Cancer Research AMC  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leu, Y.-W.
Right arrow Articles by Huang, T. H-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leu, Y.-W.
Right arrow Articles by Huang, T. H-M.
[Cancer Research 64, 8184-8192, November 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Loss of Estrogen Receptor Signaling Triggers Epigenetic Silencing of Downstream Targets in Breast Cancer

Yu-Wei Leu1, Pearlly S. Yan1, Meiyun Fan2,3, Victor X. Jin1, Joseph C. Liu1, Edward M. Curran4, Wade V. Welshons4, Susan H. Wei1, Ramana V. Davuluri1, Christoph Plass1, Kenneth P. Nephew2,3 and Tim H-M. Huang1

1 Human Cancer Genetics Program, Department of Molecular Virology, Immunology, and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio; 2 Medical Sciences, Indiana University School of Medicine, Bloomington, Indiana; 3 Department of Cellular and Integrative Physiology and Obstetrics and Genecology, Indiana University Cancer Center, Indianapolis, Indiana; and 4 Department of Veterinary Biomedical Sciences, University of Missouri, Columbia, Missouri


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Alterations in histones, chromatin-related proteins, and DNA methylation contribute to transcriptional silencing in cancer, but the sequence of these molecular events is not well understood. Here we demonstrate that on disruption of estrogen receptor (ER) {alpha} signaling by small interfering RNA, polycomb repressors and histone deacetylases are recruited to initiate stable repression of the progesterone receptor (PR) gene, a known ER{alpha} target, in breast cancer cells. The event is accompanied by acquired DNA methylation of the PR promoter, leaving a stable mark that can be inherited by cancer cell progeny. Reestablishing ER{alpha} signaling alone was not sufficient to reactivate the PR gene; reactivation of the PR gene also requires DNA demethylation. Methylation microarray analysis further showed that progressive DNA methylation occurs in multiple ER{alpha} targets in breast cancer genomes. The results imply, for the first time, the significance of epigenetic regulation on ER{alpha} target genes, providing new direction for research in this classical signaling pathway.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The steroid hormone estrogen is important for normal breast development, but it is also important for growth and progression of breast cancer. The molecular actions of estrogen are mediated by estrogen receptors (ERs), ER{alpha} and ERß. On ligand binding, ER{alpha} functions as a transcription factor by either binding to DNA targets or tethering to other transcription factors, such as AP-1 and SP-1 (1) . These molecular interactions have been shown to positively or negatively modulate the activity of ER{alpha} downstream genes important to breast epithelial development.

It is known that estrogen signaling regulates the growth of some breast tumors, and antiestrogen therapies can effectively block this growth signaling, resulting in tumor suppression (2) . However, most tumors eventually develop resistance to this endocrine therapy, and antiestrogens are mostly ineffective in patients with advanced disease (2) . Mechanisms underlying this hormonal resistance are complex, involving intricate interactions between ER{alpha} and kinase networks (1 , 2) . In addition, epigenetic silencing of ER{alpha} is known to contribute to the antiestrogen resistance (1 , 2) . An emerging theme not yet investigated in this field is the subsequent influence on the expression of ER{alpha} downstream target genes.

Epigenetics can be defined as the study of heritable changes that modulate chromatin organization without altering the corresponding DNA sequence. DNA methylation, the addition of a methyl group to the fifth carbon position of a cytosine residue, occurs in CpG dinucleotides (3) and is a key epigenetic feature of the human genome. These dinucleotides are usually aggregated in stretches of 1- to 2-kb GC-rich DNA, called CpG islands, located in the promoter and first exon of ~60% of human genes (3 , 4) . Promoter methylation is known to participate in reorganizing chromatin structure and also plays a role in transcriptional inactivation (3 , 5) . Studies have suggested that the CpG island in an active promoter is usually unmethylated, with the surrounding chromatin displaying an "open" configuration, allowing for the access of transcription factors and other coactivators to initiate gene expression (6, 7, 8) . Furthermore, transcription factor occupancy may make the promoter inaccessible to repressors or other chromatin-remodeling proteins. In contrast, the CpG island in an inactive promoter may become methylated, with the associated chromatin exhibiting a "closed" configuration. As a result, the methylated area is no longer accessible to transcription factors, disabling the functional activity of the promoter (7 , 9 , 10) .

Recent studies have shown that establishing transcriptional silencing of a gene involves a close interplay between DNA methylation and histone modifications (7 , 11) . This process may be achieved by recruiting histone-modifying enzymes, such as histone deacetylases, which mediate posttranslational modification at the NH2 terminus ends of histones (7 , 11) . As a result, chromatin modifications form distinct patterns, known as the "histone code," that may dictate gene expression (12, 13, 14) .

Two models have been offered to describe the molecular sequence leading to the establishment of epigenetic gene silencing. One model suggests that histone modifications are the primary initiating event in transient repression (15 , 16) . DNA methylation subsequently accumulates in the targeted CpG island, creating a heterochromatin environment to establish a heritable, long-term state of transcriptional silencing. However, a second model is that DNA methylation can actually specify unique histone codes for maintaining the silenced state of a gene (17, 18, 19, 20) . In this case, DNA methylation may precede histone modifications. Clearly, this epigenetic process is complex, and multiple systems may be implemented for genes participating in different signaling pathways.

In this study, we investigated whether the removal of ER{alpha} signaling triggers changes in DNA methylation and chromatin structure of ER{alpha} target promoters. By using RNA interference (RNAi) to transiently disable ER{alpha} in breast cancer cells, we show, for the first time, that polycomb repressors and histone deacetylases assemble on the promoters of interrogated ER{alpha} target genes to participate in long-term transcriptional silencing. These events are later accompanied by a progressive accumulation of DNA methylation in the promoter regions of the now silent targets, leaving a heritable "mark" that may be stably transmitted to cell progeny.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Clinical Samples.
The breast cancer cell line MCF-7 and its derived subline, C4-12, were routinely maintained in our laboratories. For the demethylating treatment, cells were plated at a density of 2 x 106 cells per 10-cm dish and pretreated with 2 or 5 µmol/L 5-aza-2'-deoxycytidine (5-AzadC; Sigma, St. Louis, MO) for 5 days before treatment with 17ß-estradiol (E2; 10 nmol/L, 24 hours). Thirty-two invasive ductal carcinomas were obtained from patients undergoing breast surgery at the Ellis Fischel Cancer Center (Columbia, MO), in compliance with the institutional review board. Seven tumor-free breast parenchymas were used as controls. The ER status of tumor tissue was determined by immunohistochemical staining (21) .

Transfection of Estrogen Receptor {alpha} Small Interfering RNAs.
MCF-7 cells (60% confluent in a 3.5-cm–diameter culture dish) were starved in serum-free medium (minimal essential medium only) for 72 hours, followed by the addition of 10 nmol/L E2 (E2758; Sigma) for 24 hours. The cells were then transfected with small interfering RNAs (siRNAs) for 4 to 5 hours with DMRIE-C reagent (Invitrogen, Carlsbad, CA). Double-stranded siRNA was generated using the Silencer siRNA Construction Kit (Ambion, Austin, TX). The siRNA oligonucleotides designed according to the ER{alpha} mRNA sequence (GenBank accession numbers AF_258449, 258450, and 258451) are as follows: (a) target sequence 1 (5'-AACCTCGGGCTGTGCTCTTTT), sense strand siRNA primer 5'-CCTCGGGCTGTGCTCTTTTTTCCTGTCTC and antisense strand siRNA primer AAAAGAGCACAGCCCGAGGTTCCTGTCTC; and (b) target sequence 17 (5'-AAACAGGAGGAAGAGCTGCCA), sense strand siRNA primer 5'-ACAGGAGGAAGAGCTGCCATTCCTGTCTC and antisense strand siRNA primer 5'-TGGCAGCTCTTCCTCCTGTTTCCTGTCTC.

Media were changed after transfection. The cells were then harvested for total RNA (RNeasy Kit; Qiagen, Valencia, CA) and genomic DNA (QIAamp; Qiagen) isolation at various time periods after siRNA treatment.

