Cancer Research Cancer Epigenetics  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eckfeld, K.
Right arrow Articles by Clark, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eckfeld, K.
Right arrow Articles by Clark, G. J.
[Cancer Research 64, 8688-8693, December 1, 2004]
© 2004 American Association for Cancer Research


Regular Articles

RASSF4/AD037 Is a Potential Ras Effector/Tumor Suppressor of the RASSF Family

Kristin Eckfeld1, Luke Hesson2, Michele D. Vos1, Ivan Bieche3, Farida Latif2 and Geoffrey J. Clark1

1 Department of Cell and Cancer Biology, National Cancer Institute, Rockville, Maryland; 2 Section of Medical and Molecular Genetics, Division of Reproductive and Child Health, University of Birmingham, Birmingham, United Kingdom; and 3 Laboratoire d’Oncogenetique-INSERM E0017, Centre Rene Huguenin, St-Cloud, France


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Activated Ras proteins interact with a broad range of effector proteins to induce a diverse series of biological consequences. Although typically associated with enhanced growth and transformation, activated Ras may also induce growth antagonistic effects such as senescence or apoptosis. It is now apparent that some of the growth-inhibitory properties of Ras are mediated via the RASSF family of Ras effector/tumor suppressors. To date, four members of this family have been identified (Nore1, RASSF1, RASSF2, and RASSF3). We now identify a fifth member of this group, RASSF4 (AD037). RASSF4 shows approximately 25% identity with RASSF1A and 60% identity with RASSF2. RASSF4 binds directly to activated K-Ras in a GTP-dependent manner via the effector domain, thus exhibiting the basic properties of a Ras effector. Overexpression of RASSF4 induces Ras-dependent apoptosis in 293-T cells and inhibits the growth of human tumor cell lines. Although broadly expressed in normal tissue, RASSF4 is frequently down-regulated by promoter methylation in human tumor cells. Thus, RASSF4 appears to be a new member of the RASSF family of potential Ras effector/tumor suppressors.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ras oncoproteins participate in the regulation of a broad range of normal biological processes, but activating point mutations in Ras are often associated with the development of human cancer (1) . Ras functions by binding and modulating the enzymatic activity of a diverse array of effector proteins, many of which are potential oncoproteins themselves such as Raf kinases, RalGEFs, and phosphatidylinositol 3'-kinases (2, 3, 4, 5) . Consequently, Ras may be regarded as a master oncoprotein that can activate cascades of other oncoproteins to mediate transformation. However, it has now become apparent that activated forms of Ras can also induce growth antagonistic effects such as cell cycle arrest, senescence, and apoptosis (6, 7, 8, 9, 10) . If Ras can antagonize growth in some circumstances, then it follows that some Ras effector pathways can operate to negatively regulate cell growth and survival. Indeed, this appears to be the case with the RASSF family of proteins (10 , 11) . To date, RASSF1 (12 , 13) , Nore1 [RASSF5 (14 , 15) ], and RASSF2 (16) have been shown to directly interact with Ras proteins with the characteristics of effectors. These proteins can induce cell death in a Ras-dependent manner. Moreover, these proteins are all frequently down-regulated during tumor development by promoter methylation (15, 16, 17, 18) . This suggests that one of the key characteristics of Ras-dependent tumors may be the subversion of growth-inhibitory Ras effector pathways.

We now identify a new member of the RASSF family, RASSF4 (also called AD037 in some early database entries). RASSF4 shows approximately 25% identity with RASSF1A and 60% identity with RASSF2. Here we show that human RASSF4 binds K-Ras in a GTP-dependent manner via the effector domain and synergizes with K-Ras to induce apoptotic cell death in 293-T cells. Expression of RASSF4 inhibits the growth of human tumor cells, and this effect is enhanced by the addition of a Ras CAAX membrane localization signal to the COOH terminus of RASSF4.

RASSF4 is broadly expressed in human tissues but is frequently down-regulated in human tumor cell lines and primary tumors. Down-regulation of RASSF4 expression correlates with the methylation of the promoter. Thus, we propose that RASSF4 is a new potential Ras effector/tumor suppressor of the RASSF family.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids and DNA.
RASSF4 was identified by TblastN searches of the expressed sequence tag (EST) database using sequences from the RASSF2 Ras association (RA) domain as probes. The EST clone (5727323) was purchased from the IMAGE consortium via the ATCC (Manassas, VA), and the gene was cloned by polymerase chain reaction (PCR) using the oligomers (5'-3') ggagatctaccatgaaggaagactgtctgccg and cgcgaattcttacttggcctccaccagctg. A CAAX sequence from H-Ras was added by PCR using the 3' oligonucleotide gcgaattcaggagagcacacacttgcagctcatgcacttggcctccaccagctgctc. The gene was cloned into expression vectors pEGFP and pHc-Red (Clontech, Palo Alto, CA), pcDNAF (19) , and pBabe (20) as a BglII/EcoRI fragment. The RA domain of RASSF4 was cloned by PCR using the oligomers (5'-3') ggagatctggtgaggcccagcgcatcc and gggaattcctagacttcccacgcccaagtcagc and cloned into pGEX2T (Pharmacia, Piscataway, NJ) as a BglII/EcoRI fragment. The pCGN K-Ras plasmids and pSensor system have been described previously (16) . MST1 plasmids were a generous gift from J. Chernoff (Fox Chase Cancer Center, Philadelphia, PA).

