Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamasani, U.
Right arrow Articles by Prendergast, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamasani, U.
Right arrow Articles by Prendergast, G. C.
[Cancer Research 64, 8389-8396, November 15, 2004]
© 2004 American Association for Cancer Research

Regular Articles

Cyclin B1 Is a Critical Target of RhoB in the Cell Suicide Program Triggered by Farnesyl Transferase Inhibition

Uma Kamasani1, Minzhou Huang1, James B. DuHadaway1, Edward V. Prochownik2, P. Scott Donover1 and George C. Prendergast1,3

1 Lankenau Institute for Medical Research, Wynnewood Pennsylvania; 2 Children’s Hospital of Pittsburgh, Section of Hematology/Oncology, Pittsburgh, Pennsylvania; and 3 Department of Pathology, Anatomy, and Cell Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Farnesyl transferase inhibitors (FTIs) have displayed limited efficacy in clinical trials, possibly because of their relatively limited cytotoxic effects against most human cancer cells. Therefore, efforts to leverage the clinical utility of FTIs may benefit from learning how these agents elicit p53-independent apoptosis in mouse models of cancer. Knockout mouse studies have established that gain of the geranylgeranylated isoform of the small GTPase RhoB is essential for FTI to trigger apoptosis. Here we demonstrate that Cyclin B1 is a crucial target for suppression by RhoB in this death program. Steady-state levels of Cyclin B1 and its associated kinase Cdk1 were suppressed in a RhoB-dependent manner in cells fated to undergo FTI-induced apoptosis. These events were not derivative of cell cycle arrest, because they did not occur in cells fated to undergo FTI-induced growth inhibition. Mechanistic investigations indicated that RhoB mediated transcriptional suppression but also accumulation of Cyclin B1 in the cytosol at early times after FTI treatment, at a time before the subsequent reduction in steady-state protein levels. Enforcing Cyclin B1 expression attenuated apoptosis but not growth inhibition triggered by FTI. Moreover, enforcing Cyclin B1 abolished FTI antitumor activity in graft assays. These findings suggest that Cyclin B1 suppression is a critical step in the mechanism by which FTI triggers apoptosis and robust antitumor efficacy. Our findings suggest that Cyclin B1 suppression may predict favorable clinical responses to FTI, based on cytotoxic susceptibility, and they suggest a rational strategy to address FTI nonresponders by coinhibition of Cdk1 activity.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell suicide processes are thought to play an important role in limiting cancer progression and therapeutic response. Although great progress has been made in identifying the basic mechanisms of apoptosis, much less is known about transformation-specific mechanisms of apoptosis that may relate more directly to cancer pathophysiology. Insights in this area may increase understanding of the pathophysiological roots of cancer progression as well as identify better strategies to trigger cancer-selective cell deaths.

Farnesyltransferase inhibitors (FTIs) trigger a unique p53-independent apoptosis in transformed mouse and rat cells, in vitro and in vivo, although they have much less effect on the survival of most nontransformed cells (1 , 2) . FTIs were developed originally as a strategy to attack the farnesylation requirement of oncogenic Ras in human cancers. However, it has become clear that the response of transformed cells to FTIs is based to a significant extent on factors beyond Ras targeting (3 , 4) . For example, it has been demonstrated that the small GTPase RhoB is an essential player in FTI-induced apoptosis (5) . RhoB is unusual among small GTPases in that it exists in two differently isoprenylated populations in cells that have a unique localization, and perhaps a unique function, in cells (6) . RhoB responds to FTI treatment by a gain-of-function mechanism characterized by depletion of the farnesylated isoform of RhoB (RhoB-F) but elevation of the geranylgeranylated isoform of RhoB (RhoB-GG; refs. 7 , 8 ). Notably, a gain of RhoB-GG is sufficient to mediate many major facets of the cellular response to FTI in vitro and in vivo (5 , 8, 9, 10) . In particular, a genetic proof of the essential role of RhoB-GG in FTI-induced apoptosis has been offered by knockout mouse studies (5) . Reinforcing this line of work, other studies have shown that RhoB limits cancer development and that it is critical for the apoptotic response of transformed cells to genotoxic stress (11 , 12) .

Operation of this apoptotic program is widely blunted in human cancer cells, which most studies show are susceptible to growth inhibition, but not killing, by FTI. This apoptotic impotence may be relevant to clinical experience, which has not tended to recapitulate the dramatic efficacy produced by FTI in certain preclinical models, particularly in Ras transgenic models (13, 14, 15) in which tumor regressions elicited by FTI treatment are associated with induction of apoptosis (16) . Because one would expect efficacy and cytotoxicity to be linked, learning how RhoB facilitates FTI-induced apoptosis in mouse models may suggest insights into the relative resistance of human cancer cells.

Recently, microarray studies identified Cyclin B1 as a major target for down-regulation by RhoB in transformed mouse cells fated to undergo FTI-induced apoptosis (17) . This finding was interesting because of earlier evidence that FTI and RhoB influence G2-M phase events (12 , 18) , including Ras-independent control of Cyclin B1/Cdk1 activity (19) . We, therefore, tested the hypothesis that the suppression of Cyclin B1 by RhoB may be a critical factor in the ability of FTI to trigger apoptosis.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
The generation and culture of mouse embryonic fibroblasts (MEFs) transformed by adenovirus E1A and mutant H-Ras has been described previously (5 , 11) . E1A+Ras-transformed MEF cell populations that are heterozygous or nullizygous for RhoB are termed ER +/–or ER –/–cells, respectively (5) . Heterozygous cells, which exhibit similar biological properties to homozygous wild-type cells (5 , 11) , are matched to nullizygous cells to control for the presence of the neomycin resistance cassette used for rhoB gene replacement (11) . The specific FTI inhibitor L-744,832 (13) was added to cell cultures to a final concentration of 10 µmol/L when indicated. In some experiments, the structurally distinct peptidomimetic FTI inhibitors B581 or FTI-277 were used at the same concentration. Generation and culture of the rat intestinal epithelial (RIE) cell line transformed by an oncogenic V12 mutant of K-Ras, termed RIE/K-ras, has been described previously (8) . MMEC/myc is a c-myc-transformed mouse mammary epithelial cell line (myc83 cells) that was established from an autochthonous mammary gland tumor arising in a mouse mammary tumor virus (MMTV)-c-myc transgenic mouse (20 , 21) . MMEC/myc cells were cultured in Richter’s Medium (IMEM) supplemented with 2.5% fetal calf serum (FCS; Hyclone, Logan, UT), 10 ng/mL human epidermal growth factor (Invitrogen, Carlsbad, CA), 5 µg/mL insulin (Life Technologies, Inc., Rockville, MD), and penicillin/streptomycin (Life Technologies, Inc.).

Ectopic expression of Cyclin B1 was achieved in ER +/–cells by liposome-mediated transfection of a full-length human cyclin B1 cDNA vector that has been described previously (22) . Briefly, cells were seeded at 5 x 105 cells per well in a 6-well dish and were transfected the next day with 3 µg of the cyclin B1 or empty pBabe(puro) vectors. After 48 hours, cells were passaged into 100-mm dishes, were treated the following day with 1 µg/mL puromycin, and were expanded into mass culture for analysis. Cell populations were screened by PCR to confirm stable integration of the cyclin B1 vector and by Western analysis to confirm elevated expression of Cyclin B1 protein. To attenuate expression of endogenous Cyclin B1, ER –/–cells were transfected stably with an RNA interference (RNAi) vector modified to include a puromycin resistance cassette and the following hairpin cyclin B1 targeting sequence defined as effective in suppressing levels of expression of Cyclin B1 protein in transient 293 cell transfection assays. Briefly, the primers CATGGAGAGCTCCATGAGGTATTTGGCCGAAGCTTGGGCTAAGTATCTTATGGAGCTCTCCATGCTGTTTTTT and GATCAAAAAACAGCATGGAGAGCTCCATAAGATACTTAGCCCAAGCTTCGGCCAAATACCTCATGGAGCTCTCCATGCG were kinased, annealed, and ligated into the BseRI and BamHI sites of pSHAG-puro, a derivative of pShag-1,4 which includes a puromycin resistance cassette inserted at the EcoRV site. The RNAi vector pShag-puro-cycB1 targets the sequence GGCCAAATACCTCATGGAGCTCTCCATGC in mouse cyclin B1 (bases 957 to 985) or rat cyclin B1 (bases 936 to 964) message.

Cell Morphology and Proliferation.
To document cell morphology changes, we treated cells the day after passaging with 10 µmol/L FTI L-744,832 or DMSO vehicle and photographed the cells 24 or 48 hours later. Anchorage-dependent proliferation was determined by sulforhodamine B (SRB) assay in a 96-well format. Anchorage-independent proliferation was determined in soft agar culture (ER MEFs) or on polyHEMA-coated dishes (MMEC/myc cells) as described previously (9 , 23) .

Apoptosis.
FTIs have previously been shown to induce apoptosis of Ras-transformed cells under conditions of deprival of serum growth factors or substratum attachment (5 , 23, 24, 25) . For serum deprival experiments, 5 x 105 ER MEFs or RIE/K-ras cells were seeded onto 60-mm dishes and were treated 16 hours later with FTI L-744,832 or dimethylsulfoxide vehicle in DMEM containing 0.1% fetal bovine serum. For adhesion deprival experiments, 1 x 106 MMEC/myc cells were seeded onto polyHEMA-coated dishes in media containing FTI L-744,832 or vehicle in fully supplemented media. After 24–72 hours, cells were harvested by trypsinization, were washed once with PBS, were fixed in 70% EtOH, and were analyzed by flow cytometry. Terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) assay was performed in some experiments with a commercial kit according to the manufacturer’s protocol (Roche Molecular Biology, Indianapolis, IN). TUNEL-positive cells in the population were quantitated by flow cytometry with a FACscan cell analyzer (Becton-Dickinson, San Jose, CA).

Tumorigenicity Assay.
Cells were tested for tumorigenic potential in ~8-week-old nude mice (Charles River, Cambridge, MA). Mice were given injections subcutaneously on the upper thigh of different legs of the same animal with 106 cells suspended in 200 µL of DMEM. Palpable tumors appeared at the injection site within 1 week and visible nodules of >0.5 cm were apparent by 2 weeks. For FTI trials, mice were dosed once daily when the tumor reached ~50 to 100 mm3 by intraperitoneal injection with FTI L-744.832 (40 mg/day) or 30% DMSO carrier in 0.2 mL total volume as described previously (13) . Tumor volumes were calculated with caliper measurements and the formula, (width)2 x length x 0.52.

Western Analysis.
Cells were harvested by washing once in PBS before lysis in 1x radioimmunoprecipitation (RIPA) buffer supplemented with 10 µL/mL Protease Inhibitor Sets II and III (Calbiochem, San Diego, CA). Cellular protein was quantitated by Bradford assay, and 25 µg of protein was fractionated by SDS-PAGE. Gels were analyzed by standard Western blotting methods with antibodies to Cyclin B1 (Santa Cruz Biotechnology, Santa Cruz, CA, cat. no. sc-245), Cdk1 [Cell Signaling, Beverly, MA; PhosphoPlus Cdc2 (Tyr15) Antibody kit], Bcl-xL (BD Transduction Laboratories, Los Angeles, CA; cat. no. 610211), and actin (Santa Cruz Biotechnology, cat. no. sc-1616). Detection of the primary antibody was carried out with a chemiluminescence system for the detection of murine antibodies (Pierce, Rockford, IL).

Cellular Immunofluorescence.
Cells were seeded onto coverslips in 24-well dishes and were treated the next day for various times with 10 µmol/L FTI L-744,832 or dimethylsulfoxide carrier. To monitor actin, we treated cells for 48 hours with FTI before fixing and staining with fluorescein-phalloidin (Molecular Probes, Eugene, OR) as described previously (26) . To monitor Cyclin B1, we seeded cells onto coverslips in 24-well dishes, and the next day, we replaced the medium with DMEM containing 10% or 0.1% fetal bovine serum (dictating growth-inhibitory or apoptotic response to FTI, respectively). On the following day, cells were treated for 8 hours with FTI or vehicle carrier (control) before fixation and processing for immunofluorescence. Briefly, cells were rinsed twice with PBS, fixed 10 minutes in 4% formaldehyde, and permeabilized 10 minutes with 0.2% Triton X-100 in PBS. After nonspecific sites were blocked by incubation for 10 minutes in 2% bovine serum albumin–0.2%Triton X-100 in PBS, cells were incubated for 1 hour in PBS containing 1 µg/mL anti-Cyclin B1 (GNS1, Santa Cruz Biotechnology). Bound antibody was detected by incubation 30 minutes with FITC-conjugated goat antimouse IgG1, as recommended by the vendor (1031-02, Southern Biotechnology Associates). After the final wash, cells were stained 5 minutes with 4',6-diamidino-2-phenylindole (DAPI; Sigma, St. Louis MO) to visualize nuclei and were mounted on slides with Fluoromount G (0100-01; Southern Biotechnology Associates, Birmingham, AL) for examination by immunofluorescence microscopy.

Cyclin B1 Promoter Reporter Assays.
ER –/–cells were seeded into a 6-well dish at 5 x 105 cells per well. On the following day, cells were transfected with 0.2 µg of SV-ßGal (200 ng) plus 1 µg of pGL2-luciferase (Promega, Madison, WI) or the cyclin B1 promoter-reporter pGL2-cycB1-luc (22) and 0, 0.5, 1, 1.5, or 1.8 µg of the HA epitope-tagged RhoB or RhoA vectors or the corresponding no-insert control vectors that have been described previously (7 , 8 , 27) . The total quantity of DNA in each transfection was normalized to 3 µg with empty vector corresponding to the different RhoB vectors used (7, 8, 9 , 27) . Cells were harvested 48 hours after transfection and were processed with a commercial kit (Dual Light System, cat. no. BD100LP, Applied Biosystems, Foster City, CA) and a fluorescence luminometer (Analytical Luminescence Laboratory, San Diego, CA).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Suppression of Cyclin B1 by FTI Is Linked to Gain of RhoB-GG and Apoptotic Cell Fate.
Cyclin B1 expression is restricted normally to G2-M phase by a complex set of regulatory events (28) . This tight control is profoundly disrupted during malignant development, as illustrated by aberrant expression patterns of Cyclin B1, including during G1 phase in cancer cells (29) . Given the central role of Cyclin B1 in cell cycle control and cell survival, and its profound disruption in transformed cells, one would expect the alteration of Cyclin B1 to mediate alterations in the physiology of transformed cells. This gene was identified previously as a target for suppression by RhoB in E1A+Ras-transformed cells that were fated to undergo FTI-induced apoptosis (17) . This regulatory connection was selective to transformed cells, because it was not seen in normal cells. Therefore, we explored its potential significance in E1A+Ras-transformed cells that were heterozygous or homozygous null for rhoB (termed ER +/–or ER –/–cells), with the potent and specific FTI L-744,832 to induce growth inhibition or apoptosis under normal-culture conditions or serum-deprival conditions, respectively, as described previously (5) .

FTI caused a rapid and specific reduction in steady-state levels of cyclin B1 in a manner that was associated with the induction of RhoB-GG and apoptotic fate (Fig. 1A)Citation . This response was specific insofar as Cyclin D1 and Cyclin A (which are required for transit through G1-S phase, and S-phase/G2 phases of the cell cycle, respectively) were not affected by FTI treatment. Furthermore, cyclin B1 was not suppressed under normal-culture conditions in which FTI treatment caused growth inhibition but not apoptosis (24 , 25) . This response was not compound-specific because the same pattern of cyclin B1 suppression was produced by the structurally distinct FTIs B581 and FTI-277 (Fig. 1B)Citation . Under the same conditions, FTI treatment also reduced steady-state expression of Cdk1, the cell cycle kinase that is specifically bound and activated by Cyclin B1 (Fig. 1C)Citation . The basis for Cdk1 loss was unclear, but it suggested a mechanism that focused on the Cyclin B1/Cdk1 complex. The specific reduction in Cyclin B1 and Cdk1 was not derivative of cell death, because Cyclin D1 and Cyclin A were not affected and because the kinetics of Cyclin B1/Cdk1 reduction preceded the kinetics of poly(ADP-ribose) polymerase (PARP) cleavage, an indicator of caspase-3 activation during the execution phase of apoptosis (Fig. 1D)Citation .



View larger version (49K):
[in this window]
[in a new window]
  		Fig. 1. Cyclin B1 suppression by FTI is associated with apoptotic fate and requires prior induction of RhoB-GG. A, steady-state levels of Cyclins B1 (Cyc B1), D1 (Cyc D1), and A1 (Cyc A) and RhoB in ER +/–and ER –/–MEFs after FTI treatment. Western analysis was performed with extracts prepared from cells that were cultured in serum-deprived conditions [0.1% FCS (0.1% FCS)], in which FTI will induce apoptosis, or from cells cultured in normal growth media (10% FCS), in which FTI will induce growth inhibition but not apoptosis (5) . In B, Cyclin B1 responds similarly to structurally distinct inhibitors of farnesyltransferase. Western analysis was performed with extracts from cells under the same conditions as above except for treatment with the peptidomimetic inhibitors FTI-277 or B581. C, Cdk1 down-regulation accompanies Cyclin B1 suppression. Western analysis was performed as above with pan- or phospho-specific Cdk1 antibodies. In D, suppression of Cyclin B1 precedes execution of cell death. Western analysis of the caspase-3 indicator protein PARP is shown in extracts prepared from cells treated with FTI under serum-deprived conditions. PARP cleavage signals the execution phase of apoptosis, which occurs after Cyclin B1 suppression under the conditions of the experiment. (h, hour; µM, mmol/L.)

 
Cyclin B1 responded similarly to FTI in other cell systems in which neoplastic transformation was driven by FTI-insensitive oncoproteins. RIE/K-ras is an RIE rat intestinal epithelial cell line transformed by the activated K-Ras mutant K-RasG12V (8) . FTI does not inactivate K-Ras, because this protein is geranylgeranylated in drug-treated cells (30) . Nevertheless, despite the failure to block K-Ras prenylation, FTI strongly inhibits the proliferation of RIE/K-ras cells in serum-containing media, an effect that is associated with RhoB-GG induction and that can be phenocopied by ectopic expression RhoB-GG (8) . In the absence of serum growth factors, we observed that FTI triggers apoptosis of RIE/K-ras cells, consistent with similar observations in other K-Ras-transformed cells (24) . As before, apoptotic fate was associated with specific suppression of Cyclin B1 (Fig. 2A)Citation . A similar pattern was also observed in an epithelial cell system in which transformation was driven by c-Myc, which does not use Ras pathways to transform cells. MMEC/myc (also known as myc83) is a c-myc-transformed mouse mammary epithelial cell line that derived from in vitro establishment of an autochthonous MMTV-c-myc tumor (20 , 21) . MMEC/myc cells responded to FTI by growth inhibition unless cells were deprived of substratum adhesion (by culturing cells on the nonadherent substrate polyHEMA; 23 ). Cyclin B1 was suppressed by FTI only under conditions of adhesion deprival that led to cell death (Fig. 2B)Citation . Taken together, these observations extended the evidence that Cyclin B1 suppression was associated with apoptotic fate in settings in which Ras inhibition by FTI was irrelevant. In summary, suppression of Cyclin B1 by FTI was not a MEF-specific response, was not associated with the execution phase of cell death, and was not associated with a cell cycle arrest derivative of FTI-induced growth inhibition. We concluded that RhoB specifically mediated suppression of Cyclin B1 in cells fated to undergo FTI-induced cell death.



View larger version (22K):
[in this window]
[in a new window]
  		Fig. 2. Similar response of cyclin B1 to FTI in transformed epithelial cells. A, K-Ras-transformed rat intestinal epithelial cells (RIE/K-ras cells). Five x 105 cells were seeded overnight and were treated 16 hours with medium containing 10% FCS or 0% FCS before the addition of 10 µmol/L FTI L-744,832 or vehicle only. Cells were processed 24 hours later for flow cytometry (top panels) or Western analysis (bottom panels). B, c-myc-transformed mouse mammary epithelial cells (MMEC/myc cells). One x 106 cells were seeded onto standard or polyHEMA-coated tissue culture dishes in growth medium containing 10 µmol/L L-744,832 or vehicle only and then were processed at the times indicated for cell growth and flow cytometry (top panels) or for Western analysis (bottom panels). Viable cell number was determined by trypan blue exclusion with confirmation of cell death at 72 hours by flow cytometry, with sub-G1 phase cells as a basis for quantitation. (Con, control only; Cyc B1, Cyclin B1; h and hr, hour; M1, gate M1.)

 
RhoB Mediates Inhibition of the Cyclin B1 Promoter by FTI.
The identification of cyclin B1 in gene microarray studies suggested that RhoB acted in part by affecting mRNA stability or promoter activity. RhoB was not observed to affect steady-state levels of Cyclin B1 protein driven from an exogenous promoter, which argues against the notion that mRNA stability was targeted (data not shown). In contrast, RhoB inhibited transcription from the cyclin B1 promoter as measured by a luciferase reporter plasmid (22) . We studied this effect in ER –/–cells in which it was possible to analyze the properties of various transfected isoforms of ectopic RhoB on the cyclin B1 promoter.

RhoB inhibited the activity of the cyclin B1 promoter in a dose-dependent manner (Fig. 3A)Citation . This effect was not phenocopied by the related but functionally distinct RhoA protein, which activated the cyclin B1 promoter (Fig. 3B)Citation . Consistent with the notion that RhoB mediated FTI action at this promoter, FTI had little effect unless RhoB was expressed ectopically (Fig. 3C)Citation . Moreover, an engineered RhoB-GG isoform (9) was sufficient to phenocopy the inhibition elicited by wild-type RhoB plus FTI (Fig. 3C)Citation . The requirement for an active RhoB molecule was illustrated by the inability of the CaaX mutant RhoB-C186C (27) to suppress the cyclin B1 promoter. This observation reinforced the conclusion that the ability of FTI to inhibit Cyclin B1 expression was causally connected to the ability of FTI to elicit the geranylgeranylated isoform of RhoB in cells.



View larger version (36K):
[in this window]
[in a new window]
  		Fig. 3. Role of RhoB in suppression of the cyclin B1 promoter by FTI. ER –/–cells were transfected with an empty luciferase reporter plasmid (luc-vect), no-insert (vect), or Rho vectors as indicated in the figure panels and a human cyclin B1 promoter–luciferase reporter (cycB1-luc) at 1:1 to 1:5 (w/w) ratios to the Rho vector. All cells were cultured in low serum conditions for 24 hours before normalized luciferase activity was determined in cell extracts 48 hours after transfection. Error bars, the SD of the data. In A, RhoB inhibits the activity of the cyclin B1 promoter. In B, inhibitory effect of RhoB is not phenocopied by RhoA, which activates the cyclin B1 promoter. In C, RhoB-GG phenocopies the ability of RhoB + FTI to inhibit the cyclin B1 promoter. RhoB vectors were transfected at a 5:1 ratio to the cyclin B1 luciferase reporter plasmid in this experiment. The mutant RhoB-C186S is unprenylated and inactive because of loss of the cysteine in the CaaX prenylation motif (7) . In D, effector domain mutations in RhoB-GG identify a correlation between cyclin B1 promoter inhibition and interaction with the Rho-binding protein kinectin (see Results). RhoB vectors were transfected at a 5:1 ratio to the cyclin B1 luciferase reporter plasmid in the experiment.

 
A panel of six effector domain mutations with known interaction properties (8) was used to address the question as to whether the pattern of effector interactions differed from those associated with growth inhibition by RhoB-GG [which map significantly to interactions with protein kinase C–related kinase (PRK) (8) ]. No single mutant completely relieved the ability of RhoB-GG to inhibit the cyclin B1 promoter, suggesting that multiple interactions were needed to mediate full inhibition. However, the activity pattern differed markedly from that seen for growth inhibition (8) . In particular, the T37Y and E40T mutants suggested a role for kinectin, a Rho effector protein that binds the microtubule motor kinesin (Fig. 3D)Citation . T37Y is a mutant that abolishes interactions with all Rho effector molecules except kinesin (31) , and this mutant was even more active than wild-type RhoB-GG. In contrast, E40T, which abolishes interactions with kinesin but not with other Rho effector molecules (31) , relieved inhibition by RhoB-GG more strongly than any other mutant. Taken together, these results supported the interpretation that RhoB mediated the ability of FTI to suppress Cyclin B1 at a transcriptional level, by a mechanism(s) distinct from that used to cause growth inhibition.

Cytosolic Accumulation of Cyclin B1 Precedes Suppression of Protein Levels and Apoptosis.
RhoB has a specific physiologic function in signal trafficking as illustrated by its role in trafficking of the epidermal growth factor receptor (EGFR) and Akt (32 , 33) . Mistrafficking of these proteins that is elicited by FTI is associated with induction of RhoB-GG and altered protein turnover. Therefore, although Cyclin B1 had been highlighted by gene microarray analysis, we were interested in learning whether RhoB might influence its trafficking in transformed cells. As mentioned above, although Cyclin B1 is restricted to G2-M phase in normal cells, its regulation is profoundly disrupted in neoplastic cells, in which inappropriate nuclear expression of Cyclin B1 can be observed broadly in the cell cycle including in G1 phase (e.g., see refs. 29 , 34 ). E1A+Ras-transformed cells have been used widely as a cancer model, and consistent with the human cancer cell studies, we observed widespread constitutive nuclear expression of Cyclin B1 in unsynchronized cell populations (see below and Discussion).

To assess the effects of RhoB on the localization of Cyclin B1, we used indirect immunofluorescence to examine the status of Cyclin B1 in ER +/–and ER –/–cells treated 8 hours with FTI under conditions in which cell fate was directed to either growth inhibition or apoptosis (Fig. 4)Citation . This time point was early in the FTI response, within the time that RhoB-GG was induced but before any reduction occurred in the steady-state levels of Cyclin B1 (Fig. 1A)Citation or induction of the effector phase of apoptosis (Fig. 1D)Citation . Two observations were made. First, we observed widespread and robust nuclear expression of Cyclin B1 throughout the unsynchronized ER cell population, regardless of rhoB genotype, arguing that E1A+Ras transformation profoundly disrupted the normal regulation of Cyclin B1. Second, we observed that FTI induced a punctate cytosolic accumulation of Cyclin B1 in cells fated to undergo apoptosis (Fig. 4)Citation . This event was not associated with growth inhibition, because Cyclin B1 did not relocalize in cells fated to undergo growth inhibition. Moreover, it depended on the ability of FTI to elicit RhoB-GG because relocalization did not occur in ER –/–cells in which RhoB-GG could not be induced. The change in Cyclin B1 localization could conceivably occur in one of two ways, either by imposing a block to nuclear import or by potentiating nuclear export. Nuclear export of Cyclin B1 is mediated by a CRM1-dependent mechanism (35) . However, we found that the CRM1 inhibitor leptomycin B1 did not prevent relocalization of Cyclin B1 in ER +/–cells (data not shown), suggesting that cytosolic accumulation occurred as a result of a block to nuclear import. We concluded that, at early times after FTI treatment, RhoB impaired the nuclear accumulation of Cyclin B1 in cells that were fated to undergo apoptosis.



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 4. Role of RhoB in mediating cytosolic accumulation of Cyclin B1 at early times after FTI treatment. ER +/–and ER –/–cells were seeded overnight onto coverslips and then fed with medium containing 10% or 0.1% fetal bovine serum (growth-inhibitory or apoptotic fate, respectively, after FTI treatment). On the following day, cells were treated 8 hours (8h) with 10 µmol/L FTI L-744,832 (+FTI) or vehicle (Control), were fixed and permeabilized, and were processed for indirect immunofluorescence with an anti-Cyclin B1 antibody (Anti-cycB1). DAPI costaining was used to visualize nuclei.

 
Enforcing Cyclin B1 Expression Limits RhoB-Dependent Apoptosis Triggered by FTI.
We reasoned that if cyclin B1 suppression was essential for FTI-induced apoptosis, then overexpressing cyclin B1 to combat its down-regulation might reduce apoptotic susceptibility of ER +/–cells. Conversely, we reasoned that reducing cyclin B1 expression would elevate the sensitivity of ER –/–cells to FTI- induced apoptosis. To test these predictions, we compared the FTI response in ER +/–cells in which Cyclin B1 was augmented by ectopic expression, and in ER –/–cells in which Cyclin B1 levels were reduced by an RNAi strategy. As a control for apoptosis suppression, we overexpressed the antiapoptotic protein Bcl-xL in ER +/–cells.

Using a human cyclin B1 vector (22) , we achieved a several-fold increase in steady-state levels of Cyclin B1 protein in ER +/–cells (Fig. 5)Citation . FTI treatment of these cells (ER +/–cycB1 cells) still led to a reduction in steady-state levels of Cyclin B1, but only to the level of expression that was characteristic of untreated vector control cells (ER +/–vect cells). This observation was consistent with evidence that RhoB affected Cyclin B1 at more than at a transcriptional level (as suggested by the microarray analysis). From a functional standpoint, the ER +/–cycB1 cells were acceptable to test our hypothesis, because the steady-state level of Cyclin B1 in FTI-treated cells persisted to levels that were similar to those found in untreated ER +/– vector cells. An effect of exogenous Cyclin B1 was also reflected on steady-state levels of Cdk1 and phosphorylated (active) Cdk1, which were elevated in ER +/–cycB1 cells toward the levels of untreated control cells (Fig. 5A)Citation . We noted that Bcl-xL also elevated the level of endogenous cyclin B1 and Cdk1, hinting at some level of cross-talk in this system that was mechanistically undefined.



View larger version (89K):
[in this window]
[in a new window]
  		Fig. 5. Enforcing Cyclin B1 blocks apoptosis but not growth inhibition by FTI. A, transgene expression in ER +/–cell populations. Cells expressing ectopic Cyclin B1 (cycB1) or Bcl-xL (bcl-xL) or that contained only vector sequences (vect) were cultured 18 hours in medium containing 0.1% fetal bovine serum before 18-hour treatment with FTI (+) or vehicle only (–). Cell extracts were prepared and examined by Western analysis with antibodies to Cyclin B1 (CycB1), Cdk1, phospho-Cdk1 (p-Cdk1), Bcl-xL, and actin. B, lack of effect on anchorage-independent growth by FTI. Cells (104) were seeded in soft agar culture containing vehicle (Control) or FTI (+FTI), and colonies were photographed 2 weeks later. C, inhibition of apoptosis triggered by FTI. After seeding in normal growth medium, cells were fed with medium containing 0.1% fetal bovine serum and, 18 hours later, were treated an additional 24 hours with FTI (+FTI) or vehicle (Control) before photomicrography and processing for TUNEL reaction and flow cytometry. (N.D., not determined.) M1 gate quantifies apoptosis by TUNEL.

 
Overrexpressed Cyclin B1 specifically inhibited the apoptotic response of ER +/–cells to FTI treatment. Under normal culture conditions, ER +/–cells respond to FTI by undergoing morphologic reversion, stress fiber formation, and growth inhibition (5) ; and enforced cyclin B1 expression did not alter the pattern of these responses. FTI-induced actin stress fiber formation was not affected (data not shown). RhoB-GG is sufficient and necessary to mediate this response (5) , so the ability of FTI to induce stress fibers in ER +/–cycB1 cells confirmed that enforced Cyclin B1 did not interfere with the induction of a functionally competent RhoB-GG molecule. Similarly, neither enforced cyclin B1 nor Bcl-xL blocked the ability of FTI to cause growth inhibition under anchorage-independent conditions (Fig. 5B)Citation . In contrast, enforced cyclin B1 and Bcl-xL each inhibited the apoptotic response of ER +/–cells to FTI treatment that was manifested under serum-deprived conditions, as documented by TUNEL assay and flow cytometry (Fig. 5C)Citation . This observation suggested that Cyclin B1 responded downstream of RhoB in the proapoptotic mechanism elicited by FTI. In the converse experiment, we found that small interfering RNA (siRNA)-mediated blockade of cyclin B1 expression in ER –/–cells was not tolerated in stably transfected cell populations. Two cell populations that stably integrated a pShag-1-derived cyclin B1 RNAi vector exhibited reduced cyclin B1 expression and increased FTI sensitivity, relative to control cells, but these cell populations proliferated poorly and were unstable (data not shown). This result was unsurprising, given the requirement of cyclin B1 for cell survival (36) ; and the instability of cell populations expressing the siRNA reinforced the expectation that abolishing Cyclin B1 would be highly deleterious to cell survival. In summary, we concluded that Cyclin B1 suppression was essential for the RhoB-mediated program of apoptosis triggered by FTI.

Cyclin B1 Overexpression Blunts the Antitumor Efficacy of Farnesyl Transferase Inhibition.
Apoptosis plays a major role in the ability of FTI to block tumor growth by ER cells (5) ; therefore, one might predict ER +/–cycB1 cells to exhibit FTI resistance in vivo. To examine this prediction, we compared the FTI response of cells grown as tumor grafts in immunodeficient nude mice. ER +/–vect or ER +/–cycB1 cells (107) were injected into the opposite thighs of the same animal to control for nonspecific environmental effects. On the basis of the marked response of control ER +/–cells to FTI in previous studies (5) , five mice in each group were treated in this manner. Palpable tumors formed in each animal within several days of injection. One week after the graft was initiated, mice were assigned randomly to control or drug treatment groups, the latter of which was dosed once daily for 14 days by intraperitoneal injection with 40 mg/kg L-744,832 as described previously (5 , 13) . Control mice were given vehicle carrier only. Tumor volumes were calculated at various times during the experiment from caliper measurements as described previously (5) . ER +/–cycB1 cells grew markedly more slowly in nude mice than did ER +/–vect cells (Fig. 6A)Citation , which exhibited growth kinetics similar to parental ER +/–cells (5) . The effect of ectopic Cyclin B1 was unexpected given the lack of any discernable effect on in vitro proliferation. Nevertheless, in contrast to ER +/–vect tumors, which were strongly inhibited by drug treatment, the ER +/–cycB1 tumors were completely resistant to FTI (Fig. 6A)Citation . The germane effect of Cyclin B1 on the in vivo response to FTI treatment was apparent when the data were internally normalized to control for the growth effect of Cyclin B1 (Fig. 6B)Citation . We concluded that the suppression of Cyclin B1 mediated by RhoB was critical for FTI efficacy in this system.



View larger version (24K):
[in this window]
[in a new window]
  		Fig. 6. Enforcing Cyclin B1 abolishes FTI antitumor activity. A, tumor growth curve. Cells (107) were injected subcutaneously into nude mice, and tumor volume was determined by caliper measurements at times afterward (n = 5). B, relative effect of FTI on tumor growth at 2 weeks. The data were internally normalized to each cell line to control for the apparent growth effect of Cyclin B1 (cycB1) on tumor growth. Error bars, SD of the data. (vect, vector.)

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
This study identifies Cyclin B1 as a critical proapoptotic target of RhoB in the response of transformed cells to FTI treatment. Cyclin B1 was not affected under conditions of growth inhibition but was linked specifically to apoptotic induction. The earliest changes exhibited by Cyclin B1 occurred within 8 hours of FTI treatment, after induction of RhoB-GG but long before induction of cell death. The notion that Cyclin B1 is required for cell survival is well supported by genetic studies in the mouse (36) . By elucidating a specific and essential component of the apoptotic program triggered by FTI, this study addresses the question of how cytotoxic versus cytostatic responses to FTI may be determined. Efforts to address this question are important, because they may promote efforts to learn why FTI is not cytotoxic or efficacious to human cancers and to learn how to leverage the utility of these well-tolerated agents in the clinic. Our results argue that suppressing Cyclin B1 is critical to antitumor activity, in support of other evidence that apoptosis is critical to in vivo antitumor efficacy (5 , 14 , 16) . In the one study that has reported FTI effects on cyclin B1 in human cancer cells, it was found that growth inhibition was associated with high Cyclin B1/Cdk1 activity, which is consistent with our observations (19) . By establishing a causal link between Cyclin B1 suppression and apoptosis, this study advances understanding of how FTI triggers transformation-selective apoptosis via RhoB-GG. The connection between FTI and Cyclin B1 suppression is important because it may help uncover potential defects in a pathway that is responsible for attenuating the cytotoxicity and efficacy of FTIs in human cancers.

RhoB localizes to plasma and to vesicular and nuclear membranes, and it has a physiologic function in controlling intracellular trafficking processes (6 , 33 , 37, 38, 39) . Knockout mouse studies show that RhoB is dispensable for murine development but that it has a critical role in stress-signaling processes and cancer suppression (2) . Existing members of the RhoB "traffickome" include the EGFR and the survival kinase Akt, two important regulators of neoplastic cell growth and survival (32 , 33) . The findings of this study suggest that trafficking of Cyclin B1 may also be subjected to control by RhoB under certain stress conditions, including those present in transformed cells. Thus, RhoB may influence susceptibility to proapoptotic stimuli by influencing how signaling molecules are trafficked under stressful conditions (e.g., "trafficking to survive" versus "trafficking to trash"). In support of the concept that signal trafficking may influence apoptotic susceptibility, another study has defined an essential role for Bin1/Amphiphysin2 [a BAR adapter-encoding gene implicated in vesicle trafficking processes and cancer suppression (40, 41, 42, 43, 44, 45) ] in FTI-induced apoptosis (46) . The present work develops the model that altered-signal trafficking can alter apoptotic susceptibility to FTI. If selection against proapoptotic trafficking processes occurs during malignant development, as it does for proapoptotic signaling processes, then such events may be expected to modify the resistance of human cancer cells to FTI-induced apoptosis.

Gaps in understanding Cyclin B1 control in cancer cells complicate the interpretation of our findings. In particular, emerging evidence suggests that mechanisms that normally restrict nuclear accumulation of Cyclin B1 to G2-M phase are profoundly disrupted in human cancer cells (29 , 34) . Nuclear accumulation of Cyclin B1 documented in G1 phase in cancer cells (29) would be expected to elicit premature mitosis and cell death in normal cells, suggesting radical differences in not only the regulation but also the function of Cyclin B1 in cancer cells. E1A+Ras-transformed cells have been used widely to model cancer; and, consistent with human cell studies, we observed widespread constitutive nuclear expression of Cyclin B1 in our E1A/Ras-transformed murine fibroblasts. The significance and basis of these observations are unclear at present, but they highlight the gaps in knowledge that persist about Cyclin B1 control, which is not generally well elucidated, even in normal cells. Although a possible role for cyclin B1 can be entertained in mediating RhoB-dependent cell deaths that occur in noncancer settings, it remains the case that one cannot fully interpret the present findings without gaining greater understanding of the basis and significance of the aberrant control of Cyclin B1 in neoplastic cells.

Despite this situation, it is possible to illustrate how our findings advance FTI studies. First, the Cyclin B1 response can be exploited further to elucidate the mechanistic linkage between RhoB and FTI-induced apoptosis. For example, a potential effector role for kinectin dovetails with the accepted signal-trafficking function of RhoB, because kinectin acts to anchor the microtubule motor protein kinesin to membranes and to facilitate vesicle movement (47) . Kinectin is dispensable for normal development and physiology in the mouse, but its role in stress processes or cancer has not been explored (48) . If kinectin is essential for Cyclin B1 control by RhoB, then defects in kinectin structure or expression in cancer may attenuate the ability of RhoB-GG to mediate apoptosis. If such defects are selected during tumor progression, they may inherently compromise FTI cytotoxicity. In summary, although kinectin has not been validated as a relevant effector molecule, the discussion above illustrates how learning about effectors can yield new clues to cancer pathophysiology and mechanisms of FTI cytotoxicity and resistance. Another use of the findings is the potential for Cyclin B1 to predict favorable versus unfavorable FTI responses in the clinic based on cytotoxic susceptibility. To date, clinical experience suggests that breast cancers and leukemias are among the most likely to respond favorably to FTI (49) . Cyclin B1 has been reported to be profoundly dysregulated in these cancers, perhaps making them more susceptible to FTI cytotoxicity (29 , 34) . Given that overexpressed Cyclin B1 can limit FTI-induced apoptosis, an additional implication is that FTI cytotoxicity and clinical response might be enhanced by combination with a Cdk1 inhibitor. Indeed, generalized Cdk inhibitors have been reported to cooperate with FTI to trigger cell death in human cancer cells (50) . Additional studies of Cyclin B1 in the FTI response of human cancer cells would seem warranted, given its potential to serve as a marker to help triage patients, predict responses, and address nonresponders in clinic.


   ACKNOWLEDGMENTS
 
We thank members of our laboratory for constructive criticism. We kindly acknowledge D. Ramljak and R. B. Dickson (Georgetown University, Washington, DC) for providing MMEC/myc myc83 cells and G. V. Hannon (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) for providing the RNA interference vector pShag-1.


   FOOTNOTES
 
Grant support: Supported by NIH grant CA82222 to G. Prendergast; U. Kamasani was supported by a postdoctoral grant from the US Army Breast Cancer Research Program (DAMD17-01-1-046).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: George C. Prendergast, Lankenau Institute for Medical Research, Cancer Cell Signaling Laboratory, 100 Lancaster Avenue, Wynnewood, PA 19096. Phone: (610) 645-8475; Fax: (610) 645-8091; E-mail: prendergastg{at}mlhs.org

4 Internet address: http://www.cshl.org/public/SCIENCE/hannon.html. Back

Received 7/14/04. Revised 9/12/04. Accepted 10/ 6/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Prendergast GC Farnesyltransferase inhibitors: antineoplastic mechanism and clinical prospects. Curr Opin Cell Biol 2000;12:166-73.[CrossRef][Medline]
  2. Prendergast GC Actin’ up: RhoB in cancer and apoptosis. Nat Rev Cancer 2001;1:162-8.[CrossRef][Medline]
  3. Prendergast GC, Oliff A Farnesyltransferase inhibitors: antineoplastic properties, mechanisms of action, and clinical prospects. Semin Cancer Biol 2000;10:443-52.[CrossRef][Medline]
  4. Cox AD Farnesyltransferase inhibitors: potential role in the treatment of cancer. Drugs 2001;61:723-32.[CrossRef][Medline]
  5. Liu A-X, Du W, Liu J-P, Jessell TM, Prendergast GC RhoB alteration is required for the apoptotic and antineoplastic responses to farnesyltransferase inhibitors. Mol Cell Biol 2000;20:6105-13.[Abstract/Free Full Text]
  6. Wherlock M, Gampel A, Futter C, Mellor H Farnesyltransferase inhibitors disrupt EGF receptor traffic through modulation of the RhoB GTPase. J Cell Sci 2004;117:3221-31.[Abstract/Free Full Text]
  7. Lebowitz P, Casey PJ, Prendergast GC, Thissen J Farnesyltransferase inhibitors alter the prenylation and growth-stimulating function of RhoB. J Biol Chem 1997;272:15591-4.[Abstract/Free Full Text]
  8. Zeng P-Y, Rane N, Du W, Chintapalli J, Prendergast GC Role of RhoB and PRK in the suppression of epithelial cell transformation by farnesyltransferase inhibitors. Oncogene 2003;22:1124-34.[CrossRef][Medline]
  9. Du W, Lebowitz P, Prendergast GC Cell growth inhibition by farnesyltransferase inhibitors is mediated by gain of geranylgeranylated RhoB. Mol Cell Biol 1999;19:1831-40.[Abstract/Free Full Text]
  10. Du W, Prendergast GC Geranylgeranylated RhoB mediates inhibition of human tumor cell growth by farnesyltransferase inhibitors. Cancer Res 1999;59:5924-8.
  11. Liu A-X, Rane N, Liu J-P, Prendergast GC RhoB is dispensable for mouse development, but it modifies susceptibility to tumor formation as well as cell adhesion and growth factor signaling in transformed cells. Mol Cell Biol 2001;21:6906-12.[Abstract/Free Full Text]
  12. Liu A-X, Cerniglia GJ, Bernhard EJ, Prendergast GC RhoB is required for the apoptotic response of neoplastically transformed cells to DNA damage. Proc Natl Acad Sci USA 2001;98:6192-7.[Abstract/Free Full Text]
  13. Kohl NE, Omer CA, Conner MW, et al Inhibition of farnesyltransferase induces regression of mammary and salivary carcinomas in ras transgenic mice. Nat Med 1995;1:792-7.[CrossRef][Medline]
  14. Liu M, Bryant MS, Chen J, et al Antitumor activity of SCH 66336, an orally bioavailable tricyclic inhibitor of farnesyl protein transferase, in human tumor xenograft models and wap-ras transgenic mice. Cancer Res 1998;58:4947-56.[Abstract/Free Full Text]
  15. Mangues R, Corral T, Kohl NE, et al Antitumor effect of a farnesyl protein transferase inhibitor in mammary and lymphoid tumors overexpressing N-ras in transgenic mice. Cancer Res 1998;58:1253-9.[Abstract/Free Full Text]
  16. Barrington RE, Subler MA, Rands E, et al A farnesyltransferase inhibitor induces tumor regression in transgenic mice harboring multiple oncogenic mutations by mediating alterations in both cell cycle control and apoptosis. Mol Cell Biol 1998;18:85-92.[Abstract/Free Full Text]
  17. Kamasani U, Liu A-X, Prendergast GC Genetic response to farnesyltransferase inhibitors: proapoptotic targets of RhoB. Cancer Biol Ther 2003;2:273-80.[Medline]
  18. Crespo NC, Ohkanda J, Yen TJ, Hamilton AD, Sebti SM The farnesyltransferase inhibitor, FTI-2153, blocks bipolar spindle formation and chromosome alignment and causes prometaphase accumulation during mitosis of human lung cancer cells. J Biol Chem 2001;276:16161-7.[Abstract/Free Full Text]
  19. Song SY, Meszoely IM, Coffey RJ, Pietenpol JA, Leach SD K-Ras-independent effects of the farnesyl transferase inhibitor L-744,832 on cyclin B1/cdc2 kinase activity, G2/M cell cycle progression and apoptosis in human pancreatic ductal adenocarcinoma cells. Neoplasia 2000;2:261-72.[Medline]
  20. Amundadottir LT, Nass SJ, Berchem GJ, Johnson MD, Dickson RB Cooperation of TGF alpha and c-Myc in mouse mammary tumorigenesis coordinated stimulation of growth and suppression of apoptosis. Oncogene 1996;13:757-65.[Medline]
  21. Ramljak D, Coticchia CM, Nishanian TG, et al Epidermal growth factor inhibition of c-Myc-mediated apoptosis through Akt and Erk involves Bcl-xL upregulation in mammary epithelial cells. Exp Cell Res 2003;287:397-410.[CrossRef][Medline]
  22. Yin XY, Grove L, Datta NS, Katula K, Long MW, Prochownik EV Inverse regulation of cyclin B1 by c-Myc and p53 and induction of tetraploidy by cyclin B1 overexpression. Cancer Res 2001;61:6487-93.[Abstract/Free Full Text]
  23. Lebowitz PF, Sakamuro D, Prendergast GC Farnesyltransferase inhibitors induce apoptosis in Ras-transformed cells denied substratum attachment. Cancer Res 1997;57:708-13.[Abstract/Free Full Text]
  24. Suzuki N, Urano J, Tamanoi F Farnesyltransferase inhibitors induce cytochrome c release and caspase 3 activation preferentially in transformed cells. Proc Natl Acad Sci USA 1998;95:15356-61.[Abstract/Free Full Text]
