| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Department of Molecular Biology, Division of Genomics, University of Salzburg, Salzburg, Austria; 2 Medical University Vienna, Institute of Medical and Chemical Laboratory Diagnostics, Vienna, Austria; 3 Department of Pathology, St. Johanns Hospital, Paracelsus Medical School, Salzburg, Austria; and 4 Center for Cutaneous Research, Barts and The London Queen Marys School of Medicine & Dentistry, University of London, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
HH signal transduction is initiated by binding of secreted and post-translationally modified HH protein to the 12-pass transmembrane receptor Patched (PTCH), which in the absence of ligand represses signaling by inhibiting the 7-pass transmembrane protein Smoothened (SMOH). On ligand binding, the repressive activity of PTCH is abrogated, allowing SMOH to transduce the signal toward the nucleus by a complex mechanism that in vertebrates is not fully understood at present (1 , 5) .
Binding of HH to PTCH induces the transcriptional activation of GLI1 and/or GLI2, both members of the GLI family of zinc finger transcription factors, which mediate the signal in the nucleus of responsive cells by regulating HH-target gene expression. GLI1 and GLI2 are expressed in overlapping yet distinct domains and have a highly conserved zinc finger DNA binding domain, each binding to the consensus GLI binding site GACCACCCA (6 , 7) .
Evidence indicates that aberrant HH signaling is involved in the development of a number of different types of malignancies, including medulloblastoma, rhabdomyosarcoma, and basal cell carcinoma (BCC; refs. 8, 9, 10 ). Deregulated HH/GLI signaling recently also has been implicated in common highly aggressive cancers of the lung, gastrointestinal tract, and pancreas, where it not only appears to be involved in tumor formation but also in tumor maintenance because the survival of transformed cells depends on active HH signaling (11, 12, 13) .
In the case of BCC, a wealth of data suggest that ligand-independent activation of HH/GLI signaling resulting either from PTCH loss of function or from SMOH gain of function mutations represents the primary genetic lesion sufficient to initiate and propagate carcinogenesis (14, 15, 16) . GLI1 and GLI2 are expressed at high levels in BCC, and transgenic expression of human GLI1 or rodent Gli2 in mouse epidermis showed that the oncogenic HH signal could be mediated by these transcription factors. Increased expression of GLI1 or Gli2 resulted in the formation of epidermal tumors including BCC, but the frequency with which certain tumor types were induced was different (17, 18, 19, 20) . Although these experiments convincingly showed that HH-induced tumorigenesis could be mediated by the increased activity of GLI1 and GLI2, the relative contribution of each transcription factor to tumorigenesis still remains to be addressed.
Distinct target gene specificities of Gli1 and Gli2 were revealed by heterologous expression of Gli genes in Drosophila (21) and were further supported by the finding that Gli2 acts in ventral mesodermal patterning in amphibians independent of HH signaling. In this context, Gli2 but not Gli1 was able to directly activate mesodermal patterning genes (22) . Conversely, Gli1 can compensate for the lack of Gli2 function when expressed from the Gli2 locus, indicating that Gli1 and Gli2 regulate a similar set of target genes during early mouse embryogenesis. Later in development, however, new gain-of-function defects emerge, suggesting context-dependent regulation of the biological activities of GLI factors (23) .
Whether GLI1 or GLI2 or a combination of both factors is required for HH-induced tumorigenesis is still unclear. Recent evidence uncovered an essential role of Gli2 in transducing HH signaling during hair follicle development in mice, whereas Gli1 function appears to be dispensable for this process (24) . By contrast, overexpression studies and the strong expression of GLI1 in the majority of HH-associated tumors argue that GLI1 plays a central role in mediating the oncogenic HH signal (20 , 25, 26, 27) .