Cell Culture.
293-T cells were grown in Dulbecco’s modified Eagle’s medium/10% fetal bovine serum, and tumor cell lines were grown in RPMI 1640/10% fetal bovine serum supplemented with penicillin (100 units/mL)/streptomycin (100 µg/mL). Cells were incubated with 10% CO2 at 37°C. Cell lines and primary tumors have been described previously (15 , 16 , 21 , 22) . Cells were transfected with LipofectAMINE 2000 (Invitrogen, Carlsbad, CA). In situ, trypan blue uptake assays were performed on 293-T human embryonic kidney cells (American Type Culture Collection, Manassas, VA). Cells were transfected with 5 µg of RASSF4 in the presence or absence of 50 ng of K-Ras12V. Seventy two hours after transfection, trypan blue was added at a final concentration of 0.04%. Dye uptake was quantified by counting the number of blue cells in three random x40 fields in two separate assays. Apoptosis assays using the pSensor system were performed as described previously (16) . 5-Aza-2'-deoxycytidine treatment was performed by plating 5 to 10 x 105 cells and allowing growth for 24 hours before the addition of 10 µmol/L 5-aza-2'-deoxycytidine (Sigma, St. Louis, MO). The medium (including 10 µmol/L 5-aza-2'-deoxycytidine) was changed 24 hours after seeding and then changed every 3 days. RNA was prepared 7 days after treatment using the RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions.

Recombinant Protein Binding Assays.
Preparation of RASSF4 glutathione S-transferase (GST) fusion proteins and Ras binding assays were performed as described previously (16) . Purified, baculovirus-derived K-Ras was a generous gift of D. Stokoe (University of California San Francisco Cancer Center, San Francisco, CA). Ras was visualized using K-Ras–specific monoclonal antibody F234 (Santa Cruz Biotechnology, Santa Cruz, CA).

Bisulfite Modification and Methylation Analysis.
Bisulfite DNA sequencing was performed as described previously (21) . The RASSF4 CpG island spanning the first noncoding exon was analyzed. The region was amplified from cell lines and tumors by PCR using the primers RASSF4 F (5'-AGGATAYGATATATGTAGTGGTTTTTGGATT-3') and RASSF4 R (5'-ATTATAACCCCTAAATTACTTAACAAAAATACCAAA-3'), where Y = C or T to ensure no bias toward methylated or unmethylated templates. PCR products were then digested with TaqI or BstUI for 2 hours at 65°C and 60°C, respectively, to assay for methylation. PCR products were also concentrated and purified using QIAquick PCR purification columns (Qiagen) according to the manufacturer’s instructions. Purified PCR products were sequenced directly using ABI BigDye cycle sequencing kit (Perkin-Elmer, Fremont, CA).

Expression Analysis by Real-Time Reverse Transcription-Polymerase Chain Reaction.
Tumor cell lines were analyzed for RASSF4 expression using real-time reverse transcription-PCR (RT-PCR) and RT-PCR. Quantitative real-time RT-PCR was performed as described previously (23) . Quantified levels of TATA box-binding protein (TBP) transcripts were used as the endogenous RNA control, and each sample was normalized according to TBP content. Results, expressed as N-fold differences in target gene expression relative to the TBP gene (termed Ntarget), were determined by the following formula: Ntarget = 2{Delta}Ctsample, where the {Delta}Ct value of the sample was determined by subtracting the average Ct value (cycle number) of the target gene from the average Ct value of the TBP gene. The Ntarget values of the samples were subsequently normalized such that the mean ratio of the normal breast samples would equal a value of 1. Primers used for real-time RT-PCR amplification were specific for exon 10 (5'-ACATTAAGTTTGAAATGCCGGTGCT-3') and junction exon 10/exon 11 (5'-GCAGGGCTTGGAACTTCATGT-3') to give an expected product size of 102 bp and for TBP-F (5'-TGCACAGGAGCCAAGAGTGAA-3') and TBP-R (5'-CACATCACAGCTCCCCACCA-3') to give a 132-bp product. PCR was performed using the SYBR Green PCR Core Reagents kit (Perkin-Elmer) under the following conditions: 95°C initial denaturation step for 10 minutes, followed by 50 cycles of 95°C for 15 seconds and 65°C for 1 minute. Experiments were performed with duplicates for each data point. The SE was <20%.