Transfection of Estrogen Receptor {alpha} Expression Vector.
C4-12 cells were transfected with pcDNA-ER{alpha} (C4-12/ER) or empty vector (C4-12/vec) using LipofectAMINE Plus Reagent (Life Technologies, Inc., Carlsbad, CA) and then exposed to an antibiotic (G418; 0.5 mg/mL) for 3 weeks. Expression of ER{alpha} in G418-resistant colonies was detected by immunoblotting with an anti-ER antibody (Chemicon, Temecula, CA).

Real-Time Reverse Transcription-Polymerase Chain Reaction.
Total RNA (2 µg) was treated with DNase I to remove potential DNA contamination and then reverse transcribed using the SuperScript II reverse transcriptase (Invitrogen). Real-time polymerase chain reactions (PCRs) were then performed using puReTaq Ready-To-Go PCR beads (Amersham Biosciences, Piscataway, NJ) and monitored by SYBR Green I (BioWhittaker, Walkersville, MD) using a Smart Cycler Real-Time PCR instrument (Cepheid, Sunnyvale, CA) for 42 cycles. PCR products of the expected size were also visualized on agarose gels stained with ethidium bromide. Alternatively, the reverse transcription-PCR (RT-PCR) reaction was conducted using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) in an iCycler system (Bio-Rad) for PR transcripts (22) . The relative mRNA level of a given locus was calculated by Relative Quantitation of Gene Expression (Applied Biosystems, Foster City, CA) with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or ß-actin mRNA as an internal control. The primers used for RT-PCR reactions are listed in Supplementary Table S1.

Immunofluorescence and Western Blot Analysis.
MCF-7 cells (2 x 105) treated with or without ER{alpha} siRNAs were permeablized with 0.5% Nonidet P-40/PBS and blocked with a 1:100 dilution of horse serum before incubation with primary anti-ER{alpha} antibody (1:1,000; mouse monoclonal antibody D-12; Santa Cruz Biotechnology, Santa Cruz, CA). Sample slides were washed with PBS and incubated in the dark with secondary antibody (1:500) conjugated with Texas Red (fluorescent antimouse IgG kit; Vector Laboratories, Burlingame, CA) for 1 hour. The slides were then mounted with Vectashield mounting medium with 4',6-diamidino-2-phenylindole (Vector Laboratories) and observed under a fluorescence microscope (Zeiss Axioskop 40; Zeiss, Thornwood, NY). Images were captured by the AxioCam HRC camera and analyzed by AxioVision 5.05 software.

Small interfering RNA-treated cells and control cells were lysed in the presence of proteinase inhibitors. One hundred micrograms of protein were subjected to 7% SDS-PAGE and transferred to immunoblot membranes. The membranes were then incubated with mouse anti-ER{alpha} (MAB463; Chemicon) and labeled secondary antibody. GAPDH was used a loading control.

Chromatin Immunoprecipitation-Polymerase Chain Reaction.
Cultured cells (2 x 106) were cross-linked with 1% formaldehyde and then washed with PBS in the presence of protease inhibitors. The cells were resuspended in lysis buffer, homogenized using a tissue grind pestle to release nuclei, and then pelleted by centrifugation. SDS-lysis buffer from a chromatin immunoprecipitation (ChIP) assay kit (Upstate Biotechnology, Lake Placid, NY) was used to resuspend the nuclei. The lysate was sonicated to shear chromatin DNAs and then centrifuged to remove cell debris. The supernatants were transferred to new tubes and incubated overnight with an antibody against ER{alpha}, YY-1, or EZH2 (Santa Cruz Biotechnology); HDAC1, MBD2, or MeCP2 (Upstate Biotechnology); and DMNT1, DNMT3a, or DNMT3b (Imgenex, San Diego, CA). Agarose slurry was then added to the mixture, and the chromatin-bound agarose was centrifuged. The supernatant was collected and used for total input (it serves as a positive control) in the ChIP-PCR assay. After elution, proteins were digested from the bound DNA with proteinase K. Phenol/chloroform-purified DNA was then precipitated and used in ChIP-PCR assays for a progesterone receptor (PR) promoter region. The primer sequences were 5'-GGCTTTGGGCGGGGCCTCCCTA (sense strand) and 5'-TCTGCTGGCTCCGTACTGCGG (antisense strand). After amplification, 32P-incorporated PCR products were separated on 8% polyacrylamide gels and subjected to autoradiography using a Storm PhosphorImager (Amersham Biosciences).

Methylation-Specific Polymerase Chain Reaction.
Genomic DNA (1 µg) from each sample was bisulfite-converted using the EZ DNA Methylation Kit (Zymo Research Corp., Orange, CA), according to the manufacturer’s protocol. The converted DNA was eluted with 40 µL of elution buffer and then diluted 50 times for methylation-specific PCR (MSP). The primer sets designed for amplifying the methylated or unmethylated allele of the PR locus are listed in Supplementary Table S2. All PCR reactions were performed in PTC-100 thermocyclers (MJ Research, Watertown, MA) using AmpliTaq Gold DNA polymerase (Applied Biosystems). 32P-incorporated amplified products were separated on 8% polyacrylamide gels and subjected to autoradiography using a Storm PhosphorImager (Amersham Biosciences).

Combined Bisulfite Restriction Analysis.
Combined bisulfite restriction analysis (COBRA) was carried out essentially as described previously (23) . Bisulfite-modified DNA (~10 ng) was used as a template for PCR with specific primers flanking the interrogated sites (TaqI or BstUI) of an ER{alpha} downstream target. Primer sequences used for amplification are listed in Supplementary Table S3. After amplification, radiolabeled PCR products were digested with TaqI or BstUI, which restrict unconverted DNA containing methylated sites. The undigested control and digested DNA samples were run in parallel on polyacrylamide gels and subjected to autoradiography. The percentage of methylation was determined as the intensity of methylated fragments relative to the combined intensity of unmethylated and methylated fragments.

Chromatin Immunoprecipitation on Chip.
MCF-7 cells (2 x 107) were used to conduct ChIP with an antibody specific for ER{alpha} following the protocol described (see Chromatin Immunoprecipitation-Polymerase Chain Reaction). After chromatin coimmunoprecipitation, DNA was labeled with Cy5 fluorescence dye and hybridized to a genomic microarray panel containing ~9,000 CpG islands (24) . Microarray hybridization and posthybridization washes have been described previously (25) . The washed slides were scanned by a Gene Pix 4000A scanner (Axon, Union City, CA), and the acquired microarray images were analyzed with GenePix Pro 4.0 software. This ChIP-on-chip experiment was conducted twice.

Positive CpG island clones were sequenced, and the derived sequences were used to identify putative transcription start sites by Blastn5 or Blat.6 Both Genomatrix7 and TFSEARCH8 programs were then used to localize the consensus sequences of the estrogen response elements (EREs) and other related transcription factor binding sites (AP-1, SP-1, cAMP-responsive element binding protein, and CEBP).

Differential Methylation Hybridization.
Differential methylation hybridization (DMH) was performed essentially as described previously (25 , 26) . Briefly, 2 µg of genomic DNA were digested by the 4-base frequent cutter MseI, which restricts bulk DNA into small fragments but retains GC-rich CpG island fragments (24) . H-24/H-12 PCR linkers (5'-AGGCAACTGTGCTATCCGAGGGAT-3' and 5'-TAATCCCTCGGA-3') were then ligated to the digested DNA fragments. The DNA samples were further digested with two methylation-sensitive endonucleases, HpaII and BstUI, and amplified by PCR reaction using H-24 as a primer. After amplification, test DNA from siRNA-treated cell lines or clinical samples was labeled with Cy5 (red) dye, whereas control DNA from the mock-transfected cell lines or normal female blood samples was coupled with Cy3 (green) dye. Equal amounts of test and control DNAs were cohybridized to a microarray slide containing 70 ER{alpha} promoter targets (average, 500 bp) identified from the ChIP-on-chip results. Posthybridization washing and slide scanning are described above. Normalized Cy5/Cy3 ratios of these loci were calculated by GenePix Pro 4.0.

Shrunken Centroids Analysis.
DMH microarray data were analyzed by the procedure described online.9 This program incorporates graphic methods for automatic threshold choice and centroid classification.