To better understand the contribution of GLI1 and GLI2 in the neoplastic conversion of epidermal cells, we compared the mRNA expression profiles of GLI1- and GLI2-expressing human keratinocytes by cDNA array analysis and found that the key antiapoptotic factor BCL2 was predominantly induced by GLI2. Intriguingly, Bigelow et al. (28) recently have established a direct link between HH/GLI signaling and BCL2 expression, showing that GLI1 but not GLI3 was able to stimulate the BCL2 promoter. The role of GLI2 has not been addressed (28) . Here we show that in human epidermal cells the GLI2 oncogene is a potent activator of BCL2 expression compared with GLI1. Detailed analysis of the BCL2 promoter identified a single conserved GLI binding site that was essential for selective activation by GLI2. We also show that the preferential activation of BCL2 by GLI2 depends on the zinc finger domain of GLI2, implicating the highly conserved DNA binding domain in selective target site recognition and differential gene regulation. These results, together with the observation that GLI2 and BCL2 are coexpressed in BCC and plasmacytoma, suggest a predominant role for GLI2 in activating the key prosurvival factor BCL2, thereby uncovering a potential mechanism by which GLI2 contributes to tumor development in response to deregulated HH signaling.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The T-REx system (Invitrogen, Carlsbad, CA) was used to generate double-stable HaCaT lines expressing GLI1 or NH2-terminally His-tagged GLI2 under the control of the tetracycline repressor. Transgene expression was induced by the addition of 1 mg/L tetracycline (Invitrogen). Cells were transfected using SuperFect (Qiagen, Valencia, CA) according to the manufacturers instructions. Expression of GLI1 and GLI2 in primary human keratinocytes by retroviral transduction was done as described previously (20 , 30) .
Plasmid Construction.
For short hairpin RNA (shRNA) plasmid, construction oligonucleotides (see below) were annealed and cloned into ApaI/EcoRI-digested pBS/U6 vector (31)
. To avoid off-target effects, shRNAs targeting GLI1 were designed to have at least three mismatches with any other human mRNA sequence other than GLI1. The following oligonucleotides were used: shRNA-A (targeting nucleotides 565 to 585 of GLI1; GenBank accession no. NM 005269): 5'-GGATGATCCCACATCCTCAGAAGCTTCTGAGGATGTGGGATCATCCCTTTTTG-3' and 5'-AATTCAAAAAGGGATGATCCCACATCCTCAGAAGCTTCTGAGGATGTGGGATCAT C3-'; shRNA-C (targeting nucleotides 3008 to 3028 of GLI1): 5'-GGCAAATAGGGCTTCACATAAAGCTTTATGTGAAGCCCTATTTGCCCTTTTTG-3' and 5'-AATTCAAAAAGGGCAAATAGGGCTTCACATAAAGCTTTATGTGAAGCCCTATTTGC- 3'; and shRNA-K (control): 5'-GGTGCACAATAGTACTACGAAAGCTTTCGTAGTACTATTGTGCACCCTTTTTG3-' and 5'-AATTCAAAAAGGGTGCACAATAGTACTACGAAAGCTTTCGTAGTACTATTGTGCAC- 3'.
For the construction of the EGFP-GLI1 expression plasmid, the GLI1 coding region with a silent mutation at position 3381 to destroy the internal EcoRI site was cloned into HindIII/EcoRI-digested pEGFP-C1 vector (BD Biosciences, San Jose, CA). To generate Myc-tagged GLI1 protein containing a nuclear localization signal (NLS), the GLI1 coding sequence was cloned into StuI/XbaI-digested pCS2+NLSMT (gift from Dr. Dave Turner, University of Michigan, Ann Arbor, MI). The resulting NH2-terminally NLS-Myc-tagged GLI1 was isolated by HindIII-XbaI digestion and shuttled into pcDNA4/TO expression vector (Invitrogen).
The GLI121 expression construct was generated by sequentially fusing the NH2-terminal region of Myc-tagged GLI1 (amino acids 1 to 233), the zinc finger domain of GLI2 (amino acids 92 to 244), and the COOH-terminal region of GLI1 (amino acids 389 to 1106) by a PCR-based approach. This yielded a GLI121 fusion protein with an NH2-terminal Myc-epitope but no NLS sequence. Like GLI1, GLI121, human GLI2 (GenBank accession no. AB007296), and GLI3 (GenBank accession no. NM 000168) were cloned into pcDNA4/TO expression vector (Invitrogen). All of the constructs were sequence verified, and their expression was controlled by Western blot analysis.
Promoter Constructs and Luciferase Reporter Assays.