RT-PCR was performed using Ready-to-go RT-PCR reaction beads (Amersham Biosciences, Piscataway, NJ). Primers used for RT-PCR were specific for exon 2 (5'-GAAGACTGTCTGCCGAGTTC-3') and exon 5 (5'-CTGTCTGTGGAACTCTCAGC-3') to give an expected product size of 362 bp. Two methylated colorectal carcinoma cell lines and two methylated breast carcinoma cell lines were treated with 10 µmol/L demethylating agent 5-aza-2'-deoxycytidine. Multiple tissue cDNA (MTC) panel I (Clontech) was used for expression analysis in normal tissues using the above-mentioned RT-PCR RASSF4-specific primers.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sequence Alignment of RASSF4.
RASSF4 was identified as a RASSF family member by TblastN searches of the EST database. Sequences were aligned with ClustalW (Fig. 1)Citation . The RASSF4 protein demonstrates approximately 60% identity with RASSF2 and 25% identity with RASSF1. The predicted RA domain is shaded in Fig. 1Citation and demonstrates 73% identity with that of RASSF2.



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Alignment of RASSF4, RASSF2, and RASFF1A. Sequences were aligned with ClustalW. The RA domain is shaded.

 
RASSF4 Binds Ras in a GTP-Dependent Manner via the Effector Domain.
To determine whether RASSF4 might serve as a Ras effector, we cotransfected 293-T cells with FLAG-tagged RASSF4 and wild-type or activated K-Ras in a hemagglutinin (HA)-tagged vector and performed coimmunoprecipitation experiments. We found that RASSF4 could readily be precipitated with activated but not wild-type K-Ras (Fig. 2A)Citation . Thus, the interaction between Ras and RASSF4 requires that Ras be in the active, GTP-bound conformation. To confirm that the interaction was via the Ras effector domain, we used an effector mutant (24) of activated K-Ras (16) . The binding of the effector mutant to RASSF4 was severely impaired (Fig. 2B)Citation .



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A. RASSF4 binds activated K-Ras in cells. RASSF4 was transfected into 293-T cells with activated or wild-type K-Ras. The bottom panel is a Western blot of the lysates. The top panel is a HA immunoprecipitation followed by a Western blot with HA and FLAG. RASSF4 only precipitates with activated K-Ras. B. 293-T cells were transfected with RASSF4 and activated Ras or an effector mutant (E37G) of activated K-Ras. The bottom panel shows a Western blot of the lysates to confirm similar levels of expression of all of the recombinant proteins. The top panel shows that only the activated K-Ras with an intact effector domain can coprecipitate with RASSF4. C. RASSF4 interacts directly with activated K-Ras. A recombinant GST fusion protein of the RA domain of RASSF4 was prepared and used as an affinity reagent to precipitate farnesylated K-Ras loaded with GTP.

 
RASSF4 Binds K-Ras Directly.
To determine whether the interaction between Ras and RASSF4 was direct, we prepared a GST fusion of the RA domain of RASSF4. The GST-RA fusion protein was then used as an affinity reagent in binding assays using purified, recombinant K-Ras protein derived from a baculovirus infection of Sf9 cells. The precipitate was then subjected to Western analysis using a K-Ras monoclonal antibody. GST-RASSF4 RA, but not GST, precipitated K-Ras. Thus, in vitro, the interaction of K-Ras and RASSF4 is direct (Fig. 2C)Citation . Levels of GST proteins used in the assays were determined by reprobing the blot with a GST antibody.

Activated Ras Stimulates RASSF4-Mediated Cell Death.
To determine the biological effects of RASSF4 expression, we transfected RASSF4 into 293-T cells in the presence or absence of activated K-Ras. After 48 hours, the cells were stained with trypan blue to quantify cell death. RASSF4 promoted cell death and synergized with activated K-Ras to kill cells (Fig. 3A, i)Citation . The average of two independent experiments is shown in the bar graph in Fig. 3A, iiCitation . The protein levels of RASSF4 in the experiment were determined by Western blot and found to be similar (Fig. 3A, iii)Citation .



