| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Breast Cancer Program, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Johns Hopkins University School of Medicine, Baltimore, Maryland, and 2 Genzyme Oncology, Framingham, Massachusetts
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Bulk tissue expression profiling may mask differential expression in specific cell types of the tumor, as recent findings reveal genetic alterations that occur in cells surrounding epithelial tumors (reviewed in ref. 7 ). Moreover, using whole tumors may also mask the profiles of metastatic epithelial cells, because only a small proportion may have an underlying metastatic potential (8) . It is becoming evident that stromal cells and the extracellular matrix interact with tumor epithelium to influence cancer progression. Such an influence is evidenced by the fact that tumor cells grow and metastasize best at their orthotopic site (compared with ectopic sites), associated with marked differences in angiogenesis (reviewed in ref. 9 ). Because the stromal microenvironment is important (10, 11, 12) , it is necessary to study the molecular consequences associated with the cross-talk between cell types to gain a more comprehensive understanding of tumor progression. Many genes have been found to be aberrantly expressed in tumor epithelium and more recently in the surrounding stroma (13) , yet there is little information on the gene expression alterations that occur in the breast vascular endothelium that may ultimately promote angiogenesis and provide a route for tumor cell dissemination into the circulation.
Enhanced angiogenesis is associated with an increased risk of metastasis and poor prognosis in breast cancer (14 , 15) . Neo-angiogenesis is also required at the metastatic site allowing micrometastases to grow into macrometastatic lesions. Therefore, angiogenesis within metastases is a very desirable therapeutic target considering the mortality associated with distant metastasis in breast cancer. Profiling expression changes that occur in the vasculature of breast cancer will provide insight into the mechanisms underlying tumor vascular growth and also reveal attractive targets for antiangiogenic therapies.
Serial analysis of gene expression technology is a powerful technology that has been used for expression profiling of both specific cell types (16 , 17) and bulk tumors, including primary breast tumors (18) . Serial analysis of gene expression is an open gene expression platform providing analysis of the entire transcriptome with a quantitative, digital output. To date, expression profiling from cancer-associated, pure vascular-specific cells has been limited to a serial analysis of gene expression application on a single normal and tumor endothelial cell preparation from colon (16) and several normal brain and malignant brain tissues (19) . These studies demonstrated the ability to define both tumor-specific endothelial genes and normal endothelial genes. It is noteworthy that the genes discovered to be growth or tumor-specific could be generally classified as extracellular matrix components or surface proteins likely to play a role in adhesion or cell-cell interaction. Transcription factors and other classes of upstream regulators were generally lacking. This finding suggested that the molecular events driving tumor angiogenesis were either solely dependent on extracellular events or that tumor-specific transcription factors were at too low a level to be evaluated with the expression platform used. Moreover, the extent to which circulating endothelial cells and vasculogenesis contribute to the overall expression changes is unclear. Here, we report our findings on serial analysis of gene expression analysis of purified endothelial cells from freshly resected specimens of two invasive breast cancers and one normal reduction mammoplasty. The gene expression profiles derived in our current study define unique profiles for vascular gene expression in breast tumorigenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Serial Analysis of Gene Expression Analysis.
RNA was extracted from
20,000 purified cells. LongSAGE analysis (21)
was performed on RNA from the endothelium of 2 breast tumor samples and 1 normal mammoplasty tissue, yielding
50,000 tags (Table 1)
. All of the tag frequency calculations are normalized to exactly 50,000 tags. For comparative analysis to the colon standard serial analysis of gene expression tag libraries, longSAGE tag counts were aggregated based on common 10 base sequence tags. Genes that corresponded to the tags were then determined, and the fold difference between tags from normal breast endothelium and breast tumor endothelium were calculated. To provide for a conservative estimate of tumor-induced and normal-induced genes, a ratio was calculated using the minimum tumor serial analysis of gene expression tag number (for tumor-induced to normal-induced ratios) or the maximal tumor serial analysis of gene expression tag number (for normal-induced to tumor-induced ratios). Data derived from normal brain endothelial cells and glioma endothelial cells were used as comparators to define breast-specific markers (19)
.
|
In vitro Functional Assays.