For the construction of the BCL2 reporter plasmid, a fragment spanning 1.9 kb of the putative promoter and 5'-untranslated region of human BCL2 (1291 to +610) was cloned into pGL3 basic vector (Promega, Madision, WI) yielding BCL2prom (1.9 kb). The cassette containing the three GLI binding sites (1291 to 1022) was deleted by SmaI digestion yielding BCL2prom (control) construct. The 244-bp cassette containing the three putative GLI binding sites was isolated from the BCL2 promoter by SmaI restriction digest. The resulting fragment corresponding to position 1291 to 1047 of the BCL2 promoter was cloned into pGL3 promoter vector (Promega) yielding BCL2prom244. Deletion constructs were generated as follows: for construct bs12, BCL2prom244 was digested with NotI and MluI and the resulting fragment cloned into SmaI-MluI-digested pGL3 promoter vector; construct bs23 was generated by cloning a NotI-XhoI fragment into pGL3 promoter plasmid; and construct bs3 was created by deleting binding sites 1 and 2 from the BCL2prom244 construct by digestion with Bpu10I and MluI, followed by religation.
For luciferase reporter assays, HaCaT cells (29) were grown in 12-well plates to 80% confluence and triple transfected with the respective GLI expression and luciferase reporter plasmids and a ß-Galactosidase expression vector (pcDNA4/TO/lacZ; Invitrogen) for normalization. Luciferase activity was measured in a luminometer (Lucy 2; Anthos, Wals, Austria) using Luciferase Assay Substrate (Promega) according to the manufacturers protocol. Data were normalized for ß-Galactosidase activity using o-nitrophenyl ß-D-galactopyranoside as substrate. LacZ activity was quantified by measuring absorbance at 405 nm on a Spectra Shell Microplate Reader (SLT, Salzburg, Austria).
RNA Isolation and Real-Time PCR Analysis.
Quantitative mRNA measurements by real-time PCR analysis were done as described previously (20
, 30)
. Primer sequences for BCL2 were as follows: forward, 5'-TGG ACA ACC ATG ACC TTG GAC AAT CA-3'; and reverse, 5'-TCC ATC CTC CAC CAG TGT TCC CAT C-3'. Primers for amplification of PTCH and RPLP0 used as reference gene (32)
and appropriate controls and calculations of fold inductions were as described previously (20
, 30)
.
Western Blot Analysis.
Detection of GLI1 protein was performed according to standard procedures using a polyclonal goat anti-GLI1 antibody (C-18; Santa Cruz Biotechnology, Santa Cruz, CA).
BCL2 protein expression in inducible GLI2-HaCaT cells was detected using a polyclonal mouse antihuman BCL2 antibody (clone 100; Santa Cruz Biotechnology).
Recombinant GLI2 Protein Expression and Purification.
For the production of recombinant GLI2 protein, the region coding for amino acids 1 to 332 of GLI2 was cloned into pHIS-Parallel2 bacterial expression plasmid (33)
. Protein expression was induced for 60 minutes in Escherichia coli strain BL21 (Stratagene, La Jolla, CA) by the addition of 1 mmol/L isopropyl-1-thio-ß-D-galactopyranoside (Sigma, St. Louis, MO). Protein purification was done via Ni-NTA agarose affinity chromatography (Qiagen) according to the manufacturers instructions.
Electrophoretic Mobility Shift Assay.
Binding reactions for bandshift assays were done as described previously (34)
. Five micrograms of purified His-tagged GLI2 protein and 40 ng of radioactively labeled double-stranded oligonucleotides were added to the reaction and incubated for 25 minutes at room temperature. In competition experiments, 40 ng or 2 µg of specific unlabeled oligonucleotide were used per reaction. For unspecific competition, 1.5 µg poly(dI·dC) were added to the reaction. Samples were separated on 6% polyacrylamide gels, exposed overnight, and scanned with a BAS-1800II phosphorimager (Fuji Medical Systems, Stamford, CT).
Immunohistochemistry.
Specimens from BCC or plasmacytoma patients (diagnosed at the Institute of Pathology, St. Johanns Hospital, Salzburg, Austria) and normal skin tissue were analyzed in this study. Immunohistochemical staining for GLI2, GLI3, and BCL2 was performed on formalin-fixed paraffin-embedded tissues (4-µm sections) using standard streptavidin-biotin-peroxidase (StreptABComplex/HRP Duet kit; DakoCytomation, Carpinteria, CA) and double-immunofluorescence techniques. GLI2, GLI3, or BCL2 protein was detected with polyclonal goat anti-GLI2 antibody [GLI2-(N-20); Santa Cruz Biotechnology; 1:100], polyclonal goat anti-GLI3 antibody [GLI3-(N-19); 1:100], and monoclonal anti-BCL2 antibody (DakoCytomation; 1:40), respectively.