View larger version (79K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A. RASSF4-mediated cell death is activated by K-Ras. 293-T cells were transfected RASSF4 ± activated K-Ras. Cell death was determined by trypan blue staining. i, a representative staining assay. ii, average of two separate assays. iii, expression levels of RASSF4 in the transfected cells. B. RASSF4 induces apoptosis when overexpressed in MCF-7 human breast tumor cells. MCF-7 cells were transfected with RASSF4 fused to red fluorescent protein and the EGFP-pSensor plasmid. RASSF4-positive cells were then scored after 16 hours for caspase-induced nuclear localization of the EGFP-pSensor protein by fluorescent microscopy. Results shown are the average of two separate assays. Fas serves as the positive control. C. RASSF4 inhibits human tumor cell growth. A549 human lung tumor cells (i) and MCF-7 human breast tumor cells (ii) were transfected with RASSF4 or RASSF4-CAAX in pBabe and selected in puromycin. Surviving colonies were stained after 2 weeks.

 
RASSF4 Can Induce Apoptosis in Human Tumor Cell Lines.
To further examine the mechanism behind the growth-inhibitory properties of RASSF4, we performed apoptosis assays on transfected MCF-7 human breast tumor cells. Cells were transfected with pHc-Red RASSF4 and the indicator plasmid enhanced green fluorescent protein (EGFP)-pSensor. The EGFP-pSensor plasmid expresses a green fluorescent indicator protein that localizes to the nucleus on cleavage by caspases during apoptosis. Cells that expressed both RASSF4 and EGFP-pSensor were examined for the location of the Sensor indicator protein. RASSF4 induced an approximately 3-fold increase in the number of transfected cells exhibiting nuclear indicator protein and hence activated caspases (Fig. 3B)Citation . An established method of activating Ras effectors is to add a COOH-terminal CAAX membrane localization sequence to them (25) . RASSF4-mediated caspase activation was further enhanced by the addition of a Ras-CAAX motif to the COOH terminus of RASSF4. Thus, RASSF4 can promote apoptosis in human tumor cells.

RASSF4 Inhibits the Survival of Tumor Cell Lines.
To examine the effects of RASSF4 expression on the growth of tumor cells, the human lung tumor cell line A549 and the human breast tumor cell line MCF-7 were transfected with RASSF4 in the vector pBabe (20) , and the cells were selected in puromycin. After 2 weeks, puromycin-resistant colonies were stained with crystal violet. Fig. 3CCitation shows that RASSF4 inhibited colony formation. When we compared the wild-type RASSF4 and RASSF4-CAAX in the A549 lung tumor cells, we saw that the RASSF4-CAAX was more growth inhibitory than the wild-type protein.

RASSF4 Is Frequently Inactivated by Promoter Methylation in Human Tumor Cells.
Real-time RT-PCR analysis showed that RASSF4is expressed in normal breast, lung, and kidney tissue (Fig. 4A)Citation .



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. A. RASSF4is broadly expressed in normal tissue. RT-PCR of a multiple tissue cDNA panel was used to assess the relative expression levels of RASSF4in different tissues. Lane 1, heart; Lane 2, brain; Lane 3, placenta; Lane 4, lung; Lane 5, liver; Lane 6, skeletal muscle; Lane 7, pancreas. B. The RASSF4promoter is frequently methylated during transformation. A summary table of the percentage of tumor cell lines and primary tumor samples that scored positive for promoter methylation by COBRA is shown. ND, not determined.

