potential and after exposure to tumor released factors. In general, we were able to detect the telomerase activity during the first two thirds of the culture life span, and we could show that hTERT expression peaks at logarithmic phases during the cell growth. On the other hand, all of our attempts to reactivate the telomerase or to up-regulate hTERT expression by tumor cells were unsuccessful, and it was so even when human endothelial cells were grown in direct contact with tumor cells or in hypoxic condition.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Cultures.
Pooled human endothelial cells were obtained from BioWittaker and grown in endothelial cell growth medium EGM-2 supplemented with endothelial cell Bullet kit (BioWittaker, Walkersville, MD). Three independent cultures were analyzed up to the end of their replicative potential. Appropriate numbers of cells were collected by trypsinization every 2 to 3 days at each subculturing and used for telomeric repeat amplification protocol (TRAP) and reverse transcription-PCR analysis. To obtain resting cells, the cultures were maintained for 3 to 4 days after confluence either in growth medium or in Dulbecco’s modified Eagle’s medium plus 2% serum. Cocultures of human endothelial cells and T98G human glioblastoma cells or primary skin human fibroblasts were obtained using trans-well polycarbonate membrane polystyrene plates (pore size, 0.4 µm; Corning Costar Inc., New York, NY). Cells were plated at a density of 104 cells/cm2 in separate compartments and maintained in EGM-2 complete medium. Cultures were analyzed at subconfluence and after being cocultivated for three more passages. In some experiments, tumor cell-like U937 and SK-MEL-28 were used instead of T98G. For the experiments with conditioned medium, T98G and human fibroblast cells were cultured for 4 days in complete endothelial cell growth medium, EGM-2. Conditioned media were collected and either centrifuged at 1500 rpm for 5 minutes or filtered through 0.4-µm pore size filter and used to maintain human endothelial cells in culture for 3 days. Cultures of T98G and human endothelial cells grown in RPMI and EGM-2, respectively, for the same time intervals were used as controls. ALT telomerase-negative tumor cell lines U2OS or SAOS-2 were admixed with cultures of human endothelial cells that had been seeded the day before. In other experiments, the two types of cell were seeded simultaneously and grown together for 3 days before sample collection. Hypoxic conditions were obtained as described previously (10) . The cultures were kept in 1% oxygen concentration for 24 hours before sampling.

Telomeric Repeat Amplification Protocol Assay.
Human endothelial cells (2 x 105) were lysed in 20 µL of Chaps buffer (2) . The homogenate was incubated on ice for 30 minutes and centrifuged at 12,000 x g for 30 minutes. An aliquot of 3 µL of the protein extract (30,000 cells equivalent) was assayed for telomerase activity using a modified TRAP assay (11) . The reaction products were electrophoresed on 6% nondenaturing polyacrylamide gels and visualized by autoradiography.

Quantitative Reverse Transcription-Polymerase Chain Reaction.
Total RNA was extracted from 2 x 106 human endothelial cells with the TRIZOL LS reagent (Invitrogen, Carlsbad, CA). Total RNA (10 µg), DNase pretreated, was reverse-transcribed by random hexamers, and one fifth of the resulting cDNA was used. GPDH and hTERT fragments were coamplified using the following primer sets: GPDH/F (CACAGTCCATGCCATCAC) and GPDH/R (CACCACCCTGTTGCTGTA), and F/TERT 1784 (CGGAAGAGTGTCTGGAGCAA) and R/TERT 1928 (GGATGAAGCGGAGTCTGGA; ref. 12 ). The amplification was performed in a mixture of 50 µL containing 1.5 mmol/L MgCl2, 200 µmol/L dNTPs, 20 pmol of TERT primers, 5 pmol of GPDH primers, and 2 U of Taq polymerase. The PCR reaction was conducted for 30 cycles with the following settings: 94° for 20 seconds, 60° for 20 seconds, and 72° for 20 seconds. The amplified products were separated on 6% nondenaturing polyacrylamide gels and stained by ethidium bromide. The relative amount of hTERT transcript was calculated by normalizing the intensity of the relevant band to the intensity of the GPDH band. The amount of hTERT found in human endothelial cells was also compared with that found in HeLa cells.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Three independent human endothelial cell cultures (A, B, and C) were followed up to their replicative senescence. A quantitative reverse transcription-PCR was set up to measure hTERT expression more accurately. Specific regions of hTERT and GPDH genes were coamplified. The optimal amplification conditions to detect variable amounts of hTERT were determined using different amounts of HeLa RNA mixed to a fixed amount of fibroblast RNA (data not shown).