Adenovirus expressing HEYL and PRL3 were constructed and determined to viably infect human microvascular endothelial cells. Both constructs expressed the gene of interest to a level at least 15-fold higher than empty vector control. The effect of HEYL overexpression on human microvascular endothelial cell proliferation was assessed by infecting human microvascular endothelial cells for 18 hours at a multiplicity of infection of 200. Cell number was determined at days 0, 2, and 3. The migration effects of adenoviral-expressing PRL3 were assessed by infecting 50,000 human microvascular endothelial cells for 48 hours with a multiplicity of infection of 300. Cells were plated in the top well containing basal media and migrated toward the bottom chamber containing 5% fetal bovine serum as attractant. Migrated cells were read after 24 hours using cell titer glow (Promega, Madison, WI). Terminal deoxynucleotidyl transferase-mediated nick end labeling assays were used to assess the apoptotic potential of human umbilical vein endothelial cells infected with HEYL or control adenovirus. Twenty-five thousand human umbilical vein endothelial cells were transfected with AD-GFP or AD-HEYL and cultured for 3 days in serum-free medium. Apoptosis was detected using In Situ Cell Death terminal deoxynucleotidyl transferase-mediated nick end labeling detection kit, TMR red (Roche).
Quantitative PCR.
ABI Prism 7900 detection system was used according to the manufacturers specifications. Data output is shown as log2 values relative to the mean of the 10 normal breast tissue RNAs used. Data were normalized to either 18 s rRNA or to the median of a set of preselected ubiquitous endothelial cell marker genes. These genes were defined as those having small variance in previously derived pure endothelial cell serial analysis of gene expression data. The genes included in the set are: Claudin 5, ROBO4, TIE2, Hevin, Sox18, and von Willebrand factor. Gene-specific PCRs were performed in duplicate on two separate occasions with similar results. Probe sequences used for gene-specific amplification were as follows: KDR: TCCCAGGCTGCACCCATGGC, TEM7: CTTTGCCTATAAAGAGATCCCTATGTCTGTCCCGG, PRL3: TTTGACGATGGGGCGCCCCCGC, HEYL: ACGGCGTCGAGACCGCATCA, Neuritin: CCGCAGGGCCTGGACGACAA, and TEM1: CGCTGGCTGTCGACGGCTACCTGTGCCAGTT.
PRL3 Expression in Serial Analysis of Gene Expression Libraries.
PRL3 expression (serial analysis of gene expression tag = taggtcagga) was determined for breast-specific cells or tissue in both public serial analysis of gene expression database resources (CGAP) and our own serial analysis of gene expression database. Library data from our database included B1 and B2; normal bronchial epithelial cells; and tumor cell lines B5, B6, B7, B8, B9, and B10. Additional tumor lines included 21-PT, 21-MT, MDA-467, SKBR3, BT-474, and MDA-231; BEC1: BECT1, BEC2: BECT2 and BEC3; BECN1 (this study); BEC5; bone metastasis epithelial cells, BEC6; and PCR amplified normal breast epithelial cells. All of the other library information can be found on the internet.3
| RESULTS |
|---|
|
|
|---|
The premise for our study is that pure endothelial cell populations can be derived from surgical samples of both normal and malignant breast tissue. The protocol used for the isolation of pure endothelial cells uses a combination of negative and positive immunoselections. Immunopurification of specific cell types requires evidence that the final cell preparations are essentially pure. We confirmed the purity of our endothelial cell populations by analyzing the serial analysis of gene expression tag frequency for genes known to be selectively expressed in specific subpopulations of cells. Genes specific for endothelial, epithelial, and hematopoietic cells were analyzed in the serial analysis of gene expression libraries for the 3 samples (Table 1B)
. Genes with preferential expression in vascular endothelium including von Willebrand factor, CD31, CD34, and hevin were moderately and uniformly expressed in all 3 of the samples. Genes specific to epithelium (keratin 8 and 6A) or hematopoietic cells (CD14 and CD45) had negligible expression within the constructed serial analysis of gene expression libraries with the total absence of corresponding tags in most cases. Furthermore, von Willebrand factor and CK18 reverse transcription-PCR analysis performed on cDNA generated from the endothelial cell populations demonstrated little contamination of epithelial cells within the endothelial cell populations (data not shown). This confirms that the samples used were essentially pure endothelial cells. However, it is reasonable to assume that a small percentage of cells are derived from endothelial cell-associated pericytes.