 
RASSF4 is related to the RASSF1 and Nore1 tumor suppressors. The expression of RASSF1A and Nore1 is frequently down-regulated by a process of promoter methylation (18 , 19) . Consequently, we sought to determine whether the promoter of RASSF4was also the subject of epigenetic inactivation during the process of transformation. Combined bisulfate restriction analysis (COBRA) was performed on a series of human tumor cell lines and primary tumor samples. The results are summarized in Fig. 4BCitation and show that the promoter of RASSF4is frequently methylated in primary tumors and tumor cell lines. No methylation was detected in normal samples. Direct sequencing analysis of the promoter of RASSF4in a range of tumor cell lines was used to confirm the methylation (Fig. 5A and B)Citation . Examination of the expression status of RASSF4in kidney and lung tumor cell lines by real-time RT-PCR showed that methylation (M) of the RASSF4promoter correlated with a loss of expression of the gene (Fig. 5C and D)Citation . Examination of breast tumor cell lines and primary breast tumor samples also showed that methylation correlated with reduced RASSF4expression (Fig. 5E and F)Citation . To confirm that promoter methylation was the basis for the down-regulation of RASSF4, we treated a series of tumor cell lines with the demethylating agent 5-Azacytidine (AzaC). RT-PCR analysis showed that in each case, expression of the gene was enhanced after treatment (Fig. 6)Citation . Thus, promoter methylation contributes to the frequent loss of RASSF4 expression in tumor cells.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Direct sequencing confirms hypermethylation of the RASSF4 CpG island in human tumor cell lines. A. The sequence shows bisulfite modified RASSF4 CpG island predicted promoter region. Primers used for PCR amplification are labeled. CG dinucleotides within the amplified region are numbered, and the location of the first and last nucleotides relative to the transcription start site of RASSF4 (AF260335) are indicated. Underlined sequences and numbers indicate TaqI and BstUI sites that can be used to detect methylation by restriction digest. A distinct pattern of hypermethylation was observed in methylated cell lines with frequent hypermethylation seen at CpG dinucleotides 6 through 16. B. Direct sequencing of COBRA PCR products showing the extent of methylation across the RASSF4 CpG island in tumor cell lines. Colorectal tumor lines, SW48 and DLD1; breast tumor lines, HCC712, HTB27, HCC1395, HCC70, and MCF-7; kidney tumor cell lines, SKRC54, SKRC39, SKRC18, and KTCL26; SCLC cell line, 101. Each box represents the methylation status of each CG dinucleotide; {blacksquare}, methylated; {zch0230455940sc1}, partial methylation; {square}, unmethylated. C and D. RASSF4 CpG island hypermethylation corresponds with down-regulated or absent RASSF4 expression in lung and kidney tumor cell lines. Real-time RT-PCR expression data showing RASSF4 expression levels from several methylated (M) and unmethylated (U) tumor cell lines. Each panel gives levels of RASSF4 mRNA transcript relative to internal control TBP. Results are the average of two assays. SE was <20%. Indicated below each column is the methylation status as determined by COBRA and sequencing. M, methylated; U, unmethylated. C, kidney tumor cell lines and normal kidney; D, lung tumor cell lines (A549 and H2171) and normal lung. E and F. Promoter methylation correlates with reduced expression of RASSF4in human breast tumor cell lines (E) and primary breast tumors (F). M, methylated; U, unmethylated. Expression levels were expressed in comparison with a normalized to a value of 1 obtained from the average of four normal breast samples. SE was <20%.

 


View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. RASSF4 expression is restored after treatment with a demethylating agent. RT-PCR from two methylated breast (MCF-7 and T47D) and two methylated colorectal (SW48 and LoVo) tumor cell lines before (–) and after 5-aza-2'-deoxycytidine treatment (+).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The versatility of Ras oncoproteins in modulating growth processes stems from the ability of Ras oncoproteins to interact with a broad range of heterologous effector proteins. These effector proteins often contain a conserved RA domain. Activated forms of Ras oncoproteins are usually associated with loss of growth control and tumorigenic transformation. However, it has become increasingly apparent that Ras (and other oncogenes) have the ability to activate both growth-enhancing and growth-inhibiting pathways (10 , 26 , 27) . These contrasting activities suggest that the activation of powerful oncogenes such as Ras can promote conflicting biological processes in a potential tumor cell. To successfully manifest transforming activity, the growth-inhibiting pathways controlled by Ras in normal cells must be subverted in some manner, allowing the transforming pathways to dominate.

The recent discovery of the RASSF family of Ras effectors allows an explanation of at least some of the growth-inhibitory actions of Ras. RASSF1, Nore1 (RASSF5), and RASSF2 mediate a Ras-dependent cell cycle arrest and apoptotic death (12 , 15 , 16 , 28 , 29) . Moreover, these proteins are frequently down-regulated by promoter methylation in human tumors and tumor cell lines (15, 16, 17, 18) . A fourth member of the family, RASSF3, has been identified but remains uncharacterized (30) .

By using a bioinformatics-based approach to detect novel RA domain-containing proteins, we have now identified a fifth member of this class of protein, RASSF4. RASSF4 bears closest homology to RASSF2, showing approximately 60% identity overall. RASSF4 lacks the cysteine-rich domain (CRD) present in RASSF1A and Nore1/RASSF5. It also lacks the putative ATM phosphorylation site present before the RA domain in RASSF1A (28) . However, RASSF4 does contain the SARAH motif present in the COOH terminus of RASSF1A and other family members (31) .

Like the other family members (13, 14, 15, 16 , 19) , RASSF4 can bind Ras directly in a GTP-dependent manner via the effector domain. Consequently, it has the potential to serve as a Ras effector. RASSF4 synergized with activated K-Ras to kill cells and a CAAXed form of RASSF4 exhibited enhanced growth-inhibitory properties in human tumor cell lines. Adding a Ras-CAAX membrane localization signal to an effector of Ras is an established method of activating the function of the effector by simulating the membrane recruitment by Ras (25) . These results suggest that activated K-Ras binds and activates RASSF4 to stimulate its growth-inhibitory properties.

Examination of the mechanism by which RASSF4 promotes cell death showed that RASSF4 activates caspases in human tumor cells, suggesting that the cell death is apoptotic. The proapoptotic effects of Nore1 have been ascribed to the interaction of Nore1 with MST1 kinase (29) . We found that RASSF4 also binds MST-1 when the two proteins are exogenously expressed (data not shown). Thus, MST1 may also play a role in the action of RASSF4.

The RASSF1A and Nore1 tumor suppressors are frequently inactivated in human tumors by promoter methylation (17 , 18) . If loss of function of RASSF4 also plays a role in the development of human tumors, we might expect that it too would be down-regulated during tumorigenesis. COBRA showed that the promoter region of RASSF4 was subject to methylation in between 32% and 54% of the tumor cell lines and between 21% and 27% of the primary samples. Thus, the RASSF4promoter is often subjected to methylation during cellular transformation, and this is not just a phenomenon associated with in vitro cell culture. Expression analysis of RASSF4in cell lines and primary breast tumors showed that the methylation correlated with reduced expression of RASSF4. Moreover, a demethylating agent could restore RASSF4expression in several human tumor cell lines. Consequently, it appears that, like other members of the RASSF family, RASSF4is frequently down-regulated by promoter methylation in human tumor cells.

The same primary lung tumor samples analyzed for RASSF4were also examined for RASSF1Apromoter methylation (21) . No significant correlation could be determined, perhaps because the sample was not large enough. The RASSF1Apromoter is methylated in approximately 70% to 80% of primary small-cell lung cancers (SCLCs) and 30% to 34% of non–small-cell lung cancers [NSCLCs (21) ], suggesting that RASSF1Amethylation is more important for the development of SCLC than NSCLC. In contrast, the RASSF4promoter was essentially equally methylated in approximately 21% of NSLCs and SCLCs. Several of the cell lines analyzed for RASSF4expression have also been examined previously for RASSF1or Nore1expression. Although the sample is too small to draw strong conclusions, DLD-1, SKCR18, and SW48 cells are down-regulated for RASSF4 and Nore1. Furthermore, A549 and HCC1395 cells are down-regulated for RASSF4and RASSF1A(18 , 32) .

When we restored the expression of RASSF4 by transfecting a RASSF4 expression construct into RASSF4-negative tumor cells, such as MCF-7 cells, we observed a potent inhibition of growth. Thus, RASSF4 can antagonize the growth of transformed cells. However, this effect was tumor cell dependent because the human lung tumor cell line H1299 was completely resistant to RASSF4-mediated growth inhibition (data not shown). This observation may give some clues as to the mechanism of action of RASSF4 because H1299 cells (unlike MCF-7 cells) are known to be defective for p53. We are currently attempting to determine whether the biological effects of RASSF4 are p53 dependent.

The coding sequence of RASSF4was examined for potential inactivating mutations, but none were detected (data not shown). Interestingly, the gene locus of RASSF4(10p11.21) has been found to be a site of loss of heterozygosity in primary prostate tumors (33) . It is notable that primary prostate tumors have previously been shown to exhibit a high degree of RASSF1Apromoter methylation (34) . The loss of expression of RASSF4during tumorigenesis implies that, like the other RASSF family members, RASSF4plays an important role in the genesis of human tumors.

In summary, we have cloned and characterized a fourth member of the RASSF family and shown that it too exhibits the properties of a Ras effector/tumor suppressor that may play an important role in the development of human cancer.


    ACKNOWLEDGMENTS
 
We thank Holly Symonds for critical comments.


    FOOTNOTES
 
Grant support: F. Latif is supported in part by Cancer Research United Kingdom.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: RASSF4 sequence is deposited as NP_114412.2 in Genbank.

Requests for reprints: Geoffrey J. Clark, Department of Cell and Cancer Biology, National Cancer Institute, 9610 Medical Center Drive, Rockville, MD 20850-3300. Phone: 301-594-7288; Fax: 301-402-4422; E-mail: gclark{at}mail.nih.gov