As shown in Fig. 1Citation , telomerase activity can be detected in growing cells independently of the growth rate of the cells, but not in quiescent confluent cultures. On the other hand, the level of hTERT expression was maximum in cultures 70 to 90% confluent and totally absent only in cultures maintained for 4 days in 2% fetal calf serum minimal essential medium after confluence. Although the level of hTERT expression was minimal, it was still detectable in cultures maintained in growth medium for 3 to 4 days after confluence. The highest level of expression in human endothelial cells was about one third of that routinely observed in HeLa cells (Fig. 1B)Citation .



View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Telomerase activity and hTERT expression in human endothelial cells analyzed under different growth conditions. Two distinct samples from the same culture were processed both for the protein extraction and the RNA isolation. A, TRAP assay performed on human endothelial cell cultures in different proliferating conditions. Lane 1, culture maintained for 4 days after confluence in 2% fetal calf serum Dulbecco’s modified Eagle’s medium; Lane 2, culture maintained in growth medium for 3 days after confluence; Lane 3, 70% confluent culture; Lane 4, 90% confluent culture; Lane 5, confluent culture. B, quantitative reverse transcription-PCR performed on human endothelial cell corresponding samples and HeLa (H). The amount of hTERT relative to GPDH normalized to the HeLa is indicated. R.U., relative units.

 
We then tested subconfluent cultures until they exhausted their proliferative potential. We obtained 44 cell doublings for culture A and 35 and 40 cell doublings for cultures B and C, respectively. As shown in Fig. 2Citation , telomerase activity was detected up to 29, 23, and 26 cell doublings for cultures A, B, and C, respectively. In all TRAP-positive samples, we detected a constant level of hTERT expression. Although at much lower level, hTERT was still detectable for an additional two or three cell doublings after the last TRAP-positive sample (Fig. 3)Citation .



View larger version (89K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Follow-up of telomerase activity in human endothelial cells. TRAP assay was performed on three independent cultures: A, B, and C followed to the end of their proliferative potential. Cells were harvested while subconfluent. The figure shows the last telomerase-positive sample and the first telomerase-negative sample as well as the sample obtained from cells after five population doublings (PDs). In the three cultures, telomerase was no longer detected at 32, 26, and 28 PDs, respectively.

 


View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Quantitative reverse transcription-PCR analysis performed on RNA samples extracted from subconfluent cells (culture B) at 23, 26, and 32 PDs. hTERT transcript is virtually absent only in the sample at 32 PDs, whereas telomerase activity is only detected in the sample at 23 PDs (+). The hTERT relative units (R.U.) are normalized to the amount of hTERT in HeLa cells.

 
Cocultivation experiments were set up with cultures in which telomerase was either easily detectable or absent and with cultures in which only hTERT transcript was detectable. The cells were exposed to factors released by tumor cells either by cocultivating human endothelial cells and tumor cells in separate compartments of trans-well plates or by growing human endothelial cells in tumor conditioned medium. Control experiments in which tumor cells were substituted by normal human fibroblasts were also performed. To determine whether cell–cell contact could potentially induce or up-regulate telomerase, human endothelial cell and telomerase-negative tumor cell lines that have developed alternative mechanisms of telomere maintenance were grown in the same flask.

Typical results are shown in Fig. 4Citation . In no case and with none of the conditions tested did we see changes in telomerase activity of human endothelial cells. On the other hand, the quantitative analysis showed a significant reduction of hTERT transcript in human endothelial cells in which only hTERT was detectable. In general, we found that the amount of hTERT in cells exposed to tumor-released factors was about one half of that present in unexposed control cultures. Similar results were obtained with human endothelial cells exposed to fibroblast and to different tumor cultures, such as U937 and melanoma cell lines. This result was obtained also in the experiments in which human endothelial cells and tumor cells were grown with intimate contact conditions (Fig. 4C)Citation .