Primary antibodies were incubated at 4°C overnight, and after several washes, detection was performed using biotinylated goat antimouse or biotinylated rabbit antigoat and horseradish-streptavidin-biotin complex (DakoCytomation), followed by development with diaminobenzidine. Specimens were counterstained with hematoxylin.
For double-immunofluorescence staining, primary antibodies were applied simultaneously, followed by incubation with biotinylated rabbit antigoat antibody, Alexa Fluor 555 goat antimouse (1:50), and Streptavidin-Alexa Fluor 488 (1:100; Molecular Probes, Eugene, OR). Positive and negative control samples were included, and preabsorption controls using appropriate blocking peptides (Santa Cruz Biotechnology) were performed. Confocal microscopy analysis was done on a Zeiss LSM 510 laser scanning microscope (Zeiss, Oberkochen, Germany).
| RESULTS |
|---|
|
|
|---|
RNA isolated from pools of four independent HaCaT lines expressing GLI1 or GLI2 under tetracycline control was used for the measurements to minimize interclone variability. In GLI2-expressing HaCaT cells, significantly elevated levels of BCL2 mRNA were already detected after 12 hours of tetracycline treatment (8.4-fold increase), whereas in GLI1-expressing cells, the level of BCL2 mRNA was only moderately higher at that time point compared with uninduced cells (1.6-fold increase). The predominant induction of BCL2 mRNA expression by GLI2 also was observed at later time points (Fig. 1A)
. The GLI1 and GLI2 HaCaT pools expressed comparable levels of transgene, showing that the differences in target gene activation are not caused by differences in GLI1 or GLI2 expression levels (Fig. 1; see Supplementary Data). The known direct GLI target gene PTCH also was induced to comparable levels by GLI2 and GLI1 (Fig. 1B)
, excluding the possibility that GLI1 protein was generally less active than GLI2. The results were validated with retrovirally transduced primary human keratinocytes expressing GLI1 or GLI2 for 72 hours. Like in HaCaT cells, only GLI2 induced high levels of BCL2 mRNA (7.1-fold induction by GLI2 versus 1.3-fold induction of BCL2 by GLI1), whereas GLI2 and GLI1 stimulated transcription of PTCH (Fig. 1C)
. Moderate activation of BCL2 mRNA expression in response to GLI1 was only observed at later time points (96 hours post-transduction; data not shown). Induction of BCL2 expression in response to GLI2 also was confirmed by Western blot analysis (Fig. 1D)
. Collectively, the data suggest that in human keratinocytes, BCL2 expression is predominantly activated by GLI2 in response to HH/GLI signaling.
|
In silico analysis of the human BCL2 promoter using the ScanAce motif search program (35)
revealed the presence of three closely spaced putative GLI binding sites (bs1, bs2, and bs3) with significant homology to the consensus GLI binding site GACCACCCA (ref. 6
; Fig. 2A
). To address whether GLI2 is able to bind to these sequences, we performed electrophoretic mobility shift assays (EMSAs). As shown in Fig. 2B
, all three sequences were specifically bound by the GLI2 zinc finger, suggesting that like GLI1, GLI2 regulates BCL2 expression by directly binding to the BCL2 promoter. To corroborate this, we isolated the putative BCL2 promoter region from position 1291 to +610 relative to the transcriptional start site (36)
and cloned the fragment containing the three GLI binding sites into a luciferase reporter vector yielding BCL2prom (1.9 kb). As a control, we used a reporter construct in which the three putative GLI binding sites located within the region from 1291 to 1022 of the BCL2 promoter fragment were deleted [BCL2prom (cont); Fig. 2C
, top]. The reporter constructs were tested in HaCaT keratinocytes for activation by GLI1, GLI2, or GLI3. To exclude that the weak induction of BCL2 expression by GLI1as observed in our real-time PCR analysiscould be because of cytoplasmic rather than nuclear localization of GLI1 protein, we used a modified GLI1 construct that directs GLI1 protein to the nucleus by the presence of an NH2-terminal NLS. Consistent with previous results (28)
, GLI1 induced BCL2 reporter activity (Fig. 2C)
. Activation of the BCL2 promoter by GLI2, however, was >10-fold stronger compared with GLI1-mediated reporter activation. By contrast, activation of a PTCH reporter by GLI2 was only moderately stronger (1.8-fold) than activation by GLI1 (Fig. 2C
, inset), showing a similar activator potential of both transcription factors. GLI3 did not significantly induce activation of the BCL2 reporter, and neither GLI1 nor GLI2 was able to activate BCL2 reporter expression on deletion of the three GLI binding sites [BCL2prom (cont); Fig. 2C
]. Together with our studies on endogenous BCL2 mRNA levels in GLI1- and GLI2-expressing keratinocytes, these results suggest that among the three human GLI genes, GLI2 is the predominant factor involved in the direct activation of BCL2 expression in response to HH/GLI signaling.
|
|
The Zinc Finger DNA Binding Domain of GLI2 and GLI Binding Site bs3 Is Required for GLI2-Specific Activation of the BCL2 Promoter.
Vertebrate Gli genes have been shown to bind to the consensus Gli binding site (GACCACCCA; refs. 6
, 37
). This has led to the hypothesis that the distinct biological activities of GLI proteins rely on differential post-translational modifications, proteolytic processing, or specific interactions with transcriptional cofactors such as CBP rather than on selective binding site recognition (38, 39, 40, 41)
. Conversely, the lack of quantitative data on the affinity of the DNA binding domains of different GLI proteins to variants of the consensus Gli binding site makes it difficult to assess the role of the zinc finger domain in mediating the distinct biological activities of GLI proteins.
We addressed the roles of the zinc finger DNA binding domain of GLI2 and of the three GLI binding sites in the induction of BCL2 expression. We reasoned that if the zinc finger domains of GLI2 were responsible for strong induction of BCL2 expression, replacing the zinc finger domain of GLI1 with that of GLI2 would convert GLI1 into a strong inducer of the BCL2 promoter. To test this, we constructed a chimeric protein termed GLI121, consisting of the NH2-terminal region of GLI1, the zinc finger domain of GLI2, and the COOH-terminal region of GLI1 (Fig. 4B)
. The ability of wild-type GLI2, GLI121, and NLS-tagged GLI1 protein to activate the BCL2 promoter and the contribution of each of the three GLI binding sites to promoter activation were measured using the reporter constructs shown in Fig. 4A
.
|
We next addressed the question of whether any one of the three GLI binding sites is required for selective promoter activation by GLI2 and GLI121, respectively. We found that construct bs12 containing binding sites bs1 and bs2 but lacking bs3 was only poorly activated by GLI1, GLI2, and GLI121. Although bs1 has been identified previously as a critical site for GLI1-mediated activation of the BCL2 promoter (28)
, these results suggest that bs1 is not responsible for the differential activation of the promoter by GLI1 and GLI2, respectively. By contrast, constructs bs23 and bs3 were strongly activated by GLI2 and GLI121 but only poorly by GLI1, suggesting that bs3 represents the cis-regulatory element involved in mediating GLI2-specific activation of the BCL2 promoter. Because no significant difference between constructs bs23 and bs3 was observed, we propose that bs2 only plays a minor role in mediating BCL2 activation in response to HH/GLI signaling. The critical role of bs3 in mediating selective BCL2 activation is further underlined by the fact that among the three binding sites found in the human BCL2 promoter, only bs3 has been fully conserved between human, mouse, and rat, as shown by sequence alignment of the respective genomic regions using PipMaker sequence comparison software (ref. 42
; Fig. 4D
). Notably, although bs1 was not required for preferential activation of the BCL2 promoter by GLI2 and GLI121, it was required to achieve maximum activation of luciferase activity, which may point to cooperative binding of GLI2 to the BCL2 promoter.
GLI2 and BCL2 Are Coexpressed in Outer Root Sheath Cells of Hair Follicles and BCC.
To address the in vivo relevance of our findings, we performed coexpression analysis of BCL2 and GLI2 in normal skin and BCC. In line with previous reports on BCL2 and GLI2 expression (20
, 34 , 43)
, both proteins were coexpressed in outer root sheath cells of hair follicles (Fig. 5A and B)
and BCC (Fig. 5C and D)
. Notably, virtually all of the cells expressing GLI2 also stained positive for BCL2, suggesting that GLI2 is likely to regulate BCL2 expression in vivo.
|
|
| DISCUSSION |
|---|
|
|
|---|
In this report, we provide evidence that GLI2 rather than GLI1 is able to induce high-level expression of BCL2, although either factor induces comparable levels of the known direct GLI target gene PTCH. Together with the observation that GLI3 is unable to activate the BCL2 promoter, this suggests that GLI2 represents the major GLI factor involved in activation of BCL2 expression in response to HH/GLI signaling. Given the pivotal role of BCL2 in promoting cell survival and tumorigenesis, our results uncover a potential mechanism by which overexpression of the GLI2 oncogene contributes to BCC development.