Genes Expressed in Invasive Breast Cancer Endothelium.
Genes that are overexpressed in cancer offer attractive therapeutic targets, especially if expressed at relatively low levels in normal tissues. Table 2A
represents genes that were expressed at least 6-fold higher (conservatively calculated by taking the tag ratio of the lower-expressing tumor sample over the tag frequency in the normal sample) in breast tumor endothelium when compared with the endothelial cells isolated from normal mammoplasty tissue. Table 2A
also shows the tumor induction ratio of the genes in a previously examined colon tumor study (16)
.
|
10-fold in breast tumor endothelial cells and induced at least 5-fold higher in breast than that observed in both colon and brain tumor endothelial cells (see serial analysis of gene expression analysis in Materials and Methods; Table 2B
Also unexpected was the finding that PRL3 was highly induced in breast tumor vasculature, because this gene was shown previously to be expressed primarily in epithelial tumor cells (17)
. It is noteworthy that although both HEYL and PRL3 serial analysis of gene expression tags demonstrate a differential induction in tumor endothelial cells over normal endothelial cells, the specific tag within the genes that is induced differs between colon and breast endothelial cell libraries (Table 2C)
. For both HEYL and PRL3, the most differential tag frequencies observed for colon endothelial cells derives from a 3' extended form of the transcripts. These extended transcripts are based on gene prediction algorithms incorporating all of the available expressed sequence tag data. Thus, within the colon endothelial cell data, the recognized 3' ultimate tags for HEYL and PRL3 show limited or no tumor induction, respectively. It remains unclear why there is this differential transcript detection between colon and breast endothelial cells.
Finally, the robust induction of the cell-cell interaction protein VE-cadherin was unique to breast tumor vasculature, with no induction in colon tumor vasculature (Table 2A)
or brain tumor vasculature (data not shown).
Decreased Gene Expression in Invasive Breast Cancer.
The concerted reduction or absence of expression of genes in tumor vasculature as compared with normal vasculature may reveal genes that function to suppress tumor and/or vascular growth. With this in mind, we sorted the data to reveal genes that showed little or no expression in tumor vasculature compared with normal breast vasculature. A striking down-regulation of numerous genes was observed (Table 3)
. Genes expressing secreted proteins may lend themselves to direct therapeutic intervention and are likely to play a role in extracellular matrix stabilization or cell adhesion. Particularly noteworthy is the observed down-regulation of both lysyl oxidase-like 1 and lysyl oxidase. Members of the lysyl oxidase gene family have been implicated in the regulation of tumor growth, albeit with highly contrasting results from different studies (22)
. The involvement of lysyl oxidase genes in extracellular matrix formation and repair may have implication for regulating the plasticity of tumor vasculature (23)
.
|
Confirmation of Gene Expression Alteration in Normal, Ductal Carcinoma In situ, and Invasive Ductal Carcinoma Tissue.