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Telomerase activity in human endothelial cells after cocultivation experiments. Cells were collected after 3 days of cocultivation, and samples were analyzed by TRAP and quantitative reverse transcription-PCR. A. Cultures at 5, 15, and 26 PDs were used. TRAP assay was performed on human endothelial cells alone (H) and on human endothelial cells cocultivated either with T98G (H/G) or with fibroblast (H/F). B. In this experiment, human endothelial cell cultures that were TRAP positive (15 PD), only hTERT positive (28 PD), or both TRAP and hTERT negative (32 PD) were used. The amounts of hTERT are normalized to the amount that was present in human endothelial cell grown under standard conditions. C, lack of the up-regulation of hTERT in human endothelial cell grown mixed to U2OS (ALT telomerase-negative tumor cells). The amount of hTERT is normalized to the amount that was present in human endothelial cells grown in the parallel control culture. D. Human endothelial cells grown for 24 hours in hypoxic conditions either with growth medium (Lane 1) or with tumor conditioned medium (Lane 2) are compared with culture kept in standard conditions (Lane C).

 
While this manuscript was under revision, it was shown that the hTERT promoter has hypoxia-inducible factor 1 response elements (13) . It is conceivable that in the hypoxic environment of a tumor, hTERT could be maintained or up-regulated in human endothelial cells. Thus, we set up experiments for culturing human endothelial cells that have low or no hTERT or telomerase in hypoxic conditions. We failed to detect any telomerase up-regulation in this condition as well (Fig. 4D)Citation .


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
High levels of telomerase activity appear to be critical in maintaining stable telomere length. Nevertheless, telomerase activity has been detected in normal cells that show telomere shortening as well (14) . In these cells, telomerase activity is considered insufficient to sustain telomere length. Human endothelial cell cultures seem to have an unusual behavior. They present easily detectable telomerase activity until they reach the last one third of their replicative life span. Successively, the level of expression of hTERT dramatically drops to less than one tenth of its typical peak expression (it is noteworthy that the culture growth rate strongly slows down at this stage), but the telomeres keep shortening constantly and the rate of shortening is double that of fibroblasts in which telomerase levels are much lower (15) . Moreover, hTERT expression is higher in fast cycling human endothelial cells, although it is only one third of that found in HeLa and very low or virtually absent in quiescent cells.

Because the sprouting of new vessels is driven by the activation of endothelial cell division, it is understandable that the hTERT expression can become consistent during early steps of angiogenesis. The presence of hTERT in endothelial cells of vessels that nourish tumors like glioblastoma multiforme was the first observation to suggest that tumor cells may specifically trans-induce telomerase (16) . On the other hand, telomerase re-activation in endothelial cells was also shown in granulation tissue in wound healing of the human skin, indicating that up-regulation of telomerase is more likely a general mechanism that is coupled to fast-cycling endothelial cells (ref. 17 ; this paper).

In their paper, Falchetti et al. (9) described experiments in which tumor-released factors induced hTERT expression and telomerase activity in young human endothelial cell cultures while control unexposed cultures were and remained negative. The reactivation of telomerase has been described to spread throughout the culture starting from isolated cells, and only after 5 days, most of them expressed telomerase. This observation is in conflict with the result expected if telomerase is activated by diffusible factors. It is likely that all of the cells in the culture would be simultaneously and equally exposed, and they should up-regulate telomerase in a relatively limited time interval.

However, none of the experiments that we carried out, either with telomerase-positive or telomerase-negative human endothelial cells, resulted in telomerase up-regulation. Telomerase-negative human endothelial cells remained such even if the cocultivation experiments were prolonged up to three subcultures. In contrast, the quantitative analysis of hTERT showed that the cells exposed to tumor factors showed considerably lower levels of transcript than control cultures. It is reasonable to suppose that cells growing in conditioned medium experienced a reduction of the proliferation rate and consequently of the telomerase expression.

It is very unlikely that the conflicting results obtained by us are due to nonidentical experimental conditions. In addition, to perform the experiments tightly to the description, other conditions were investigated. Furthermore, experiments with human endothelial cells at a different moment of their replicative history were repeatedly exploited. The results obtained with cultures in which only hTERT was detectable are particularly meaningful. Under these conditions our quantitative analysis clearly shows a decrease of the amount of hTERT after cocultivation. More importantly, we also show that even if tumor cells are grown in the same flask as human endothelial cells, so that cell to cell contacts are present, we do not have telomerase reactivation, and the amount of hTERT clearly decreases. Finally, telomerase was reactivated or up-regulated neither by hypoxia nor by culturing human endothelial cells with tumor conditioned medium in hypoxic conditions.

In conclusion, our data do not support the hypothesis that tumor cells in culture are able to trans-induce telomerase in human endothelial cells. In these cells, telomerase activity seems to be strictly coupled to the cell proliferation. Thus, all conditions that have a detrimental effect on the culture growth rate parallel to down-regulation of telomerase activity. On the other hand, the main role of telomerase in the endothelial cells does not seem to be devoted to avoid telomere shortening.


    FOOTNOTES
 
Grant support: Fondazione Avanzamento Ricerche Medicina Molecolare (FARMM onlus).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Ettore D’Ambrosio, Istituto di Neurobiologia e Medicina Molecolare, Consiglio Nazionale delle Ricerche, Viale Marx 43, 00137 Roma, Italy. E-mail: e.dambrosio{at}inemm.cnr.it

Received 5/14/04. Revised 8/16/04. Accepted 9/13/04.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Wright WE, Shay JW Historical claims and current interpretations of replicative aging. Nat Biotechnol 2002;20:682-688.[CrossRef][Medline]
  2. Kim NW, Piatyszek MA, Prowse KR, et al Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011-2015.[Abstract/Free Full Text]
  3. Shay JW, Wright WE The reactivation of telomerase activity in cancer progression. Trends Genet 1996;12:129-131.[CrossRef][Medline]
  4. Hsiao R, Sharma HW, Ramakrishnan S, Keith E, Narayanan R Telomerase activity in normal human endothelial cells. Anticancer Res 1997;17:827-832.[Medline]
  5. Vasa M, Breitschopf K, Zeiher AM, Dimmeler S Nitric oxide activates telomerase and delays endothelial cell senescence. Circ Res 2000;87:540-542.[Free Full Text]
  6. Yang J, Chang E, Cherry AM, et al Human endothelial cell life extension by telomerase expression. J Biol Chem 1999;274:26141-26148.[Abstract/Free Full Text]
  7. Carmeliet P Angiogenesis in health and disease. Nat Med 2003;9:653-660.[CrossRef][Medline]
  8. Shweiki D, Itin A, Soffer D, Keshet E Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 1992;359:843-845.[CrossRef][Medline]
  9. Falchetti ML, Pierconti F, Casalbore P, et al Glioblastoma induces vascular endothelial cells to express telomerase in vitro. Cancer Res 2003;63:3750-3754.[Abstract/Free Full Text]
  10. Di Carlo A, De Mori R, Martelli F, Pompilio G, Capogrossi MC, Germani A Hypoxia inhibits miogenic differenziation through accelerated MyoD degradation. J Biol Chem 2004;279:26141-26148.
  11. Szatmari I, Aradi J Telomeric repeat amplification, without shortening or lengthening of the telomerase products: a method to analyze the processivity of telomerase enzyme. Nucleic Acids Res 2001;29:e3[Abstract/Free Full Text]
  12. Ulaner GA, Hu J-F, Vu TH, Giudice LC, Hoffman AR Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcript. Cancer Res 1988;58:4168-4172.
  13. Nishi H, Nakada T, Kyo S, Inoue M, Shay JW, Isaka K Hypoxia-inducible factor 1 mediates upregulation of telomerase (hTERT). Mol Cell Biol 2004;24:6076-6083.[Abstract/Free Full Text]
  14. Masutomi K, Yu EY, Khurts S, et al Telomerase maintains telomere structure in normal human cells. Cell 2003;114:241-253.[CrossRef][Medline]
  15. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE Telomere shortening is proportional to the size of the G-rich telomeric 3'-overhang. J Biol Chem 2000;275:19719-19722.[Abstract/Free Full Text]
  16. Falchetti ML, Pallini R, D’Ambrosio E, et al In situ detection of telomerase catalytic subunit mRNA in glioblastoma multiforme. Int J Cancer 2000;88:895-901.[CrossRef][Medline]
  17. Osanai M, Tamaki T, Yonekawa M, Kawamura A, Sawada N Transient increase in telomerase activity of proliferating fibroblasts and endothelial cells in granulation tissue of the human skin. Wound Repair Regen 2002;10:59-66.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pascale, E.
Right arrow Articles by D’Ambrosio, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pascale, E.
Right arrow Articles by D’Ambrosio, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online