Received 6/11/04. Revised 9/ 9/04. Accepted 10/ 1/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Clark GJ, Der CJ Oncogenic activation of Ras proteins Dickey BF Birnbaumer L eds. . GTPases in biology 1993259-87. Springer-Verlag Berlin, Germany
  2. Clark GJ, O’Bryan JP, Der CJ Ras signaling and transformation Gutkind JS eds. . Signaling networks and cell cycle control: the molecular basis of cancer and other diseases 1999213-27. Humana Press Inc. Totowa, NJ
  3. Malumbres M, Pellicer A RAS pathways to cell cycle control and cell transformation. Front Biosci 1998;3:d887-d912.[Medline]
  4. Rommel C, Hafen E Ras: a versatile cellular switch. Curr Opin Genet Dev 1998;8:412-8.[CrossRef][Medline]
  5. Campbell SL, Khosravi-Far R, Rossman KL, Clark GJ, Der CJ Increasing complexity of Ras signaling. Oncogene 1998;17:1395-413.[CrossRef][Medline]
  6. Shao J, Sheng H, DuBois RN, Beauchamp RD Oncogenic Ras-mediated cell growth arrest and apoptosis are associated with increased ubiquitin-dependent cyclin D1 degradation. J Biol Chem 2000;275:22916-24.[Abstract/Free Full Text]
  7. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 1997;88:593-602.[CrossRef][Medline]
  8. Chen CY, Liou J, Forman LW, Faller DV Differential regulation of discrete apoptotic pathways by Ras. J Biol Chem 1998;273:16700-9.[Abstract/Free Full Text]
  9. Joneson T, Bar-Sagi D Suppression of Ras-induced apoptosis by the Rac GTPase. Mol Cell Biol 1999;19:5892-901.[Abstract/Free Full Text]
  10. Cox AD, Der CJ The dark side of Ras: regulation of apoptosis. Oncogene 2003;22:8999-9006.[CrossRef][Medline]
  11. Feig LA, Buchsbaum RJ Cell signaling: life or death decisions of ras proteins. Curr Biol 2002;12:R259-61.[CrossRef][Medline]
  12. Vos MD, Ellis CA, Bell A, Birrer MJ, Clark GJ Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. J Biol Chem 2000;275:35669-72.[Abstract/Free Full Text]
  13. Rodriguez-Viciana P, Sabatier C, McCormick F Signaling specificity by ras family GTPases is determined by the full spectrum of effectors they regulate. Mol Cell Biol 2004;24:4943-54.[Abstract/Free Full Text]
  14. Vavvas D, Li X, Avruch J, Zhang XF Identification of Nore1 as a potential Ras effector. J Biol Chem 1998;273:5439-42.[Abstract/Free Full Text]
  15. Vos MD, Clark GJ The pro-apoptotic Ras effector Nore1 serves as a Ras-regulated tumor suppressor in the lung. J Biol Chem 2003;278:21938-43.[Abstract/Free Full Text]
  16. Vos MD, Ellis CA, Elam C, et al RASSF2 is a novel K-Ras-specific effector and potential tumor suppressor. J Biol Chem 2003;278:28045-51.[Abstract/Free Full Text]
  17. Pfeifer GP, Yoon JH, Liu L, et al Methylation of the RASSF1A gene in human cancers. Biol Chem 2002;383:907-14.[CrossRef][Medline]
  18. Hesson L, Dallol A, Minna JD, Maher ER, Latif F NORE1A, a homologue of RASSF1A tumour suppressor gene, is inactivated in human cancers. Oncogene 2003;22:947-54.[CrossRef][Medline]
  19. Dammann R, Li C, Yoon JH, et al Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet 2000;25:315-9.[CrossRef][Medline]
  20. Morgenstern JP, Land H Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;18:3587-96.[Abstract/Free Full Text]
  21. Agathanggelou A, Honorio S, Macartney DP, et al Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast and ovarian tumours. Oncogene 2001;20:1509-18.[CrossRef][Medline]
  22. Morrissey C, Martinez A, Zatyka M, et al Epigenetic inactivation of the RASSF1A 3p21.3 tumor suppressor gene in both clear cell and papillary renal cell carcinoma. Cancer Res 2001;61:7277-81.[Abstract/Free Full Text]
  23. Bieche I, Parfait B, Laurendeau I, et al Quantification of estrogen receptor alpha and beta expression in sporadic breast cancer. Oncogene 2001;20:8109-15.[CrossRef][Medline]
  24. White MA, Nicolette C, Minden A, et al Multiple Ras functions can contribute to mammalian cell transformation. Cell 1995;80:533-41.[CrossRef][Medline]
  25. Reuther GW, Buss JE, Quilliam LA, Clark GJ, Der CJ Analysis of function and regulation of proteins that mediate signal transduction by use of lipid-modified plasma membrane-targeting sequences. Methods Enzymol 2000;327:331-50.[Medline]
  26. Downward J Ras signalling and apoptosis. Curr Opin Genet Dev 1998;8:49-54.[CrossRef][Medline]
  27. Hueber AO, Evan GI Traps to catch unwary oncogenes. Trends Genet 1998;14:364-7.[CrossRef][Medline]
  28. Shivakumar L, Minna J, Sakamaki T, Pestell R, White MA The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1 accumulation. Mol Cell Biol 2002;22:4309-18.[Abstract/Free Full Text]