The expression patterns for selected genes observed in the serial analysis of gene expression library were confirmed by reverse transcription-PCR (Fig. 1A)
. In addition to the purification of endothelial cells from normal and tumor breast tissue, we also immunopurified the adjacent epithelial cells. RNA derived from both endothelial cells and epithelial cells were tested for expression of SNAIL1, HEYL, PRL3, and VE-cadherin. As expected, SNAIL1 was expressed in both the endothelium and the epithelium of invasive cancer. The expression of SNAIL1 in tumor epithelium was reported previously, but its expression in breast cancer endothelium is a novel finding (25
, 26)
. HEYL and PRL3 expression was negligible in both cell types in normal mammoplasty tissue. In invasive breast cancer, the expression of HEYL and PRL3 was observed predominantly in the endothelial cell population, with relatively minimal expression in tumor epithelial cells. As noted previously, VE-cadherin was seen to be expressed at low levels in the endothelium of normal breast tissue. This was also the case using reverse transcription-PCR where expression was detectable in normal endothelium but was present at significantly higher levels in the tumor endothelium (Fig. 1A)
.
|
As an extensive database of breast serial analysis of gene expression data exists both from our work and within the pubic domain, we determined the expression of PRL3 across all of the breast serial analysis of gene expression studies to date. Expression of PRL3 is clearly elevated in tumor endothelial cells relative to normal endothelial cells, bulk tissue samples, and breast tumor cell lines (Fig. 1C)
, lending additional support to a preferential expression of PRL3 in breast tumor vasculature relative to epithelial cells. The PRL3 tag was observed at a frequency of 11 tags to 50,000 in one public normal breast endothelial cell library (Br-N-Endothelial). However, these data were excluded from Fig. 1C
, because it was observed that this library showed significant expression of both epithelial and hematopoietic-specific genes, in obvious contrast to other fresh tissue-derived endothelial cell libraries.
In situ hybridization was used to localize the expression of gene transcripts in tumor vasculature. For all of the in situ hybridization experiments, KDR (VEGFR2) was used as a control to localize the endothelial cells within the vasculature. This allowed confirmation of vascular-specific staining with the probes of interest. A HEYL mixture was used to probe for the expression of HEYL in normal tissue and tissue derived from a patient sample of invasive ductal carcinoma (Fig. 2)
. When comparing staining in the normal tissue with that of H&E and KDR, it is evident that the HEYL probe does not stain the endothelium in normal breast tissue vasculature. In contrast, the invasive breast cancer section demonstrates strong labeling by the HEYL-specific probes paralleling the staining seen with the endothelial-specific marker KDR. Additional interrogation of a human breast tissue array demonstrates conclusive labeling of HEYL within invasive carcinoma (data not shown).
|
In situ hybridization analysis for VE-cadherin showed a light staining in normal tissues that was enhanced in invasive carcinoma (Fig. 3A)
. Because a comparison between staining of different tissues is not quantitative, this was additionally analyzed by using a single patient sample that contained areas of normal tissue, ductal carcinoma in situ, and invasive ductal carcinoma on the same section. Fig. 3B
illustrates VE-cadherin, staining as slightly positive in the normal area, becoming stronger in the vasculature surrounding the ductal carcinoma in situ and strongest in areas of invasive ductal carcinoma, mimicking the exact pattern of both KDR and CD31 binding. Therefore, VE-cadherin expression increases as the tumor becomes more invasive. The rim of microvessels around ductal carcinoma in situ is characteristic of high-grade ductal carcinoma in situ.
|
|
Neuritin Expression Is Decreased in Invasive Breast Cancer.
We next wanted to validate the expression of the gene found to represent the most conserved, tumor-repressed vascular gene, NRN1. Using a riboprobe specific for the NRN1 RNA transcript, binding was evident in the vasculature of normal mammoplasty tissue, as verified by the binding patterns of KDR (Fig. 5)
. The vascular-specific binding of NRN1 probe was abolished in invasive breast cancer tissue (Fig. 5)
.
|
|
| DISCUSSION |
|---|
|
|
|---|
HEYL was identified recently as a basic helix-loop-helix transcription factor, a family of factors known as key regulators of embryonic development or differentiation (27) . It has been shown that HEYL can be activated by constitutively active forms of Notch receptors, making Notch receptors upstream regulators of HEYL expression (28) . The role of enhanced expression of HEYL in the breast tumor endothelium is an interesting one that needs to be studied at a functional and molecular level to determine the role of the induction of this gene on angiogenesis and tumorigenesis. The fact that HEYL and other members of the Notch pathway have limited expression in adulthood makes this gene a potential target for therapy due to the reduced likelihood of systemic toxicity.