Statistical Analyses.
Differences of methylation or mRNA levels in experimental studies were analyzed by a paired t test. Methylation differences between two tumor groups were determined with a Pearson’s {chi}2 test. P < 0.05 was considered statistically significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RNA Interference Transiently Knocks Down Estrogen Receptor {alpha} Expression in Breast Cancer Cells.
Although several in vitro systems and mouse models are available for analysis of estrogen signaling, to our knowledge, the recently described RNAi (27) has not been actively used in this area of research. We therefore used this technology to specifically repress ER{alpha} gene expression via targeted RNA degradation (28 , 29) . Six different ER{alpha} siRNAs, two of which have sequences homologous to a splice variant, were synthesized (Fig. 1A)Citation . These siRNAs (40 nmol/L) were individually transfected into MCF-7, an ER{alpha}-positive human breast cancer cell line. MCF-7 cells were cultured in the presence of E2. Quantitative RT-PCR analysis showed that, 24 hours after transfection, two siRNAs, siRNAs 1 and 17, were capable of repressing ER{alpha} transcripts (Fig. 1B)Citation . Specifically for siRNA 1, we observed a >93% decrease of ER{alpha} mRNA. Immunofluorescence (Fig. 1C)Citation and Western blot (Fig. 1D)Citation analyses confirmed that this RNAi also dramatically reduced ER{alpha} protein synthesis. This inhibitory effect appeared to be transient, and the expression of ER{alpha} protein reappeared in cultured cells 4 weeks after RNAi withdrawal (Fig. 1D)Citation .



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Down-regulation of ER{alpha} by siRNAs. MCF-7 ER{alpha}-positive human breast cancer cells were transfected with six different double-stranded siRNAs for 4 hours. Cells were left untreated for an additional 24 hours, and total RNA and proteins were then harvested for analysis. Additionally, cells were left untreated for a prolonged period of 3 to 4 weeks (see RNAi withdrawal in D), and proteins were harvested for analysis. Mock-treated cells were transfected with vehicle only. A, map of ER{alpha} cDNA. The ER{alpha} mRNAs were transcribed from several unique first exons and seven other common exons. An additional splice variant (between exons 3 and 4) is also shown. Approximate locations of siRNAs (1, 2, 16, 17, 37, and 38) are indicated by bars. B, RT-PCR of ER{alpha}. PCR primers specifically for the splice variant (ER-sv) and the common transcripts (ER-c) are indicated by arrows in A. The GAPDH transcript was used as a control. The expression levels of ER-sv or ER-c were normalized against GAPDH (bottom panel) by real-time PCR. C, immunofluorescence analysis of ER{alpha} expression. Small interfering RNA 1- or mock-treated MCF-7 cells were cultured on microscope coverslips and incubated with an ER{alpha} antibody. Positive nuclei staining (Texas Red) was seen only in mock-treated cells (with antibody), but not in siRNA 1-treated (with antibody) or mock-treated (without antibody) cells. 4',6-Diamidino-2-phenylindole was used to counterstain nuclei (blue). D, Western blot analysis of ER{alpha} expression. Cellular protein products from various treatments were harvested and separated by SDS-PAGE for immunoblot analysis with ER{alpha} and GAPDH (loading control) antibodies, respectively. Results are representative of at least three independent experiments.

 
Epigenetic Silencing of the PR Gene Is Triggered by Estrogen Signal Disruption.
We hypothesized that disruption of ER{alpha} signaling by siRNA may lead to the silencing of some positively regulated ER{alpha} targets governed by epigenetic mechanisms. To this end, a known ER{alpha} downstream target, the PR gene, was investigated in detail. In Fig. 2A and BCitation , quantitative RT-PCR analysis showed that by 36 hours after treatment of MCF-7 cells with siRNA 1, the level of PR transcripts (PR-A and PR-B) was reduced by >95% (paired t test, P < 0.0001). Next, ChIP-PCR was performed to determine the status of chromatin remodeling at the 5'-end of the PR gene. The protein-DNA complexes were immunoprecipitated with antibodies to ER{alpha} or to specific modified histones (acetyl-H3, acetyl-H3-K9, and methyl-H3-K4) known to specify active transcription (7 , 30) . As shown in Fig. 2CCitation , the presence of these active chromatin components was diminished over a period of 36 hours, coinciding with decreased ER{alpha} binding to the PR promoter region.



View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Loss of estrogen signaling leads to epigenetic silencing of the PR gene. A, genomic map of the PR promoter CpG island. The positions of CpG sites in the genomic sequence are indicated by thin vertical lines. The positions of two alternative transcription start sites, PRA and PRB, respectively, are indicated by bent arrows. Potential transcription factor binding sites (AP-1 and Sp1) resulting from a TFSEARCH query (www.cbrc.jp/htbin/nph-tfsearch) are marked by vertical arrows. The location of the PR promoter fragment used for the ChIP assay and the two regions (MSP1 and MSP2) used for MSP are indicated by horizontal lines (see Fig. 3ACitation ). The region amplified for COBRA is underlined, and the two vertical arrows indicate the interrogating TaqI restriction (TCGA) sites (see Fig. 3CCitation ). B, time course inhibition of PR transcripts by siRNA treatment. MCF-7 cells were transfected with ER{alpha} siRNA 1 for the indicated time periods (8, 24, and 36 hours) and harvested for real-time RT-PCR. Mock-transfected cells were harvested at the 36 hour time point. Primers were designed to amplify a common region of the two known PR transcripts. Relative levels of PR transcripts were normalized against that of the GAPDH loading control. Results from three independent experiments are shown as means ± SE. C, ChIP-PCR assay for activating chromatin modifications on the PR CpG promoter island. Chromatin DNA was immunoprecipitated with antibodies specific for ER{alpha}, acetylated histone H3 (acetyl-H3 and/or acetyl-H3-K9), or dimethyl-H3-K4. DNA fragments were amplified with a primer pair located in a PR CpG island region (indicated in A). The final radiolabeled products were separated on 6% polyacrylamide gels and subjected to autoradiography. In, total input; –, without antibody; +, with antibody. D, ChIP-PCR assays for repressive chromatin modifications on the PR promoter CpG island region at 36 and 168 hours after ER{alpha} siRNA treatment. Antibodies against polycomb repressors (YY-1 and EZH2), histone deacetylase (HDAC1), methyl-CpG binding proteins (MBD2 and MeCP2), and DNA methyltransferases (DMNT1, DNMT3a, and DNMT3b) were used in ChIP-PCR assays. In, total input; –, without antibody; +, with antibody.

 
We speculated that this initial transcriptional inactivation might trigger further recruitment of repressor molecules to the PR promoter CpG island to subsequently establish a long-term silencing state. ChIP-PCR assays were conducted with a panel of antibodies raised for the polycomb repressors YY-1 and EZH2, histone deacetylase HDAC1, methyl-CpG–binding proteins MBD2 and MeCP2, and DNA methyltransferases DMNT1, DNMT3a, and DNMT3b. At 36 hours after siRNA treatment, YY-1 and EZH2 were bound to the promoter region (Fig. 2D)Citation . These polycomb proteins have previously been shown to target the regulatory regions of homeobox genes, the resulting repression of which can be tissue specific and important for early embryonic development (31 , 32) . Here we demonstrate for the first time that these proteins have an additional role in repressing an ER{alpha} target gene. Furthermore, the PR promoter was seen, at 36 hours, to recruit HDAC1 (Fig. 2D)Citation , a protein known to deacetylate histone protein tails, creating a repressive heterochromatin environment in the targeted promoter area (7 , 9 , 10) . However, at this early time point (36 hours), ChIP-PCR analysis did not detect the presence of the DNA methyltransferase DNMT1 in the PR promoter CpG island area (Fig. 2D)Citation , nor did we observe the presence of MBD2 or MeCP2, which are known to bind methylated CpG sites. Only a faint band corresponding to DNMT3b was detected in the PR promoter area by 36 hours after ER{alpha} siRNA treatment of MCF-7 cells. Except for DNMT3a, the recruitment of these repressive proteins to the PR promoter CpG island was evident by 168 hours after siRNA treatment.