  25. Du W, Liu A, Prendergast GC Activation of the PI3'K-AKT pathway masks the proapoptotic effect of farnesyltransferase inhibitors. Cancer Res 1999;59:4808-12.[Abstract/Free Full Text]
  26. Prendergast GC, Davide JP, deSolms SJ, et al Farnesyltransferase inhibition causes morphological reversion of ras-transformed cells by a complex mechanism that involves regulation of the actin cytoskeleton. Mol Cell Biol 1994;14:4193-202.[Abstract/Free Full Text]
  27. Lebowitz P, Du W, Prendergast GC Prenylation of RhoB is required for its cell transforming functions but not its ability to activate SRE-dependent transcription. J Biol Chem 1997;272:16093-6.[Abstract/Free Full Text]
  28. Porter LA, Donoghue DJ Cyclin B1 and CDK1: nuclear localization and upstream regulators. Prog Cell Cycle Res 2003;5:335-47.[Medline]
  29. Shen M, Feng Y, Gao C, et al Detection of cyclin B1 expression in G(1)-phase cancer cell lines and cancer tissues by postsorting Western blot analysis. Cancer Res 2004;64:1607-10.[Abstract/Free Full Text]
  30. Whyte DB, Kirschmeier P, Hockenberry TN, et al K- and N-ras geranylgeranylated in cells treated with farnesyl protein transferase inhibitors. J Biol Chem 1997;272:14459-64.[Abstract/Free Full Text]
  31. Sahai E, Alberts AS, Treisman R RhoA effector mutants reveal distinct effector pathways for cytoskeletal reorganization, SRF activation and transformation. EMBO J 1998;17:1350-61.[CrossRef][Medline]
  32. Gampel A, Parker PJ, Mellor H Regulation of epidermal growth factor receptor traffic by the small GTPase RhoB. Curr Biol 1999;9:955-8.[CrossRef][Medline]
  33. Adini I, Rabinowitz I, Sun JF, Prendergast GC, Benjamin LE. RhoB controls Akt trafficking and stage-specific survival of endothelial cells during vascular development. Genes Dev 2003;17.
  34. Gong J, Ardelt B, Traganos F, Darzynkiewicz Z Unscheduled expression of cyclin B1 and cyclin E in several leukemic and solid tumor cell lines. Cancer Res 1994;54:4285-8.[Abstract/Free Full Text]
  35. Hagting A, Karlsson C, Clute P, Jackman M, Pines J MPF localization is controlled by nuclear export. EMBO J 1998;17:4127-38.[CrossRef][Medline]
  36. Brandeis M, Rosewell I, Carrington M, et al Cyclin B2-null mice develop normally and are fertile whereas cyclin B1-null mice die in utero. Proc Natl Acad Sci USA 1998;95:4344-9.[Abstract/Free Full Text]
  37. Adamson P, Paterson HF, Hall A Intracellular localization of the p21rho proteins. J Cell Biol 1992;119:617-27.[Abstract/Free Full Text]
  38. Lebowitz P, Prendergast GC Functional interaction between RhoB and the transcription factor DB1. Cell Adhes Commun 1998;4:1-11.
  39. Michaelson D, Silletti J, Murphy G, D’Eustachio P, Rush M, Philips MR Differential localization of Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI binding. J Cell Biol 2001;152:111-26.[Abstract/Free Full Text]
  40. Peter BJ, Kent HM, Mills IG, et al BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science (Wash DC) 2004;303:495-9.[Abstract/Free Full Text]
  41. Sakamuro D, Elliott K, Wechsler-Reya R, Prendergast GC BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. Nat Genet 1996;14:69-77.[CrossRef][Medline]
  42. Ge K, DuHadaway J, Du W, Herlyn M, Rodeck U, Prendergast GC Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. Proc Natl Acad Sci USA 1999;96:9689-94.[Abstract/Free Full Text]
  43. Ge K, DuHadaway J, Sakamuro D, Wechsler-Reya R, Reynolds C, Prendergast GC Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Int J Cancer 2000;85:376-83.[CrossRef][Medline]
  44. Tajiri T, Liu X, Thompson PM, et al Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. Clin Cancer Res 2003;9:3345-55.[Abstract/Free Full Text]
  45. Muller AJ, DuHadaway JB, Donover PS, Sutanto-Ward E, Prendergast GC. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Cell Biol Ther 2004;in press.
  46. DuHadaway JB, Du W, Liu A-X, et al Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. Oncogene 2003;22:3578-88.[CrossRef][Medline]
  47. Kumar J, Yu H, Sheetz MP Kinectin, an essential anchor for kinesin-driven vesicle motility. Science (Wash DC) 1995;267:1834-7.[Abstract/Free Full Text]
  48. Plitz T, Pfeffer K Intact lysosome transport and phagosome function despite kinectin deficiency. Mol Cell Biol 2001;21:6044-55.[Abstract/Free Full Text]
  49. Caponigro F, Casale M, Bryce J Farnesyl transferase inhibitors in clinical development. Expert Opin Investig Drugs 2003;12:943-54.[CrossRef][Medline]
  50. Edamatsu H, Gau C-L, Nemoto T, Guo L, Tamanoi F Cdk inhibitors, roscovitine and olomoucine, synergize with farnesyltransferase inhibitor (FTI) to induce efficient apoptosis of human cancer cell lines. Oncogene 2000;19:3059-68.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
A. D. Basso, P. Kirschmeier, and W. R. Bishop
Thematic review series: Lipid Posttranslational Modifications. Farnesyl transferase inhibitors
J. Lipid Res., January 1, 2006; 47(1): 15 - 31.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
B. F. Goemans, C. M. Zwaan, A. Harlow, A. H. Loonen, B. E. S. Gibson, K. Hahlen, D. Reinhardt, U. Creutzig, M. C. Heinrich, and G. J. L. Kaspers
In vitro profiling of the sensitivity of pediatric leukemia cells to tipifarnib: identification of T-cell ALL and FAB M5 AML as the most sensitive subsets
Blood, November 15, 2005; 106(10): 3532 - 3537.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Pan and S.-C. J. Yeung
Recent Advances in Understanding the Antineoplastic Mechanisms of Farnesyltransferase Inhibitors
Cancer Res., October 15, 2005; 65(20): 9109 - 9112.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. Pan, M. She, Z.-X. Xu, L. Sun, and S.-C. J. Yeung
Farnesyltransferase Inhibitors Induce DNA Damage via Reactive Oxygen Species in Human Cancer Cells
Cancer Res., May 1, 2005; 65(9): 3671 - 3681.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamasani, U.
Right arrow Articles by Prendergast, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamasani, U.
Right arrow Articles by Prendergast, G. C.

HOME HELP