There have been a number of publications recently regarding the role of the SNAIL1 family of zinc-finger transcription factors in tumorigenesis. Of particular interest is the role of SNAIL1 in epithelial-mesenchymal transition that could promote the invasive capacity of epithelium in breast cancer. The transition from epithelial to mesenchymal cells allows for enhanced migratory and invasive properties, and, hence, such a transition may contribute to tumor progression (reviewed in ref. 29 ). Our finding that SNAIL1 is induced in tumor endothelium, additional to its enhanced expression in breast tumor epithelium (26 , 30) , has not been reported previously and suggests a role for SNAIL1 in the transcriptional regulation of genes important in angiogenesis. Our study has demonstrated that SNAIL1 expression is enhanced 10-fold in breast tumor endothelium, whereas expression is absent in the endothelium of colon and brain carcinoma.
PRL3 is a proposed tyrosine phosphatase with a COOH-terminal prenylation motif that allows its association with the plasma membrane. This gene was reported recently to have a role in colorectal cancer metastasis (17) where it was found to be expressed at high levels in tumor cells of metastatic tumors, with a significantly lower level expression in the vasculature. Our results suggest a shift in the cell-specific expression of PRL3 in breast cancer versus colon cancer. We observed a 6-fold induction in breast tumor endothelium by serial analysis of gene expression yet an apparent absence or low expression in surrounding epithelium by in situ hybridization. There is limited information on the role of this gene and its molecular targets, yet as a phosphatase it may have important roles in cell signaling. It has been shown recently that PRL3 promotes cell motility, invasion, and metastasis of Chinese hamster ovary cells (31) .
A gene found to be expressed at low levels in normal endothelium but at higher levels in breast tumor endothelium was VE-cadherin. This adherence molecule is localized to the interendothelial cell junction and has an important role in maintaining endothelial permeability. Previous studies support a role of VE-cadherin in angiogenesis and tumor growth when there is active vessel growth (32) . Antibodies directed toward VE-cadherin inhibit angiogenesis and modulate endothelial permeability (33 , 34) . Moreover, dominant-negative mutants of VE-cadherin inhibit endothelial growth (35) . Our results demonstrating an enhanced expression of VE-cadherin as disease progresses is consistent with previous findings suggesting a role for VE-cadherin in angiogenesis as opposed to vasculogenesis (reviewed in ref. 36 ).
For a tumor cell to invade the stroma and enter the circulation, it has to cross the extracellular matrix. This process requires proteinases (such as matrix metalloproteinase proteins) or the alteration of the extracellular matrix architecture. Osteonectin, which was found to be induced at least 7-fold in breast tumor endothelium, has a role in the latter. The fact that this protein was only expressed in endothelium of invasive breast cancer and not in ductal carcinoma in situ may support a role for this gene in altering extracellular matrix properties during tumor cell invasion and/or during angiogenesis. Osteonectin is a bone-matrix protein that has been previously found induced in mammary and other cancers, including prostate (37) . Tumor-promoting effects seem to be specific for prostate and breast to date, as studies in ovarian cancer have conversely shown that osteonectin expression is associated with decreased endothelial proliferation and apoptotic induction (38) . In normal tissue, osteonectin modulates cell-extracellular matrix interactions during tissue remodeling; regulates extracellular secretion of extracellular matrix components including regulation of the transendothelial flux of macromolecules; and is also involved in cell differentiation, cell migration, and angiogenesis. In prostate and breast cancer cells osteonectin enhances matrix metalloproteinase activity and promotes invasion and specific metastasis to bone in vivo. Osteonectin does not, however, stimulate tumor growth or promote invasion of cells that are not metastatic to bone (39) . This is an important finding, because bone metastasis is prevalent in both types of cancer and is associated with patient mortality. Therefore, osteonectin may have a role in distant metastasis, although its expression does not have any prognostic significance in studies undertaken thus far. Past studies are limited in suggesting a role for osteonectin in breast tumor endothelium. In fact, studies have focused on the role of osteonectin expression in tumor epithelium. In contrast, our immunohistochemistry experiments using single sections as well as tissue arrays show that the endothelium is the major site of expression of osteonectin in most tumors, whereas osteonectin was detectable in a very small proportion of the carcinoma cells within a small subset of tumors. It will be of interest to determine the role of osteonectin expression in the vasculature and whether such expression can predict the metastatic outcome of breast cancer.