  29. Khokhlatchev A, Rabizadeh S, Xavier R, et al Identification of a novel Ras-regulated proapoptotic pathway. Curr Biol 2002;12:253-65.[CrossRef][Medline]
  30. Tommasi S, Dammann R, Jin SG, et al RASSF3 and NORE1: identification and cloning of two human homologues of the putative tumor suppressor gene RASSF1. Oncogene 2002;21:2713-20.[CrossRef][Medline]
  31. Scheel H, Hofmann K A novel interaction motif, SARAH, connects three classes of tumor suppressor. Curr Biol 2003;13:R899-900.[CrossRef][Medline]
  32. Burbee DG, Forgacs E, Zochbauer-Muller S, et al Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst (Bethesda) 2001;93:664-5.[Free Full Text]
  33. Dumur CI, Dechsukhum C, Ware JL, et al Genome-wide detection of LOH in prostate cancer using human SNP microarray technology. Genomics 2003;81:260-9.[CrossRef][Medline]
  34. Liu L, Yoon JH, Dammann R, Pfeifer GP Frequent hypermethylation of the RASSF1A gene in prostate cancer. Oncogene 2002;21:6835-40.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Sci SignalHome page
M. Ikeda, A. Kawata, M. Nishikawa, Y. Tateishi, M. Yamaguchi, K. Nakagawa, S. Hirabayashi, Y. Bao, S. Hidaka, Y. Hirata, et al.
Hippo Pathway-Dependent and -Independent Roles of RASSF6
Sci. Signal., September 29, 2009; 2(90): ra59 - ra59.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Klapproth, S. Sander, D. Marinkovic, B. Baumann, and T. Wirth
The IKK2/NF-{kappa}B pathway suppresses MYC-induced lymphomagenesis
Blood, September 17, 2009; 114(12): 2448 - 2458.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Maruyama, K. Akino, M. Toyota, H. Suzuki, T. Imai, M. Ohe-Toyota, E. Yamamoto, M. Nojima, T. Fujikane, Y. Sasaki, et al.
Cytoplasmic RASSF2A is a proapoptotic mediator whose expression is epigenetically silenced in gastric cancer
Carcinogenesis, July 1, 2008; 29(7): 1312 - 1318.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
V. Sherwood, R. Manbodh, C. Sheppard, and A. D. Chalmers
RASSF7 Is a Member of a New Family of RAS Association Domain-containing Proteins and Is Required for Completing Mitosis
Mol. Biol. Cell, April 1, 2008; 19(4): 1772 - 1782.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Hao, A. Chun, K. Cheung, B. Rashidi, and X. Yang
Tumor Suppressor LATS1 Is a Negative Regulator of Oncogene YAP
J. Biol. Chem., February 29, 2008; 283(9): 5496 - 5509.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Milstein, C. K. Mooser, H. Hu, M. Fejzo, D. Slamon, L. Goodglick, S. Dry, and J. Colicelli
RIN1 Is a Breast Tumor Suppressor Gene
Cancer Res., December 15, 2007; 67(24): 11510 - 11516.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Donninger, M. D. Vos, and G. J. Clark
The RASSF1A tumor suppressor
J. Cell Sci., September 15, 2007; 120(18): 3163 - 3172.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Xia, L. W. Forman, and D. V. Faller
Protein Kinase C{delta} Is Required for Survival of Cells Expressing Activated p21RAS
J. Biol. Chem., May 4, 2007; 282(18): 13199 - 13210.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Moshnikova, J. Frye, J. W. Shay, J. D. Minna, and A. V. Khokhlatchev
The Growth and Tumor Suppressor NORE1A Is a Cytoskeletal Protein That Suppresses Growth by Inhibition of the ERK Pathway
J. Biol. Chem., March 24, 2006; 281(12): 8143 - 8152.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Vos, A. Dallol, K. Eckfeld, N. P. C. Allen, H. Donninger, L. B. Hesson, D. Calvisi, F. Latif, and G. J. Clark
The RASSF1A Tumor Suppressor Activates Bax via MOAP-1
J. Biol. Chem., February 24, 2006; 281(8): 4557 - 4563.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. David, S.-Y. Sun, E. K. Waller, J. Chen, F. R. Khuri, and S. Lonial
The combination of the farnesyl transferase inhibitor lonafarnib and the proteasome inhibitor bortezomib induces synergistic apoptosis in human myeloma cells that is associated with down-regulation of p-AKT
Blood, December 15, 2005; 106(13): 4322 - 4329.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Agathanggelou, W. N. Cooper, and F. Latif
Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers
Cancer Res., May 1, 2005; 65(9): 3497 - 3508.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eckfeld, K.
Right arrow Articles by Clark, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eckfeld, K.
Right arrow Articles by Clark, G. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online