By replacing the DNA binding domain of GLI1 with that of GLI2, we showed that the zinc finger domain of GLI2 is responsible for GLI2-specific activation of the minimal BCL2 reporter construct comprising all three GLI binding sites. Notably, all of the amino acids of the GLI1 zinc finger domain that establish base contacts with the Gli consensus binding site GACCACCCA are conserved in the GLI2 zinc finger domain (ref. 47 ; data not shown). Together with the overall high degree of sequence similarity between the GLI1 and GLI2 DNA binding domain, it appears that only minor differences in the amino acid sequence of the zinc finger domains of GLI transcription factors can have a dramatic effect on the selective activation of GLI target genes.
Detailed analysis of the cis-regulatory elements involved in the activation of the BCL2 promoter in response to GLI1 and GLI2, respectively, identified bs3 as the critical element involved in selective activation of the BCL2 promoter by GLI2. Unlike bs1 and bs2, bs3 is fully conserved between mouse, rat, and human, suggesting that preferential activation of BCL2 expression by GLI2 may represent a common regulatory mechanism in mammals.
Bigelow et al. (28) recently identified bs1 (corresponding to binding site 4 in Bigelow et al. (28) ) as the major site required for activation of the BCL2 promoter in response to GLI1, whereas bs3 was not studied. In our experiments, bs1 had little effect on selective reporter activation by GLI2 when analyzed in the absence of bs3 but was able to increase reporter activity in combination with bs3. shRNA knockdown of GLI1 also showed that activation of endogenous GLI1 by GLI2 is not required for high-level activation of the BCL2 promoter. Thus, a possible scenario for the activation of the BCL2 promoter could be that GLI2 preferentially binds to bs3, which then would facilitate binding of another GLI2 molecule to bs1, a hypothesis that is consistent with our observation that full reporter activation is more than additive and depends on the presence of bs1 and bs3.
Our results on coexpression of GLI2 and BCL2 in tumors of BCC patients suggest that constitutive HH signaling induces BCL2 expression in BCC by enhancing the activity of GLI2. Aberrant HH signaling may thereby increase the viability of tumor cells. In a previous report, we have shown that GLI2 can stimulate epidermal proliferation by increasing the expression of genes required for G1-S phase progression and that GLI2 is able to antagonize epidermal differentiation (30) . Together with the findings presented in this study, the oncogenic activity of GLI2 in BCC therefore may rely on at least three distinct functions: (a) stimulation of cell proliferation; (b) repression of epidermal differentiation; and (c) induction of prosurvival signals such as BCL2.
When we observed GLI2/BCL2 coexpression in plasma cells infiltrating BCC tumor islands, we hypothesized a possible role of HH/GLI signaling also in plasma cell-derived malignancies. This was supported by a corresponding analysis of plasmacytoma samples. These results are consistent with experiments in which enforced expression of Bcl-2 significantly increased the incidence of plasmacytoma development in an appropriate mouse model, implicating BCL2 in neoplastic plasma cell development most likely by increasing the cells resistance to apoptotic signals (45) . Expression of GLI2 in malignant cells correlated well with high-level expression of BCL2. Conversely, atypical plasma cells expressing high levels of BCL2 were negative for GLI3, which mainly acts as a repressor of Hh/Gli target genes. In future experiments, it will be important to address the question of whether an increase in GLI2 activator function in plasma cells will result in increased proliferation and/or cell viability at the expense of terminal B-cell differentiation.
In summary, the observation that preferential activation of BCL2 expression by GLI2 depends on the GLI2 zinc finger domain and a single conserved GLI binding site in the BCL2 promoter uncovers a mechanism of differential target gene regulation by GLI proteins, which relies on selective binding site recognition rather than the requirement for additional coactivators. The predominant role of GLI2 in the activation of the key antiapoptotic factor BCL2 reveals an additional molecular pathway by which aberrant HH signaling may induce or maintain tumor development. Its ability to stimulate cell proliferation, to repress epidermal cell differentiation, and to activate prosurvival signals make GLI2 an attractive molecule to be targeted for therapeutic purposes in future experiments.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Notes: G. Regl and Maria Kasper contributed equally to the work; Supplementary data for this article can be found at Cancer Research Online (http://www.cancerres.aacrjournals.org).
Requests for reprints: Fritz Aberger, Department of Molecular Biology, Division of Genomics, University of Salzburg, Hellbrunnerstrasse 34, A-5020 Salzburg, Austria. Phone: 43-662-8044-5792; Fax: 43-662-8044-144; E-mail: fritz.aberger{at}sbg.ac.at
Received 3/29/04. Revised 7/14/04. Accepted 8/23/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Narita, A. So, S. Ettinger, N. Hayashi, M. Muramaki, L. Fazli, Y. Kim, and M. E. Gleave GLI2 Knockdown Using an Antisense Oligonucleotide Induces Apoptosis and Chemosensitizes Cells to Paclitaxel in Androgen-Independent Prostate Cancer Clin. Cancer Res., September 15, 2008; 14(18): 5769 - 5777. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Varas, C. Hernandez-Lopez, J. Valencia, S. Mattavelli, V. G. Martinez, L. Hidalgo, C. Gutierrez-Frias, A. G. Zapata, R. Sacedon, and A. Vicente Survival and function of human thymic dendritic cells are dependent on autocrine Hedgehog signaling J. Leukoc. Biol., June 1, 2008; 83(6): 1476 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Hegde, C. M. Munger, K. Emanuel, A. D. Joshi, T. C. Greiner, D. D. Weisenburger, J. M. Vose, and S. S. Joshi Targeting of sonic hedgehog-GLI signaling: a potential strategy to improve therapy for mantle cell lymphoma Mol. Cancer Ther., June 1, 2008; 7(6): 1450 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eichberger, A. Kaser, C. Pixner, C. Schmid, S. Klingler, M. Winklmayr, C. Hauser-Kronberger, F. Aberger, and A.-M. Frischauf GLI2-specific Transcriptional Activation of the Bone Morphogenetic Protein/Activin Antagonist Follistatin in Human Epidermal Cells J. Biol. Chem., May 2, 2008; 283(18): 12426 - 12437. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ji, F. C. Mei, B. H. Johnson, E. B. Thompson, and X. Cheng Protein Kinase A, not Epac, Suppresses Hedgehog Activity and Regulates Glucocorticoid Sensitivity in Acute Lymphoblastic Leukemia Cells J. Biol. Chem., December 28, 2007; 282(52): 37370 - 37377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thiyagarajan, N. Bhatia, S. Reagan-Shaw, D. Cozma, A. Thomas-Tikhonenko, N. Ahmad, and V. S. Spiegelman Role of GLI2 Transcription Factor in Growth and Tumorigenicity of Prostate Cells Cancer Res., November 15, 2007; 67(22): 10642 - 10646. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kim, J. W. Yoon, X. Xiao, N. M. Dean, B. P. Monia, and E. G. Marcusson Selective Down-Regulation of Glioma-Associated Oncogene 2 Inhibits the Proliferation of Hepatocellular Carcinoma Cells Cancer Res., April 15, 2007; 67(8): 3583 - 3593. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Bar, A. Chaudhry, M. H. Farah, and C. G. Eberhart Hedgehog Signaling Promotes Medulloblastoma Survival via BclII Am. J. Pathol., January 1, 2007; 170(1): 347 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kasper, H. Schnidar, G. W. Neill, M. Hanneder, S. Klingler, L. Blaas, C. Schmid, C. Hauser-Kronberger, G. Regl, M. P. Philpott, et al. Selective Modulation of Hedgehog/GLI Target Gene Expression by Epidermal Growth Factor Signaling in Human Keratinocytes. Mol. Cell. Biol., August 1, 2006; 26(16): 6283 - 6298. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bhatia, S. Thiyagarajan, I. Elcheva, M. Saleem, A. Dlugosz, H. Mukhtar, and V. S. Spiegelman Gli2 Is Targeted for Ubiquitination and Degradation by beta-TrCP Ubiquitin Ligase J. Biol. Chem., July 14, 2006; 281(28): 19320 - 19326. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wajapeyee, R. Britto, H. M. Ravishankar, and K. Somasundaram Apoptosis Induction by Activator Protein 2{alpha} Involves Transcriptional Repression of Bcl-2 J. Biol. Chem., June 16, 2006; 281(24): 16207 - 16219. [Abstract] [Full Text] [PDF] |
||||
![]() |
|