A number of genes with decreased expression in tumor endothelium were identified. We identified the gene NRN1 as the most conserved, tumor-repressed vascular marker when we looked across colon, breast, and brain cancer vascular transciptomes. The neuritin gene was originally identified due to its induction by neural activity, being a downstream effector of activity-induced neurite outgrowth (40) . In the context of neuronal regulation, neuritin serves to promote growth as a membrane-bound, GPI-anchored protein (24) . It has become clear recently that several gene products seem to share roles in neurogenesis and angiogenesis (41) . Studies are ongoing to assess the functional significance of NRN1 expression in regulating angiogenesis.
This work provides novel insights into the genes that are altered in human breast cancer vasculature, suggesting roles in angiogenesis, tumor growth, and invasion. Although several common patterns in gene expression were observed in breast tumor vasculature compared with colon tumor vasculature, clear differences suggest unique signatures for tissue-specific tumor vasculature. Additional work will define the roles for these genes in driving tumor angiogenesis and vasculogenesis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: B. S. Parkers current address: Department of Research, Peter MacCallum Cancer Centre, Melbourne, Australia. A. Bardellis current address: The Oncogenomics Center, Institute for Cancer Research and Treatment, University of Torino Medical School, Torino, Italy.
Requests for reprints: Stephen L. Madden, Genzyme Corporation, 5 Mountain Road, Framingham, MA 01701. Phone: 508-270-2175; E-mail: steve.madden{at}genzyme.com
3 Internet address: http://www.ncbi.nlm.nih.gov/SAGE/index.cgi?cmd = libsearch. ![]()
Received 6/ 4/04. Revised 8/ 3/04. Accepted 8/24/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Wu, B. M. Evers, and B. P. Zhou Small C-terminal Domain Phosphatase Enhances Snail Activity through Dephosphorylation J. Biol. Chem., January 2, 2009; 284(1): 640 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, S.-R. Cai, Y.-L. He, W.-H. Zhan, C.-Q. Chen, J. Cui, W.-H. Wu, H. Wu, W. Song, C.-H. Zhang, et al. High Expression of PRL-3 can Promote Growth of Gastric Cancer and Exhibits a Poor Prognostic Impact on Patients Ann. Surg. Oncol., January 1, 2009; 16(1): 208 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bhati, C. Patterson, C. A. Livasy, C. Fan, D. Ketelsen, Z. Hu, E. Reynolds, C. Tanner, D. T. Moore, F. Gabrielli, et al. Molecular Characterization of Human Breast Tumor Vascular Cells Am. J. Pathol., May 1, 2008; 172(5): 1381 - 1390. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liang, Y. Luo, Y. Dong, C. D. Walls, J. Liang, H.-Y. Jiang, J. R. Sanford, R. C. Wek, and Z.-Y. Zhang Translational Control of C-terminal Src Kinase (Csk) Expression by PRL3 Phosphatase J. Biol. Chem., April 18, 2008; 283(16): 10339 - 10346. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Labelle, H. J. Schnittler, D. E. Aust, K. Friedrich, G. Baretton, D. Vestweber, and G. Breier Vascular Endothelial Cadherin Promotes Breast Cancer Progression via Transforming Growth Factor {beta} Signaling Cancer Res., March 1, 2008; 68(5): 1388 - 1397. [Abstract] [Full Text] [PDF] |
||||
![]() |