To further determine whether the recruitment of these epigenetic components could trigger de novo DNA methylation, MSP assays (33) were conducted to survey two 5'-end regions of PR at different time periods after siRNA treatment. As shown in Fig. 3ACitation , PR methylation was detected in amplified bisulfite-treated DNA only at 36 hours after treatment. This observation was independently confirmed by conducting semiquantitative COBRA (23) . In the assay, ~10% of MCF-7 cells showed methylation in one (Fig. 2ACitation , TaqI-2) of the two PR TaqI sites analyzed 36 hours after siRNA treatment (Fig. 3B)Citation . Both of these sites became methylated at a later time point (168 hours) of treatment (Fig. 3B)Citation . This study implies that acquired DNA methylation is a late event and that the density of DNA methylation may gradually accumulate at the 5'-end of PR after disrupting ER{alpha} signaling by siRNA.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. DNA methylation analysis of the PR promoter by MSP and COBRA. A, bisulfite-treated DNA samples from siRNA- and mock-treated cells were used for amplification with specific primers for MSP1 and MSP2 (see Fig. 2ACitation ). Radiolabeled PCR products for unmethylated (Lanes U) and methylated (Lanes M) DNA strands were separated on 6% polyacrylamide gels. B. For COBRA, bisulfite DNA samples from siRNA- and mock-treated cells were amplified and digested with TaqI enzyme and then separated on polyacrylamide gels. The digested DNA fragments (a, b, and c) indicated by the arrows reflect methylation of TaqI restriction sites within the PR promoter CpG island (see Fig. 2ACitation ). An asterisk indicates PCR artifact or primer-dimer. C, COBRA of PR promoter in ER{alpha}-positive and -negative breast tumors. The percentage of positive methylation was calculated as the intensity of methylated fragments relative to the combined intensity of unmethylated and methylated fragments (right panel). All DNA methylation data shown here are representative of at least three independent experiments.

 
Next, we determined whether this acquired promoter methylation could be observed in ER{alpha}-negative breast tumors. COBRA was therefore conducted in 32 primary tumors (16 ER{alpha}-negative and 16 ER{alpha}-positive tumors) and 7 normal controls (see representative examples in Fig. 3CCitation ). Consistent with the in vitro findings, PR promoter hypermethylation occurred more frequently in ER{alpha}-negative tumors (45%) than in ER{alpha}-positive tumors (10%) ({chi}2 test, P < 0.05).

Reexpression of PR Requires Both Estrogen Signal Restoration and DNA Demethylation.
The in vitro experimental results described above are based on transient siRNA treatment. To determine whether this signal disruption has a lasting impact on PR expression, we took advantage of an ER{alpha}-negative cell subline, C4-12, derived from ER{alpha}-positive MCF-7 cells by long-term hormonal depletion (34) . A recent study has indicated that PR gene expression is absent in this cell line (35) . We therefore examined whether stably reexpressing ER{alpha} could restore PR gene activity in several established C4-12 subclones (C4-12/vec, C4-12/ER#1, C4-12/ER#50, and C4-12/ER#86; see examples in Fig. 4ACitation , inset).



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Treatment of C4-12/ER cells with 5-AzadC restores PR mRNA expression. A. Expression levels of PR mRNA in C4-12/Vec and C4-12/ER cells were determined after treatment with the indicated doses of 5-AzadC for 5 days, followed by 10 nmol/L E2 for 24 hours. PR mRNA levels were measured by quantitative real-time RT-PCR and normalized using ß-actin mRNA levels. The results (X± SE) are shown from two independent experiments, each in triplicate. ER{alpha} expression in C4-12 cells #86 (A, inset) was detected by immunoblotting with an anti-ER{alpha} antibody. B, analysis of PR promoter by MSP assay. Bisulfite-treated DNAs from cells treated with or without 5-AzadC were amplified with specific primers for the PR promoter CpG island (i.e., the MSP1 region in Fig. 2ACitation ). Radiolabeled PCR products for unmethylated (Lanes U) and methylated (Lanes M) DNA strands were separated on 6% polyacrylamide gels. MSP data shown here are representative of three independent experiments.

 
Treatment of these subclones (e.g., C4-12/ER#86 in Fig. 4ACitation ) with E2, however, failed to induce PR mRNA expression, demonstrating that reintroduction of ER{alpha} alone was insufficient to reactivate expression of a silent PR gene. To determine whether loss of PR expression was due to DNA methylation, C4-12/vec (i.e., cells stably transfected with empty vector) and C4-12/ER#86 cells were pretreated with 5-AzadC, a DNA demethylating agent, before E2 treatment. As shown in Fig. 4ACitation , sequential treatment with 5-AzadC followed by E2 resulted in reexpression of PR mRNA in C4-12/ER#86 cells, but not in C4-12/vec cells, demonstrating that both ER{alpha} expression and DNA demethylation are required to restore PR expression. To further confirm that reactivation of the PR gene was due to DNA demethylation, the methylation status of the PR promoter CpG island region was examined by MSP (Fig. 4B)Citation . In contrast to MCF-7 cells in which the PR promoter CpG island was unmethylated (Fig. 3A)Citation , methylation was observed in both C4-12/vec and C4-12/ER cells (Fig. 4BCitation , Lanes 1, 2, and 5–10). However, after treatment with 5-AzadC, PR promoter methylation was partially reversed in C4-12/vec cells (Fig. 4BCitation , Lanes 3 and 4) and completely removed in C4-12/ER#86 cells (Fig. 4BCitation , Lanes 11 and 12). Together, these results demonstrate that the silencing of PR is maintained, in part, by DNA methylation in the ER{alpha}-negative C4-12 cells and that reactivation of the PR promoter requires both the presence of ER{alpha} and DNA demethylation.

DNA Methylation of Multiple Estrogen Receptor {alpha} Downstream Targets Is Triggered by Disrupting Receptor Signaling.
To determine whether this epigenetically mediated silencing is a generalized event, we used ChIP-on-chip, a novel microarray-based method developed in our laboratory (36 , 37) , for a genome-wide screening of ER{alpha} downstream targets. In this case, we probed a panel of ~9,000 arrayed CpG island fragments with anti-ER{alpha}–coimmuoprecipitated chromatins. Putative target sequences were used to search for the presence of ER{alpha} binding motifs, EREs, and other related binding sites (e.g., AP-1, SP-1, cAMP-responsive element binding protein, and CEBP) by using the Genomatrix7 and TFSEARCH8 programs. These computational algorithms identified a total of 70 unique ER{alpha} promoter targets, which were used to construct a subpanel genomic microarray (see a partial list of the genes in Supplementary Table S4). The previously described DMH method (25 , 26) was then used to determine the DNA methylation status of these ER{alpha} targets in siRNA-treated versus mock-treated MCF-7 cells. Amplicons representing genomic pools of methylated DNAs were prepared from these treated cells using our established protocols (25 , 26) . Cy5 (red dye)- and Cy3 (green dye)-labeled DNAs were prepared from siRNA- and mock-treated cells, respectively, and cohybridized to microscope slides containing the arrayed 70 unique ER{alpha} targets. ER{alpha} target loci methylated in siRNA-treated cells, but not in mock-treated cells, were expected to show greater Cy5/Cy3 hybridization signals. This is because methylated CpG sites are protected from methylation-sensitive restriction (i.e., HpaII and BstUI) and could thus be amplified by a linker-PCR approach during amplicon preparation. In contrast, unmethylated CpG sites were restricted by the methylation-sensitive enzymes, could not be amplified by PCR, and were thus devoid of hybridization signals.

To analyze our microarray data, we adapted the "shrunken centroids method" (38) to define the threshold setting for class prediction of methylated ER{alpha} target loci. This approach can be used to uniquely define the threshold level that statistically discriminates ER{alpha} loci commonly methylated in siRNA-treated cells from the same loci in mock-treated cells. After initial evaluation of the microarray data, we chose the threshold value 2.0 that generates less error (≤0.3) for cross-validation (data not shown). When the cross-validation variances from individual samples were plotted (Fig. 5A)Citation , many ER{alpha} target loci could be used to discriminate between siRNA-treated cells and mock-treated counterparts (manifested as having many loci with no misclassification error) at the 168 hour time point. However, this threshold level was not sufficiently stringent to discriminate between the mock- and siRNA-treated cell samples at 24 or 36 hours (manifested as having very few loci with low misclassification error). In Fig. 5BCitation , the actual methylation status of individual loci, in comparison with the predicted centroids, is plotted to present an overall change of DNA methylation at different time periods of siRNA treatment. Relative to the overall predicted centroids, a positive value of a locus indicates more methylation during the treatment, whereas a negative value indicates less methylation. This shrunken centroids map revealed that de novo DNA methylation can be detected in a subset of ER{alpha} targets 168 hours after siRNA treatment, but not in cells treated for only 24 or 36 hours after treatment.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Acquired DNA methylation in multiple ER{alpha} downstream targets after estrogen signal disruption. Seventy ER{alpha} downstream targets were analyzed by DMH, as described in the text. Fluorescence-labeled methylation amplicons were prepared from siRNA-treated (24, 36, and 168 hours) and mock-treated (168 hours) MCF-7 cells, respectively, and cohybridized to ER{alpha} microarray slides. The hybridization output is the measured relative intensity of fluorescence reporter molecules. A, test error for different values of shrinkage. Shrunken centroids analysis was conducted using methylation microarray datasets (see detailed description in the text). Tenfold cross-validation was used to estimate the error rate, when a different degree of shrinkage was used to generate the centroids. B. Predicted centroids, shown as horizontal units, represent log ratios of DNA methylation. The order of the 70 ER{alpha} target loci is arbitrary. Methylation changes were seen only in a few loci at 24 or 36 hours after siRNA treatment; however, a significant methylation change was seen at 168 hours (7 days; P < 0.05), displaying positively shrunken values for these 70 loci. C, methylation heat map of the 21 selected ER{alpha} loci at different time periods after siRNA treatment. These loci were selected because a threshold (threshold = 2; error rate ≤ 0.3) from cross-validation showed fewer errors in methylation microarray experiments. As shown, DNA methylation of these loci accumulates progressively over time (168 hours) after the siRNA treatment. Data shown here represent three independent microarray experiments. D, methylation heat map of the top 12 methylated ER{alpha} loci in ER{alpha}-negative tumors. Microarray-based DMH was conducted in these clinical samples as described in the text. The derived microarray data were analyzed by the shrunken centroids method.

 
To validate the findings of the shrunken centroid analysis, unsupervised cluster analysis was performed on the microarray data, using the top 21 methylated loci selected by machine training ("heat map" shown in Fig. 5CCitation ). The result reaffirms the shrunken centroid data in that replicates of each treatment type are clustered together and that the level of methylation increased with the extent of siRNA treatment. A paired t test revealed that the methylation status of these 21 loci was significantly different (P < 0.05) between the mock-treated (ER{alpha}-positive) and siRNA-treated (ER{alpha}-negative) cells.

This microarray observation was independently validated by conducting expression and DNA methylation analyses on three newly identified ER{alpha} downstream targets, TRIP10, Kr-Znf1, and DCC. In general, the decreased levels of these mRNAs preceded the emergence of DNA methylation at their respective promoter CpG islands (Fig. 6A and B)Citation . This epigenetically mediated silencing also indirectly influenced the expression of MTA3, a gene known to be regulated via a downstream ER{alpha} target and to participate in Mi-2/NuRD nucleosome remodeling (Fig. 6BCitation ; ref. 39 ).



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Methylation and expression analysis of ER{alpha} target genes. A. For methylation-specific PCR assays, bisulfite-treated DNA samples from siRNA- or mock-treated cells were used for amplification with specific primers for TRIP10 and Kr-Znf1, respectively. 32P-labeled PCR products for unmethylated (Lanes U) and methylated (Lanes M) DNA strands were separated and displayed on 6% polyacrylamide gels (left panels). Messenger RNA levels of these genes were measured by quantitative real-time RT-PCR (right panels) and normalized using GAPDH mRNA expression levels, as described in the text. Results from three independent experiments are shown as means ± SE. The expression level of these genes was significantly reduced by the siRNA treatment (paired t test, P < 0.017 for TRIP10 and P < 0.048 for Kr-Znf1). B. For DCC and MTA genes, COBRA was used to measure DNA methylation. Bisulfite DNA samples were amplified and digested with BstUI enzyme and separated on polyacrylamide gels. The digested DNA fragments shown by arrows reflect methylation at the BstUI restriction sites within the DCC promoter CpG island (left panels). Messenger RNA levels of these genes were measured by quantitative real-time RT-PCR (right panels) and normalized using GAPDH mRNA expression levels, as described in the text. Results from three independent experiments are shown as means ± SE. The expression level of these genes was significantly reduced by siRNA treatment (paired t test, P < 0.03 for DCC and P < 0.014 for MTA3). C. MSP analysis of the TRIP10 promoters in 16 ER{alpha}-positive and 16 ER{alpha}-negative breast tumors. Only representative results are shown.

 
DNA Methylation of ER{alpha} Downstream Targets is Preferentially Observed in ER{alpha}-Negative Tumors.
We next determined whether this in vitro finding could be seen in vivo. DMH was therefore conducted using the aforementioned 32 primary breast tumors and 7 normal controls. The derived microarray data were then analyzed by the shrunken centroid method. Although the methylation results of these 70 ER{alpha} target loci did not clearly segregate tumor samples into subclasses, we observed a general trend that methylated loci appear more frequently in ER{alpha}-negative tumors than in ER{alpha}-positive tumors (P < 0.05). Fig. 5DCitation presents a heat map of the 12 most methylated loci in the studied breast tumors. As shown, we observed higher overall methylation in the ER{alpha}-negative tumors (6 of 16 tumors had >40% methylation in the loci analyzed) than in the ER{alpha}-positive tumors (only 1 of 16 tumors achieved the same level of methylation). Also, the total number of loci showing DNA methylation was greater in ER{alpha}-negative tumors, when compared with ER{alpha}-positive tumors. Only four loci showed a low level of methylation in normal breast samples. Methylation analysis by MSP was further conducted for TRIP10 in these breast samples (Fig. 6C)Citation . Consistent with the microarray finding, TRIP10 promoter hypermethylation was detected in 50% (8 of 16) of ER{alpha}-negative tumors but in none of the 16 ER{alpha}-positive tumors analyzed ({chi}2 test, P < 0.005).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Understanding the sequence of how complex epigenetic events are established can provide important insights into the molecular mechanisms underlying gene silencing in cancer. However, the "chicken and egg" issue of which comes first, DNA methylation, histone modification, or others, is an ongoing debate in the epigenetic research community. Many early studies of this issue come from nonmammalian systems. Mutations in a histone methyltransferase specific for H3-K9 resulted in loss of DNA methylation in Neurospora crassa (15 , 16) , suggesting that histone methylation can initiate DNA methylation. In Arabidopsis, it has been shown that CpNpG methylation depends on a histone H3 methyltransferase (40) , also indicating that histone methylation can direct DNA methylation. New evidence suggests that the reverse scenario can occur in heterochromatin (41) . In this case, a self-reinforcing system is implemented, allowing for feedback from DNA methylation to histone methylation for the long-term maintenance of a heterochromatin state in a gene (41) . However, this epigenetic paradigm remains to be explored in mammalian systems. Earlier studies have shown that in vitro methylated transgenes can be targets for methyl-CpG–binding proteins, which in turn recruit repressor complexes containing histone deacetylases (17 , 18) . Fahrner et al. (19) suggested that DNA methylation of hMLH1 can specify unique histone codes for the maintenance of a silenced state. They detected methyl histone 3-lysine 9 in the DNA methylated, transcriptionally silenced promoter CpG island of hMLH1 in a cancer cell line. Treatment with the DNA demethylating agent 5-AzadC alone, but with not the histone deacetylase inhibitor trichostatin A, resulted in reversal of this repressive histone modification. Taken together, these reports, as well as other studies, imply that in contrast to other organisms, histone modifications may be secondary to DNA methylation in initiating gene silencing in mammalian cells (17 , 18 , 20 , 42) .

A study by Bachman et al. (43) , however, presents a different view with respect to the silencing of the p16 gene in an experimental system using somatic knockout cells. These authors suggest that chromatin modifications are not totally dependent on prior DNA methylation to initiate gene silencing. In support of this observation, Mutskov and Felsenfeld (44) have recently demonstrated that histone modifications are the primary event associated with the silencing of a transgene, ILR2. In this case, a gradual increase in DNA methylation density in and around the ILR2 promoter was observed after transfection. In contrast to previous observations, these two recent studies therefore suggest that DNA methylation sets up an epigenetic "mark" for the maintenance of long-term silencing, rather than initiating it. Clearly, this epigenetic process is complex and multifaceted, and it is possible that the sequence of epigenetic events for establishing and maintaining the silenced state of a gene can be locus or pathway specific.

The present study suggests that gene inactivation and histone modifications occur before DNA methylation at some ER{alpha} target loci. Depicted in Fig. 7Citation is a hypothetical gene containing an ERE site within the promoter area, the active transcription of which is directly dependent on estrogen signaling. On the removal of this signaling, down-regulation of this gene occurs immediately. Transcriptional repressors (e.g., polycomb proteins) and histone deacetylases are then assembled to its promoter to initiate long-term transcriptional repression. Subsequent recruitment of DNA methyltransferases to the repressor complex methylates CpG sites in the adjacent area. This process may be gradual, with methylation density increasing over time in the targeted area (see the heat map in Fig. 5CCitation ). The buildup of DNA methylation could set up a heritable mark that may eventually replace some of the original repressors to establish a heterochromatin state of long-term silencing. In this case, reactivation of ER{alpha} target genes could no longer be achieved by reestablishing estrogen signaling alone (see the example of PR in Fig. 4ACitation ); it also requires DNA demethylation. In addition to the PR gene, we suggest that establishment of epigenetic memory may occur in other critical ER{alpha} downstream loci in some breast cancer cells.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. A proposed model for the epigenetic hierarchy of long-term silencing in ER{alpha} downstream targets (see further explanation in the text). HDACs, histone deacetylases; DNMTs, DNA methyltransferases.

 
The occurrence of DNA methylation in a pathway-specific manner also has a new implication. Altered DNA methylation was originally thought to be a generalized phenomenon arising from a stochastic process in earlier studies (45 , 46) . This random methylation in tumor suppressor genes at their promoter CpG islands, thus silencing their transcripts, would provide tumor cells with a growth advantage. The specific epigenetic patterns observed in particular cancer types would therefore be derived from clonal selection of the proliferating cells. Some studies (26 , 47 , 48) , however, have indicated that this epigenetic event is not random and that remodeling of the local chromatin structure of a gene may influence its susceptibility to specific DNA methylation. The present study provides some answers to this conundrum. Here we show that dysregulation of normal signaling in cancer cells may result in stable silencing of downstream targets, maintained by epigenetic machinery. This implies that the altered epigenetic condition is pathway specific, rather than a stochastic process in the ER{alpha} signaling pathway.

In conclusion, the present study implicates, for the first time, epigenetic influence (i.e., chromatin remodeling and DNA methylation) on transcription of ER{alpha} downstream target genes and thus provides a new direction for research in this classical signaling pathway. Unlike irreversible genetic damage, epigenetic alterations are potentially reversible, providing an opportunity for therapeutic intervention in breast cancer. Histone deacetylase inhibitors, alone or together with DNA demethylating agents, may represent novel treatment approaches that could be combined with currently available chemotherapies. Our experimental evidence therefore provides a rationale for such treatment strategies designed to alter aberrant epigenetic processes in hormone-insensitive but receptor-positive breast tumors.


    ACKNOWLEDGMENTS
 
The authors wish to thank Drs. Curt Balch and Phil Abbosh (Bloomington, IN) and Diane Peckham (Columbia, MO) for constructive review of the manuscript.


    FOOTNOTES
 
Grant support: National Cancer Institute grants R01 CA-69065 (T. Huang) and R01 CA-85289 (K. Nephew); United States Army Medical Research Acquisition Activity, Award Numbers DAMD 17-02-1-0418 and DAMD 17-02-1-0419 (K. Nephew); American Cancer Society Research and Alaska Run for Woman Grant TBE-104125 (K. Nephew); and funds from The Ohio State University Comprehensive Cancer Center-Arthur G. James Cancer Hospital and Richard J. Solove Research Institute (P. Yan and T. Huang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article can be found at Cancer Research Online (http://cancerres.aacrjournals.org). T. Huang is a consultant to Epigenomics, Inc., Berlin, Germany.

Requests for reprints: Tim H-M. Huang, Human Cancer Genetics Program, Department of Molecular Virology, Immunology, and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, 420 West 12th Avenue, Columbus, OH 43210. Phone: 614-688-8277; Fax: 614-292-5995; E-mail: huang-10{at}medctr.osu.edu

5 http://www.ncbi.nlm.nih.gov/BLAST/. Back

6 http://genome.cse.ucsc.edu/cgi-bin/hgBlat. Back

7 http://www.genomatix.de/site_map/index.html. Back

8 http://www.cbrc.jp/research/db/TFSEARCH.html. Back

9 http://www-stat.stanford.edu/~tibs/PAM. Back

Received 6/ 9/04. Revised 8/27/04. Accepted 9/23/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Schiff R, Massarweh S, Shou J, Osborne CK Breast cancer endocrine resistance: how growth factor signaling and estrogen receptor coregulators modulate response. Clin Cancer Res 2003;9:447s-54s.
  2. Jensen EV, Jordan VC The estrogen receptor: a model for molecular medicine. Clin Cancer Res 2003;9:1980-9.[Abstract/Free Full Text]
  3. Bird A DNA methylation patterns and epigenetic memory. Genes Dev 2002;16:6-21.[Free Full Text]
  4. Ehrlich M Amount and distribution of 5-methylcytosine in human DNA from different types of tissues or cells. Nucleic Acids Res 1982;10:2709-21.[Abstract/Free Full Text]
  5. Ehrlich M Expression of various genes is controlled by DNA methylation during mammalian development. J Cell Biochem 2003;88:899-910.[CrossRef][Medline]
  6. Ballestar E, Esteller M The impact of chromatin in human cancer: linking DNA methylation to gene silencing. Carcinogenesis (Lond) 2002;23:1103-9.[Abstract/Free Full Text]
  7. Jones PA, Baylin SB The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002;3:415-28.[Medline]
  8. Nephew KP, Huang TH-M Epigenetic gene silencing in cancer initiation and progression. Cancer Lett 2003;190:125-33.[CrossRef][Medline]
  9. Baylin SB, Esteller M, Rountree MR, et al Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum Mol Genet 2001;10:687-92.[Abstract/Free Full Text]
  10. Rountree MR, Bachman KE, Herman JG, Baylin SB DNA methylation, chromatin inheritance, and cancer. Oncogene 2001;20:3156-65.[CrossRef][Medline]
  11. Feinberg AP, Tycko B The history of cancer epigenetics. Nat Rev Cancer 2004;4:143-53.[Medline]
  12. Jenuwein T, Allis CD Translating the histone code. Science (Wash DC) 2001;293:1074-80.[Abstract/Free Full Text]
  13. Grunstein M Histone acetylation in chromatin structure and transcription. Nature (Lond) 1997;389:349-52.[CrossRef][Medline]
  14. Kouzarides T Histone methylation in transcriptional control. Curr Opin Genet Dev 2002;12:198-209.[CrossRef][Medline]
  15. Tamaru H, Selker EU A histone H3 methyltransferase controls DNA methylation in Neurospora crassa. Nature (Lond) 2001;414:277-83.[CrossRef][Medline]
  16. Tamaru H, Zhang X, McMillen D, et al Trimethylated lysine 9 of histone H3 is a mark for DNA methylation in Neurospora crassa. Nat Genet 2003;12:177-85.
  17. Eden S, Hashimshony T, Keshert I, Cedar H, Thorne AW DNA methylation models histone acetylation. Nature (Lond) 1998;394:842[CrossRef][Medline]
  18. Schubeler D, Lorincz MC, Cimbora DM, et al Genomic targeting of methylated DNA: influence of methylation on transcription, replication, chromatin structure, and histone acetylation. Mol Cell Biol 2000;20:9103-12.[Abstract/Free Full Text]
  19. Fahrner JA, Eguchi S, Herman JG, Baylin SB Dependence of histone modifications and gene expression on DNA hypermethylation in cancer. Cancer Res 2002;62:7213-8.[Abstract/Free Full Text]
  20. Stirzaker C, Song JZ, Davidson B, Clark SJ Transcriptional gene silencing promotes DNA hypermethylation through a sequential change in chromatin modifications in cancer cells. Cancer Res 2004;64:3871-7.[Abstract/Free Full Text]
  21. Yan PS, Rodriguez FJ, Laux DE, et al Hypermethylation of ribosomal RNA genes in human breast carcinoma. Br J Cancer 2000;82:514-7.[CrossRef][Medline]
  22. Aerts JL, Christiaens MR, Vandekerckhove P Evaluation of progesterone receptor expression in eosinophils using real-time quantitative PCR. Biochim Biophys Acta 2002;1571:167-72.[Medline]
  23. Laird PW, Xiong Z COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res 1997;25:2532-4.[Abstract/Free Full Text]
  24. Cross SH, Charlton JA, Nan X, Bird AP Purification of CpG islands using a methylated DNA binding column. Nat Genet 1994;6:236-44.[CrossRef][Medline]
  25. Yan PS, Chen CM, Shi H, et al Dissecting complex epigenetic alterations in breast cancer using CpG island microarrays. Cancer Res 2001;61:8375-80.[Abstract/Free Full Text]
  26. Huang TH-M, Perry MR, Laux DE Methylation profiling of CpG islands in human breast cancer cells. Hum Mol Genet 1999;8:459-70.[Abstract/Free Full Text]
  27. Elbashir SM, Harborth J, Lendeckel W, et al Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond) 2001;411:494-8.[CrossRef][Medline]
  28. Elbashir SM, Lendeckel W, Tuschl T RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 2001;15:188-200.[Abstract/Free Full Text]
  29. Brummelkamp TR, Bernards R, Agami R A system for stable expression of short interfering RNAs in mammalian cells. Science (Wash DC) 2002;296:550-3.[Abstract/Free Full Text]
  30. Geiman TM, Robertson KD Chromatin remodeling, histone modification, and DNA methylation: how does it all fit together?. J Cell Biochem 2002;2002:117-25.
  31. Orlando V Polycomb, epigenomes, and control of cell identity. Cell 2003;112:599-606.[CrossRef][Medline]
  32. Satijn DP, Otte AP Polycomb-group protein complexes: do different complexes regulate distinct targets?. Biochim Biophys Acta 1999;1447:1-16.[Medline]
  33. Herman JG, Graff JR, Myohanen S, Nelkin B, Baylin SB Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996;93:9821-6.[Abstract/Free Full Text]
  34. Oesterreich S, Zhang P, Guler RL, et al Re-expression of estrogen receptor alpha in estrogen receptor alpha-negative MCF-7 cells restores both estrogen and insulin-like growth factor-mediated signaling and growth. Cancer Res 2001;16:5771-7.
  35. Xu X, Murdoch FE, Curran EM, Welshons WV, Fritsch MK Transcription factor accessibility and histone acetylation of the progesterone receptor gene differs between parental MCF-7 cells and a subline that has lost progesterone receptor expression. Gene (Amst) 2004;17:143-51.
  36. Weinmann AS, Yan PS, Oberley MJ, Huang T H-M, Farnham PJ Isolating human transcription factor targets by coupling chromatin immunoprecipitation and CpG island microarray analysis. Genes Dev 2002;16:235-44.[Abstract/Free Full Text]
  37. Shi H, Wei SH, Leu Y-W, et al Triple analysis of the cancer epigenome: an integrated microarray system for analyzing gene expression, DNA methylation, and histone acetylation. Cancer Res 2003;63:2164-71.[Abstract/Free Full Text]
  38. Tibshirani R, Hastie T, Narasimhan B, Chu G Diagnosis of multiple cancer types by shrunken centroids of gene expression. Proc Natl Acad Sci USA 2002;99:6567-72.[Abstract/Free Full Text]
  39. Fujita N, Jaye DL, Kajita M, et al MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 2003;113:207-19.[CrossRef][Medline]
  40. Jackson JP, Lindroth AM, Cao X, Jacobsen SE Control of CpNpG DNA methylation by the KRYPTONITE histone H3 methyltransferase. Nature (Lond) 2002;416:556-60.[CrossRef][Medline]
  41. Tariq M, Saze H, Probst AV, et al Erasure of CpG methylation in Arabidopsis alters patterns of histone H3 methylation in heterochromatin. Proc Natl Acad Sci USA 2003;100:8823-7.[Abstract/Free Full Text]
  42. Lynch CA, Tycko B, Bestor TH, Walsh CP Reactivation of a silenced H19 gene in human rhabdomyosarcoma by demethylation of DNA but not by histone hyperacetylation. Mol Cancer 2002;1:2[CrossRef][Medline]
  43. Bachman KE, Park BH, Rhee I, et al Histone modifications and silencing prior to DNA methylation of a tumor supporessor gene. Cancer Cell 2003;3:89-95.[CrossRef][Medline]
  44. Mutskov V, Felsenfeld G Silencing of transgene transcription precedes methylation of promoter DNA and histone H3 lysine 9. EMBO J 2004;1:1-12.[CrossRef]
  45. Jones PA DNA methylation errors and cancer. Cancer Res 1996;56:2463-7.[Free Full Text]
  46. Pferfer GP, Steigerwald SD, Hansen RS, Gartler SM, Riggs AD Polymerase chain reaction-aided genomic sequencing of an X chromosome-linked CpG island: methylation patterns suggest clonal inheritance, CpG site autonomy and an explanation of activity state stability. Proc Natl Acad Sci USA 1990;87:8252-6.[Abstract/Free Full Text]
  47. Feltus FA, Lee EK, Costello JF, Plass C, Vertino PM Predicting aberrant CpG island methylation. Proc Natl Acad Sci USA 2003;100:12253-8.[Abstract/Free Full Text]
  48. Costello JF, Fruhwald MC, Smiraglia DJ, et al Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat Genet 2000;24:132-8.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. M. Gaudet, M. Campan, J. D. Figueroa, X. R. Yang, J. Lissowska, B. Peplonska, L. A. Brinton, D. L. Rimm, P. W. Laird, M. Garcia-Closas, et al.
DNA Hypermethylation of ESR1 and PGR in Breast Cancer: Pathologic and Epidemiologic Associations
Cancer Epidemiol. Biomarkers Prev., November 1, 2009; 18(11): 3036 - 3043.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-S. Chen, A. Raval, A. J. Johnson, E. Hertlein, T.-H. Liu, V. X. Jin, M. H. Sherman, S.-J. Liu, D. W. Dawson, K. E. Williams, et al.
Epigenetic changes during disease progression in a murine model of human chronic lymphocytic leukemia
PNAS, August 11, 2009; 106(32): 13433 - 13438.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P.-Y. Hsu, D. E. Deatherage, B. A.T. Rodriguez, S. Liyanarachchi, Y.-I Weng, T. Zuo, J. Liu, A. S.L. Cheng, and T. H-M. Huang
Xenoestrogen-Induced Epigenetic Repression of microRNA-9-3 in Breast Epithelial Cells
Cancer Res., July 15, 2009; 69(14): 5936 - 5945.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Ramaswamy, S. Majumder, S. Roy, K. Ghoshal, H. Kutay, J. Datta, M. Younes, C. L. Shapiro, T. Motiwala, and S. T. Jacob
Estrogen-Mediated Suppression of the Gene Encoding Protein Tyrosine Phosphatase PTPRO in Human Breast Cancer: Mechanism and Role in Tamoxifen Sensitivity
Mol. Endocrinol., February 1, 2009; 23(2): 176 - 187.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Bhat-Nakshatri, G. Wang, H. Appaiah, N. Luktuke, J. S. Carroll, T. R. Geistlinger, M. Brown, S. Badve, Y. Liu, and H. Nakshatri
AKT Alters Genome-Wide Estrogen Receptor {alpha} Binding and Impacts Estrogen Signaling in Breast Cancer
Mol. Cell. Biol., December 15, 2008; 28(24): 7487 - 7503.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H.-J. L. Lin, T. Zuo, C.-H. Lin, C. T. Kuo, S. Liyanarachchi, S. Sun, R. Shen, D. E. Deatherage, D. Potter, L. Asamoto, et al.
Breast Cancer-Associated Fibroblasts Confer AKT1-Mediated Epigenetic Silencing of Cystatin M in Epithelial Cells
Cancer Res., December 15, 2008; 68(24): 10257 - 10266.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. M. McGough, D. Yang, S. Huang, D. Georgi, S. M. Hewitt, C. Rocken, M. Tanzer, M. P.A. Ebert, and K. Liu
DNA Methylation Represses IFN-{gamma}-Induced and Signal Transducer and Activator of Transcription 1-Mediated IFN Regulatory Factor 8 Activation in Colon Carcinoma Cells
Mol. Cancer Res., December 1, 2008; 6(12): 1841 - 1851.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Dumont, M. B. Wilson, Y. G. Crawford, P. A. Reynolds, M. Sigaroudinia, and T. D. Tlsty
Sustained induction of epithelial to mesenchymal transition activates DNA methylation of genes silenced in basal-like breast cancers
PNAS, September 30, 2008; 105(39): 14867 - 14872.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
M. Li, H.-i. H. Paik, C. Balch, Y. Kim, L. Li, T. H-M. Huang, K. P. Nephew, and S. Kim
Enriched transcription factor binding sites in hypermethylated gene promoters in drug resistant cancer cells
Bioinformatics, August 15, 2008; 24(16): 1745 - 1748.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Milutinovic, A. C. D'Alessio, N. Detich, and M. Szyf
Valproate induces widespread epigenetic reprogramming which involves demethylation of specific genes
Carcinogenesis, March 1, 2007; 28(3): 560 - 571.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Fan, P. S. Yan, C. Hartman-Frey, L. Chen, H. Paik, S. L. Oyer, J. D. Salisbury, A. S.L. Cheng, L. Li, P. H. Abbosh, et al.
Diverse Gene Expression and DNA Methylation Profiles Correlate with Differential Adaptation of Breast Cancer Cells to the Antiestrogens Tamoxifen and Fulvestrant
Cancer Res., December 15, 2006; 66(24): 11954 - 11966.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
B. Kuske, C. Naughton, K. Moore, K. G MacLeod, W. R Miller, R. Clarke, S. P Langdon, and D. A Cameron
Endocrine therapy resistance can be associated with high estrogen receptor {alpha} (ER{alpha}) expression and reduced ER{alpha} phosphorylation in breast cancer models
Endocr. Relat. Cancer, December 1, 2006; 13(4): 1121 - 1133.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. S. Yan, C. Venkataramu, A. Ibrahim, J. C. Liu, R. Z. Shen, N. M. Diaz, B. Centeno, F. Weber, Y.-W. Leu, C. L. Shapiro, et al.
Mapping Geographic Zones of Cancer Risk with Epigenetic Biomarkers in Normal Breast Tissue.
Clin. Cancer Res., November 15, 2006; 12(22): 6626 - 6636.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. E. K. Ibrahim, N. P. Thorne, K. Baird, N. L. Barbosa-Morais, S. Tavare, V. P. Collins, A. H. Wyllie, M. J. Arends, and J. D. Brenton
MMASS: an optimized array-based method for assessing CpG island methylation
Nucleic Acids Res., November 6, 2006; 34(20): e136 - e136.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. D. Anway, M. A. Memon, M. Uzumcu, and M. K. Skinner
Transgenerational Effect of the Endocrine Disruptor Vinclozolin on Male Spermatogenesis
J Androl, November 1, 2006; 27(6): 868 - 879.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. A. Reynolds, M. Sigaroudinia, G. Zardo, M. B. Wilson, G. M. Benton, C. J. Miller, C. Hong, J. Fridlyand, J. F. Costello, and T. D. Tlsty
Tumor Suppressor p16INK4A Regulates Polycomb-mediated DNA Hypermethylation in Human Mammary Epithelial Cells
J. Biol. Chem., August 25, 2006; 281(34): 24790 - 24802.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Karl, M. Berho, J. Pignac-Kobinger, G. E. Striker, and S. J. Elliot
Differential Effects of Continuous and Intermittent 17{beta}-Estradiol Replacement and Tamoxifen Therapy on the Prevention of Glomerulosclerosis: Modulation of the Mesangial Cell Phenotype in Vivo
Am. J. Pathol., August 1, 2006; 169(2): 351 - 361.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Mori, S. R. Martinez, S. J. O'Day, D. L. Morton, N. Umetani, M. Kitago, A. Tanemura, S. L. Nguyen, A. N. Tran, H.-J. Wang, et al.
Estrogen Receptor-{alpha} Methylation Predicts Melanoma Progression.
Cancer Res., July 1, 2006; 66(13): 6692 - 6698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. H. Abbosh, J. S. Montgomery, J. A. Starkey, M. Novotny, E. G. Zuhowski, M. J. Egorin, A. P. Moseman, A. Golas, K. M. Brannon, C. Balch, et al.
Dominant-Negative Histone H3 Lysine 27 Mutant Derepresses Silenced Tumor Suppressor Genes and Reverses the Drug-Resistant Phenotype in Cancer Cells
Cancer Res., June 1, 2006; 66(11): 5582 - 5591.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. M. McGarvey, J. A. Fahrner, E. Greene, J. Martens, T. Jenuwein, and S. B. Baylin
Silenced tumor suppressor genes reactivated by DNA demethylation do not return to a fully euchromatic chromatin state.
Cancer Res., April 1, 2006; 66(7): 3541 - 3549.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Ushmorov, F. Leithauser, O. Sakk, A. Weinhausel, S. W. Popov, P. Moller, and T. Wirth
Epigenetic processes play a major role in B-cell-specific gene silencing in classical Hodgkin lymphoma
Blood, March 15, 2006; 107(6): 2493 - 2500.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Fiegl, S. Millinger, G. Goebel, E. Muller-Holzner, C. Marth, P. W. Laird, and M. Widschwendter
Breast Cancer DNA Methylation Profiles in Cancer Cells and Tumor Stroma: Association with HER-2/neu Status in Primary Breast Cancer
Cancer Res., January 1, 2006; 66(1): 29 - 33.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Jang, J. B. Mason, and S.-W. Choi
Genetic and Epigenetic Interactions between Folate and Aging in Carcinogenesis
J. Nutr., December 1, 2005; 135(12): 2967S - 2971S.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. W.Y. Chan, S. H. Wei, P. Wen, Z. Wang, D. E. Matei, J. C. Liu, S. Liyanarachchi, R. Brown, K. P. Nephew, P. S. Yan, et al.
Hypermethylation of 18S and 28S Ribosomal DNAs Predicts Progression-Free Survival in Patients with Ovarian Cancer
Clin. Cancer Res., October 15, 2005; 11(20): 7376 - 7383.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
V X Jin, H Sun, T T Pohar, S Liyanarachchi, S K Palaniswamy, T H-M Huang, and R V Davuluri
ERTargetDB: an integral information resource of transcription regulation of estrogen receptor target genes
J. Mol. Endocrinol., October 1, 2005; 35(2): 225 - 230.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. Balch, P. Yan, T. Craft, S. Young, D. G. Skalnik, T. H-M. Huang, and K. P. Nephew
Antimitogenic and chemosensitizing effects of the methylation inhibitor zebularine in ovarian cancer
Mol. Cancer Ther., October 1, 2005; 4(10): 1505 - 1514.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. W. Laird
Cancer epigenetics
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R65 - R76.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. X. Jin, Y.-W. Leu, S. Liyanarachchi, H. Sun, M. Fan, K. P. Nephew, T. H.-M. Huang, and R. V. Davuluri
Identifying estrogen receptor {alpha} target genes using integrated computational genomics and chromatin immunoprecipitation microarray
Nucleic Acids Res., December 17, 2004; 32(22): 6627 - 6635.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leu, Y.-W.
Right arrow Articles by Huang, T. H-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leu, Y.-W.
Right arrow Articles by Huang, T. H-M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online