U.-M. Fagerli, R. U. Holt, T. Holien, T. K. Vaatsveen, F. Zhan, K. W. Egeberg, B. Barlogie, A. Waage, H. Aarset, H. Y. Dai, et al. Overexpression and involvement in migration by the metastasis-associated phosphatase PRL-3 in human myeloma cells Blood, January 15, 2008; 111(2): 806 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Leong, K. Niessen, I. Kulic, A. Raouf, C. Eaves, I. Pollet, and A. Karsan Jagged1-mediated Notch activation induces epithelial-to-mesenchymal transition through Slug-induced repression of E-cadherin J. Exp. Med., November 26, 2007; 204(12): 2935 - 2948. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chia, N. Kusuma, R. Anderson, B. Parker, B. Bidwell, L. Zamurs, E. Nice, and N. Pouliot Evidence for a Role of Tumor-Derived Laminin-511 in the Metastatic Progression of Breast Cancer Am. J. Pathol., June 1, 2007; 170(6): 2135 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Deleuze, E. Chalhoub, R. El-Hajj, C. Dohet, M. Le Clech, P.-O. Couraud, P. Huber, and D. Mathieu TAL-1/SCL and Its Partners E47 and LMO2 Up-Regulate VE-Cadherin Expression in Endothelial Cells Mol. Cell. Biol., April 1, 2007; 27(7): 2687 - 2697. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liang, J. Liang, W.-Q. Wang, J.-P. Sun, E. Udho, and Z.-Y. Zhang PRL3 Promotes Cell Invasion and Proliferation by Down-regulation of Csk Leading to Src Activation J. Biol. Chem., February 23, 2007; 282(8): 5413 - 5419. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lu, T. Bonome, Y. Li, A. A. Kamat, L. Y. Han, R. Schmandt, R. L. Coleman, D. M. Gershenson, R. B. Jaffe, M. J. Birrer, et al. Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma Cancer Res., February 15, 2007; 67(4): 1757 - 1768. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Loges, H. Clausen, U. Reichelt, M. Bubenheim, A. Erbersdobler, P. Schurr, E. Yekebas, G. Schuch, J. Izbicki, K. Pantel, et al. Determination of Microvessel Density by Quantitative Real-time PCR in Esophageal Cancer: Correlation with Histologic Methods, Angiogenic Growth Factor Expression, and Lymph Node Metastasis Clin. Cancer Res., January 1, 2007; 13(1): 76 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Guo, J. Li, H. Wang, M. Osato, J. P. Tang, S. Y. Quah, B. Q. Gan, and Q. Zeng PRL-3 Initiates Tumor Angiogenesis by Recruiting Endothelial Cells In vitro and In vivo Cancer Res., October 1, 2006; 66(19): 9625 - 9635. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Wang, L Peng, B Dong, L Kong, L Meng, L Yan, Y Xie, and C Shou Overexpression of phosphatase of regenerating liver-3 in breast cancer: association with a poor clinical outcome Ann. Onc., October 1, 2006; 17(10): 1517 - 1522. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. van Beijnum, R. P. Dings, E. van der Linden, B. M. M. Zwaans, F. C. S. Ramaekers, K. H. Mayo, and A. W. Griffioen Gene expression of tumor angiogenesis dissected: specific targeting of colon cancer angiogenic vasculature Blood, October 1, 2006; 108(7): 2339 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Duda Antiangiogenesis and drug delivery to tumors: bench to bedside and back. Cancer Res., April 15, 2006; 66(8): 3967 - 3970. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Stephens, H. Han, V. Gokhale, and D. D. Von Hoff PRL phosphatases as potential molecular targets in cancer Mol. Cancer Ther., November 1, 2005; 4(11): 1653 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Eckhardt, B. S. Parker, R. K. van Laar, C. M. Restall, A. L. Natoli, M. D. Tavaria, K. L. Stanley, E. K. Sloan, J. M. Moseley, and R. L. Anderson Genomic Analysis of a Spontaneous Model of Breast Cancer Metastasis to Bone Reveals a Role for the Extracellular Matrix Mol. Cancer Res., January 1, 2005; 3(1): 1 - 13. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |