This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bentires-Alj, M. Articles by Neel, B. G. Search for Related Content PubMed PubMed Citation Articles by Bentires-Alj, M. Articles by Neel, B. G.

Activating Mutations of the Noonan Syndrome-Associated SHP2/PTPN11 Gene in Human Solid Tumors and Adult Acute Myelogenous Leukemia

¹ Cancer Biology Program, Department of Medicine, Harvard Medical School, Beth Israel Deaconess Medical Center, Boston, Massachusetts; ² Laboratory of Medical Chemistry and Human Genetics, Center for Cellular and Molecular Therapy, University of Liège, Liège, Belgium; ³ Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts; ⁴ Division of Oncology, Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania; ⁵ Department of Pathology, Brigham and Women’s Hospital, Boston, Massachusetts; ⁶ The Oncogenomics Center, Institute for Cancer Research and Treatment, University of Torino Medical School, Turin, Italy; ⁷ Department of Surgical Services, Dana-Farber Cancer Institute, Boston, Massachusetts; ⁸ Department of Surgery, Brigham and Women’s Hospital, Boston, Massachusetts; ⁹ Department of Pediatric Hematology/Oncology, Dana-Farber Cancer Institute and Children’s Hospital, Boston, Massachusetts; ¹⁰ Hamon Center for Therapeutic Oncology Research and Departments of Internal Medicine and Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas; ¹¹ Department of Pediatrics and Comprehensive Cancer Center, University of California, San Francisco, San Francisco, California; ¹² The Howard Hughes Medical Institute and the Sidney Kimmel Comprehensive Cancer Center, John Hopkins University Medical Institutions, Baltimore, Maryland; and ¹³ Department of Medicine, Harvard Medical School, Broad Institute of Harvard and Massachusetts Institute of Technology, Boston, Massachusetts

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
The SH2 domain-containing protein-tyrosine phosphatase PTPN11 (Shp2) is required for normal development and is an essential component of signaling pathways initiated by growth factors, cytokines, and extracellular matrix. In many of these pathways, Shp2 acts upstream of Ras. About 50% of patients with Noonan syndrome have germ-line PTPN11 gain of function mutations. Associations between Noonan syndrome and an increased risk of some malignancies, notably leukemia and neuroblastoma, have been reported, and recent data indicate that somatic PTPN11 mutations occur in children with sporadic juvenile myelomonocytic leukemia, myelodysplasic syndrome, B-cell acute lymphoblastic leukemia, and acute myelogenous leukemia (AML). Juvenile myelomonocytic leukemia patients without PTPN11 mutations have either homozygotic NF-1 deletion or activating RAS mutations. Given the role of Shp2 in Ras activation and the frequent mutation of RAS in human tumors, these data raise the possibility that PTPN11 mutations play a broader role in cancer. We asked whether PTPN11 mutations occur in other malignancies in which activating RAS mutations occur at low but significant frequency. Sequencing of PTPN11 from 13 different human neoplasms including breast, lung, gastric, and neuroblastoma tumors and adult AML and acute lymphoblastic leukemia revealed 11 missense mutations. Five are known mutations predicted to result in an activated form of Shp2, whereas six are new mutations. Biochemical analysis confirmed that several of the new mutations result in increased Shp2 activity. Our data demonstrate that mutations in PTPN11 occur at low frequency in several human cancers, especially neuroblastoma and AML, and suggest that Shp2 may be a novel target for antineoplastic therapy.

	Introduction

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Protein-tyrosine phosphatases (PTPs) have key positive (signal-enhancing) or negative (signal-attenuating) roles in a variety of normal signal transduction pathways. Mutations in PTPs and/or altered expression of PTPs can contribute to disease, including cancer, autoimmune disorders, inflammation, and/or developmental defects (1) . The nonreceptor PTP Shp2, encoded by the gene PTPN11, is a positive (signal-enhancing) signaling component downstream of growth factor, cytokine, and extracellular matrix receptors and plays an important role in regulating cell growth, transformation, differentiation, and migration. Genetic and biochemical analysis have established that Shp2 is required for normal Ras activation in many of these pathways (1) .

Dominant mutations in PTPN11 cause 50% of cases of the developmental disorder Noonan syndrome (NS). Furthermore, associations between NS and increased risk of malignancy, notably leukemia (2) and possibly neuroblastoma (3) , were reported in early studies. Subsequently, somatic PTPN11 mutations were found in 35% of juvenile myelomonocytic leukemias (JMMLs), 10% of childhood myelodysplasic syndromes, and at a lower incidence in other childhood hematopoietic disorders, including B-cell precursor acute lymphoblastic leukemia (7%) and acute myelogenous leukemia (AML) (4%) (4, 5, 6) .

Shp2 has two Src homology 2 domains at its NH₂ terminus (N-SH2 and C-SH2, respectively), a catalytic (PTP) domain, and a COOH terminus containing tyrosyl phosphorylation sites. In the basal state, the PTP domain is inhibited by intramolecular interaction with N-SH2. Phosphotyrosyl peptide binding to the N-SH2 domain induces a conformational change that reverses this inhibition and activates Shp2 (1 , 7) . Most PTPN11 mutations in NS and leukemia affect N-SH2 or PTP domain residues involved in basal inhibition of Shp2 (4) . The location of these mutations, the crystal structure of Shp2, our work on activated mutants of Shp2 (1) , molecular dynamic simulations (8) , and functional and biochemical analysis¹⁴ (4) suggest that NS/leukemia mutations are "activated mutants."

Nearly all JMML cases without PTPN11 mutations have either an activating RAS mutation or homozygotic inactivation of the neurofibromatosis type-1 (NF1) gene, whose protein product, neurofibromin, is a Ras-GTPase activating protein (RasGap). Given the role of Shp2 in Ras/extracellular signal-regulated kinase (ERK) activation, these findings raise the possibility that Shp2 alterations play a role in other human malignancies that have a low frequency of RAS mutations but demonstrate an activated Ras/ERK pathway (9) . Here, we screened such tumors for PTPN11 mutations.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Complementary RNA and Genomic DNA.
Generation of primary lung adenocarcinoma cRNAs was described previously (10) . Genomic DNA was extracted from previously characterized human lung cancer cell lines using standard techniques. Genomic DNA from human breast cancer specimens was obtained from the Dana-Farber/Harvard Cancer Center Breast Program Tissue Resource. Paraffin-embedded samples of human gastric cancer were obtained from the Department of Pathology at the Brigham and Women’s Hospital (Boston, MA), and DNA was purified using the QIAamp DNA extraction kit (Qiagen, Valencia, CA). Neuroblastoma DNAs were obtained from the Children’s Oncology Group Neuroblastoma Nucleic Acids Bank (Children’s Hospital of Philadelphia). DNA samples from human colon tumors were described previously (11) . DNA samples from prostate cancers were obtained from the Department of Medical Oncology at the Dana-Farber Cancer Institute (Boston, MA); AML, acute lymphoblastic leukemia (ALL), and polycythemia vera (PV) DNAs were provided by the Department of Medicine at the Brigham and Women’s Hospital, and melanoma DNAs were from the Department of Pediatric Hematology/Oncology at the Dana-Farber Cancer Institute and Children’s Hospital (Boston, MA). DNA from astrocytomas and medulloblastomas was from the Department of Cancer Biology at the Dana-Farber Cancer Institute, and glioblastoma cell lines were from the American Type Culture Collection. All studies were approved by the institutional review boards of the Beth Israel-Deaconess Medical Center and other participating institutions.

Reverse Transcription-Polymerase Chain Reaction, Genomic DNA Polymerase Chain Reaction, and DNA Sequencing.
For sequencing cRNAs, reverse transcription-polymerase chain reaction (RT-PCR) was performed using Superscript One-Step RT-PCR and the Platinum Taq kit (Life Technologies, Inc., Gaithersburg, MD), as described previously (12) . DNA amplification used M13-tagged primers against three segments of SHP2: segment 1 (first 631 bp), GTAAAACGACGGCCAGTCCTGAGCAAGGAGCGGGT (forward primer) and CAGGAAACAGCTATGACCAGGATTCTTCTTATAATGT (reverse primer); segment 2 (nucleotide 631-1277); GTAAAACGACGGCCAGTGAACTGAAATACGACGTTG (forward primer) and CAGGAAACAGCTATGACCAGTTTAAGTTCTCTTAGCG (reverse primer); and segment 3 (nucleotide 1278–1928), GTAAAACGACGGCCAGTAGTATGCTCTAAAAGAATA (forward primer) and CAGGAAACAGCTATGACCACATCTATTTCTGTGCTGAAG (reverse primer).

PTPN11 exons were amplified from genomic DNAs by polymerase chain reaction (PCR) using exon-specific primers and reamplified by nested PCR using M13-flanked primers (Table 1) . Reactions were performed in a 25-µL volume containing 5 ng of genomic DNA, 0.1 µL (0.5 unit) of Platinum Taq DNA polymerase (Life Technologies, Inc.), 1 µL of 10 µmol/L stock solution of each primer, 1 µL of 50 mmol/L MgCl₂, 0.5 µL of 10 mmol/L deoxynucleotide triphosphate mix, and 2.5 µL of 10x PCR buffer. Cycling parameters were as follows: 8 minutes at 94°C, 34 cycles of amplification consisting of 45 seconds at 94°C, 30 seconds at 60°C (exons 2, 3, 5, 10, 11, 13, 14, and 15) or 30 seconds at 57°C (exons 4, 6, 7, 8, 9, and 12) and 45 seconds at 72°C, followed by a final extension step of 72°C for 10 minutes. Amplified DNAs were sequenced by Agencourt Bioscience Corp. (Beverly, MA).

	Results and Discussion

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Genomic DNA was obtained from 65 lung cancer cell lines, 9 prostate cancer cell lines, 15 prostate tumors, 100 breast tumors, 40 gastric tumors, 189 colon tumors, 65 AMLs, 11 ALLs, 5 PVs, 10 melanomas, 9 astrocytomas, 9 glioblastomas, 9 medulloblastomas, and 89 neuroblastomas. We also analyzed cRNAs from 118 well-characterized lung tumors (10) . The whole PTPN11 coding region of 118 lung, 24 colon, and 40 gastric carcinomas was sequenced. For the remaining samples, we sequenced either exon 3 alone (165 colon cancers) or exons 2, 3, 4, 5, 7, 8, and 13, which comprise the SH2 and PTP domains (all other neoplasms). These regions were chosen for more intensive sequencing because nearly all reported associated PTPN11 mutations lie within them (2 , 4, 5, 6) .

Eleven somatic missense mutations of PTPN11 were found in these samples (Table 2) . Five of these are mutations known or predicted to result in an activated form of Shp2. Six of the mutations have not been described previously. We found an additional 87 silent nucleotide changes (Table 3) , all of which have been reported previously as single nucleotide polymorphisms (SNPs) in control individuals (2) . These changes include 81 intronic SNPs and 6 synonymous changes in exon 3.

View larger version (30K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. Distribution of known (top panel) and newly discovered (bottom panel) PTPN11 mutations in human cancer. Novel amino acid changes are in bold.

Neuroblastoma is a malignant childhood tumor of migrating neuroectodermal cells derived from neural crest and destined for the adrenal medulla and the sympathetic nervous system (15) . The clinical behavior of neuroblastomas is variable, with occasional spontaneous regression in infants and differentiation into benign ganglioneuroma in some older patients. In most cases, however, neuroblastoma is metastatic at the time of diagnosis and progresses rapidly with a lethal outcome. The mechanisms underlying this diverse behavior remain unclear. RAS mutations occur rarely in neuroblastoma, but 4 of 10 human neuroblastoma lines express little or no neurofibromin, and 2 of these lines have NF1 mutations. It will be important to determine whether PTPN11 mutation alters clinical outcome.

K-RAS mutations are found in 30% of pulmonary adenocarcinomas. Furthermore, 10% of non–small-cell lung carcinoma (NSCLC) patients have EGFR mutations (16 , 17) . Previous work revealed two B-RAF mutations in a panel of 127 primary pulmonary adenocarcinomas (12) . We sequenced 118 of these samples and found one missense variant (E76V) located within the N-SH2/PTP interface (Fig. 2B ; Table 2 ). The corresponding normal tissue lacked this change, proving that this is a bona fide tumor-associated mutation (Fig. 2A) . This tumor had no mutations in K-RAS, B-RAF, or EGFR, suggesting, as discussed below, that these mutations are largely mutually exclusive (10) . Analysis of 65 NSCLC lines revealed two additional mutations, both of which were in N-SH2: V45L (HCC1171 cells) and N58S (H661 cells; Table 2 ; Fig. 1 ). Val⁴⁵ is located in the N-SH2 domain but maps to the phosphotyrosine peptide-binding pocket rather than the N-SH2/PTP domain interface. Asn⁵⁸ is a key residue in the N-SH2/PTP interface hydrogen bonding network (1 , 7) , so N58S is probably an activating mutant. Consistent with our findings in neuroblastomas, the H661 cell line has neither BRAF nor RAS mutations (18) . HCC1171 has a G12C RAS mutation, however, suggesting that in some cases, PTPN11 mutations may collaborate with other activating mutations in the Ras/ERK pathway. Although Shp2 is clearly required for Ras/ERK activation, several studies indicate actions downstream or parallel to Ras as well (1) .

View larger version (17K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. Selected PTPN11 mutations in human tumors. DNA sequence of normal tissue (A) and in a lung adenocarcinoma (B) from the same individual, displayed with Mutation Explorer software (SoftGenetics, State College, PA). The first box contains the reference sequence chromatogram, the second box contains the forward sequence chromatograms from normal (A) or tumor (B) tissue, the third and fourth boxes contain a computed comparison between the sample and the reference displaying a peak at the observed alteration, and the fifth box contains the reverse sequence chromatograms. C, PTP assays using the artificial substrate RCM-lysozyme and purified recombinant WT Shp2, the lung adenocarcinoma mutant V45L, the AML mutant R289G, and the neuroblastoma mutants E69K and Y62C. Values are mean ± SD of triplicates. All values were normalized to WT Shp2.

In melanoma, wherein B-RAF, N-RAS, or K-RAS mutations occur in >60% of cases (19) , we found one new mutation (R138Q), located in phosphotyrosyl peptide binding pocket of the C-SH2 domain. This motif is critical for the binding of SH2 domains to tyrosine-phosphorylated residues. The corresponding normal DNA of this sample lacks this mutation, demonstrating that it is not a polymorphism. Because the C-SH2 does not make significant contact with the N-SH2/PTP domain interface, and its role in activation remains controversial, additional experiments are required to address the mechanistic significance of this mutation.

No mutations were found in astrocytoma, glioblastoma, medulloblastoma, ALL, PV, and breast, prostate, and gastric cancers. This could be explained by the low number of samples tested (glioma, PV, and ALL) and/or by the possibility that other oncogenic changes, such as ERBB2 amplification (breast cancer), can activate the Ras/ERK pathway in these tumors.

Finally, we tested the biochemical effects of several of the new PTPN11 mutations described herein. PTP assays carried out with the artificial substrate RCM-lysozyme revealed that the N-SH2 mutations V45L (3.5 X), Y62C (2.5 X), and E69K (15.5 X) all were basally activated compared with WT Shp2 (Fig. 2C) . In contrast, the PTP domain mutation R289G found in an AML patient was not activated and instead showed decreased catalytic activity in this assay. Additional studies will be required to determine whether this mutant is less stable under these conditions, whether it is activated only against some substrates (and not the artificial substrate tested here), and/or whether PTPN11 mutations can contribute to oncogenesis by mechanisms other than increased basal PTP activity. Furthermore, because we do not have DNA from the normal tissue of this patient, we cannot exclude that R289G is a rare, not previously reported SNP. Notably, V45L, which does appear to be a functionally significant PTPN11 mutation, is encoded by exon 2, which is often excluded from screens for disease-associated PTPN11 mutations. This finding, together with data indicating that T42A, a NS-associated mutant, also is enzymatically activated,¹⁴ argues for caution in interpreting negative findings from sequencing only the more commonly affected exons 3 and 13 of PTPN11.

RAS mutations are found in many human malignancies (9) . Other tumors exhibit ERK activation but have normal RAS. Such tumors can have mutations in other Ras/ERK pathway components. For example, >60% of melanomas have B-RAF mutations (19) , and >60% of colorectal cancers have either RAS or B-RAF mutations that occur in a mutually exclusive fashion (20) . Taken together, the previously described studies of childhood leukemias, the known role of Shp2 as a regulator of the Ras/ERK pathway, and the present findings provide evidence that sporadic PTPN11 mutations contribute to the pathogenesis of other human tumors. Indeed, in preliminary studies, we have found that small interfering RNA-mediated knockdown of Shp2 (WT and N58S mutant) impairs basal and EGF-induced ERK activation in H661 cells (data not shown). Further work is needed to determine the effects of selective elimination of the mutant Shp2 protein in these cells.

Although PTPN11 mutations are rare, alterations in other signaling molecules have recently been shown to have dramatic pathophysiologic significance. For example, activating EGFR mutations are also infrequent but predict clinical response of NSCLC to the EGFR inhibitor geftinib (Iressa) (16 , 17) . Thus, Shp2 may be a novel target for antineoplastic therapy, particularly in AML and neuroblastoma.

	ACKNOWLEDGMENTS

 
We thank Dr. Gordon Chan for help with the figures and the Children’s Oncology Group for providing the neuroblastoma DNAs.

	FOOTNOTES

 
Grant support: Supported by National Institutes of Health grants R01 CA49152 (B. Neel) and CA43460 (B. Vogelstein) and grants from the International Agency for Research on Cancer and European Molecular Biology Organization (M. Bentires-Alj) and partially supported by the Dana-Farber/Harvard Specialized Programs of Research Excellence in breast cancer.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: M. Bentires-Alj is a Research Assistant at the National Fund for Scientific Research (Belgium).

Requests for reprints: Mohamed Bentires-Alj, Cancer Biology Program, New Research Building 1038, 77 Louis Pasteur Avenue, Boston, MA 02215. Phone: 617-667-6889; Fax: 617-667-0610; E-mail: mbentire{at}bidmc.harvard.edu

¹⁴ H. Keilhack and B. Neel, Distinct biochemical properties of disease-associated SHP2-PTPN11 mutants, manuscript in preparation.

Received 6/ 1/04. Revised 9/29/04. Accepted 10/22/04.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 

1. Neel BG, Gu H, Pao L The "Shp"ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci 2003;28:284-93.[CrossRef][Medline]
2. Tartaglia M, Niemeyer CM, Shannon KM, Loh ML SHP-2 and myeloid malignancies. Curr Opin Hematol 2004;11:44-50.[CrossRef][Medline]
3. Cotton JL, Williams RG Noonan syndrome and neuroblastoma. Arch Pediatr Adolesc Med 1995;149:1280-1.[Abstract/Free Full Text]
4. Tartaglia M, Niemeyer CM, Fragale A, et al Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet 2003;34:148-50.[CrossRef][Medline]
5. Loh ML, Vattikuti S, Schubbert S, et al Mutations in PTPN11 implicate the SHP-2 phosphatase in leukemogenesis. Blood 2004;103:2325-31.[Abstract/Free Full Text]
6. Tartaglia M, Martinelli S, Cazzaniga G, et al Genetic evidence for lineage- and differentiation stage-related contribution of somatic PTPN11 mutations to leukemogenesis in childhood acute leukemia. Blood 2004;104:307-13.[Abstract/Free Full Text]
7. Barford D, Neel BG Revealing mechanisms for SH2 domain mediated regulation of the protein tyrosine phosphatase SHP-2. Structure 1998;6:249-54.[Medline]
8. Tartaglia M, Mehler EL, Goldberg R, et al Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat Genet 2001;29:465-8.[CrossRef][Medline]
9. Bos JL The ras gene family and human carcinogenesis. Mutat Res 1988;195:255-71.[CrossRef][Medline]
10. Bhattacharjee A, Richards WG, Staunton J, et al Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci USA 2001;98:13790-5.[Abstract/Free Full Text]
11. Bardelli A, Parsons DW, Silliman N, et al Mutational analysis of the tyrosine kinome in colorectal cancers. Science (Wash DC) 2003;300:949[Free Full Text]
12. Naoki K, Chen TH, Richards WG, Sugarbaker DJ, Meyerson M Missense mutations of the BRAF gene in human lung adenocarcinoma. Cancer Res 2002;62:7001-3.[Abstract/Free Full Text]
13. Araki T, Mohi MG, Ismat FA, et al Mouse model of Noonan syndrome reveals cell type- and gene dosage-dependent effects of Ptpn11 mutation. Nat Med 2004;10:849-57.[CrossRef][Medline]
14. Musante L, Kehl HG, Majewski F, et al Spectrum of mutations in PTPN11 and genotype-phenotype correlation in 96 patients with Noonan syndrome and five patients with cardio-facio-cutaneous syndrome. Eur J Hum Genet 2003;11:201-6.[CrossRef][Medline]
15. Maris JM, Matthay KK Molecular biology of neuroblastoma. J Clin Oncol 1999;17:2264-79.[Abstract/Free Full Text]
16. Lynch TJ, Bell DW, Sordella R, et al Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129-39.[Abstract/Free Full Text]
17. Paez JG, Janne PA, Lee JC, et al EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science (Wash DC) 2004;304:1497-500.[Abstract/Free Full Text]
18. Davies H, Bignell GR, Cox C, et al Mutations of the BRAF gene in human cancer. Nature (Lond) 2002;417:949-54.[CrossRef][Medline]
19. Brose MS, Volpe P, Feldman M, et al BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res 2002;62:6997-7000.[Abstract/Free Full Text]
20. Rajagopalan H, Bardelli A, Lengauer C, et al Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature (Lond) 2002;418:934[CrossRef][Medline]

This article has been cited by other articles:

				Y. Y. Teo, A. E. Fry, K. Bhattacharya, K. S. Small, D. P. Kwiatkowski, and T. G. Clark Genome-wide comparisons of variation in linkage disequilibrium Genome Res., October 1, 2009; 19(10): 1849 - 1860. [Abstract] [Full Text] [PDF]

				H. Lu, N. Murata-Kamiya, Y. Saito, and M. Hatakeyama Role of Partitioning-defective 1/Microtubule Affinity-regulating Kinases in the Morphogenetic Activity of Helicobacter pylori CagA J. Biol. Chem., August 21, 2009; 284(34): 23024 - 23036. [Abstract] [Full Text] [PDF]

				H. Wang, S. Lindsey, I. Konieczna, L. Bei, E. Horvath, W. Huang, G. Saberwal, and E. A. Eklund Constitutively Active SHP2 Cooperates with HoxA10 Overexpression to Induce Acute Myeloid Leukemia J. Biol. Chem., January 23, 2009; 284(4): 2549 - 2567. [Abstract] [Full Text] [PDF]

				S. Wang, W.-M. Yu, W. Zhang, K. R. McCrae, B. G. Neel, and C.-K. Qu Noonan Syndrome/Leukemia-associated Gain-of-function Mutations in SHP-2 Phosphatase (PTPN11) Enhance Cell Migration and Angiogenesis J. Biol. Chem., January 9, 2009; 284(2): 913 - 920. [Abstract] [Full Text] [PDF]

				S. Mitra, C. Beach, G.-S. Feng, and R. Plattner SHP-2 is a novel target of Abl kinases during cell proliferation J. Cell Sci., October 15, 2008; 121(20): 3335 - 3346. [Abstract] [Full Text] [PDF]

				M. Case, E. Matheson, L. Minto, R. Hassan, C. J. Harrison, N. Bown, S. Bailey, J. Vormoor, A. G. Hall, and J. A.E. Irving Mutation of Genes Affecting the RAS Pathway Is Common in Childhood Acute Lymphoblastic Leukemia Cancer Res., August 15, 2008; 68(16): 6803 - 6809. [Abstract] [Full Text] [PDF]

				S. Eminaga and A. M. Bennett Noonan Syndrome-associated SHP-2/Ptpn11 Mutants Enhance SIRP{alpha} and PZR Tyrosyl Phosphorylation and Promote Adhesion-mediated ERK Activation J. Biol. Chem., May 30, 2008; 283(22): 15328 - 15338. [Abstract] [Full Text] [PDF]

				K. Hellmuth, S. Grosskopf, C. T. Lum, M. Wurtele, N. Roder, J. P. von Kries, M. Rosario, J. Rademann, and W. Birchmeier Specific inhibitors of the protein tyrosine phosphatase Shp2 identified by high-throughput docking PNAS, May 20, 2008; 105(20): 7275 - 7280. [Abstract] [Full Text] [PDF]

				C. Zhu, S. Lindsey, I. Konieczna, and E. A. Eklund Constitutive activation of SHP2 protein tyrosine phosphatase inhibits ICSBP-induced transcription of the gene encoding gp91PHOX during myeloid differentiation J. Leukoc. Biol., March 1, 2008; 83(3): 680 - 691. [Abstract] [Full Text] [PDF]

				N. Ohnishi, H. Yuasa, S. Tanaka, H. Sawa, M. Miura, A. Matsui, H. Higashi, M. Musashi, K. Iwabuchi, M. Suzuki, et al. Transgenic expression of Helicobacter pylori CagA induces gastrointestinal and hematopoietic neoplasms in mouse PNAS, January 22, 2008; 105(3): 1003 - 1008. [Abstract] [Full Text] [PDF]

				Y. Ren, Z. Chen, L. Chen, N. T. Woods, G. W. Reuther, J. Q. Cheng, H.-g. Wang, and J. Wu Shp2E76K Mutant Confers Cytokine-independent Survival of TF-1 Myeloid Cells by Up-regulating Bcl-XL J. Biol. Chem., December 14, 2007; 282(50): 36463 - 36473. [Abstract] [Full Text] [PDF]

				Y. Wang Mitogen-Activated Protein Kinases in Heart Development and Diseases Circulation, September 18, 2007; 116(12): 1413 - 1423. [Abstract] [Full Text] [PDF]

				M. Rosario, R. Franke, C. Bednarski, and W. Birchmeier The neurite outgrowth multiadaptor RhoGAP, NOMA-GAP, regulates neurite extension through SHP2 and Cdc42 J. Cell Biol., July 24, 2007; 178(3): 503 - 516. [Abstract] [Full Text] [PDF]

				K. Modzelewska, M. G. Elgort, J. Huang, G. Jongeward, A. Lauritzen, C. H. Yoon, P. W. Sternberg, and N. Moghal An Activating Mutation in sos-1 Identifies Its Dbl Domain as a Critical Inhibitor of the Epidermal Growth Factor Receptor Pathway during Caenorhabditis elegans Vulval Development Mol. Cell. Biol., May 15, 2007; 27(10): 3695 - 3707. [Abstract] [Full Text] [PDF]

				W. Huang, E. Horvath, and E. A. Eklund PU.1, Interferon Regulatory Factor (IRF) 2, and the Interferon Consensus Sequence-binding Protein (ICSBP/IRF8) Cooperate to Activate NF1 Transcription in Differentiating Myeloid Cells J. Biol. Chem., March 2, 2007; 282(9): 6629 - 6643. [Abstract] [Full Text] [PDF]

				R. J. Chan and G.-S. Feng PTPN11 is the first identified proto-oncogene that encodes a tyrosine phosphatase Blood, February 1, 2007; 109(3): 862 - 867. [Abstract] [Full Text] [PDF]

				J. Chen, W.-M. Yu, H. Daino, H. E. Broxmeyer, B. J. Druker, and C.-K. Qu SHP-2 phosphatase is required for hematopoietic cell transformation by Bcr-Abl Blood, January 15, 2007; 109(2): 778 - 785. [Abstract] [Full Text] [PDF]

				A. Bertotti, P. M. Comoglio, and L. Trusolino {beta}4 integrin activates a Shp2-Src signaling pathway that sustains HGF-induced anchorage-independent growth J. Cell Biol., December 18, 2006; 175(6): 993 - 1003. [Abstract] [Full Text] [PDF]

				S. Ren, H. Higashi, H. Lu, T. Azuma, and M. Hatakeyama Structural Basis and Functional Consequence of Helicobacter pylori CagA Multimerization in Cells J. Biol. Chem., October 27, 2006; 281(43): 32344 - 32352. [Abstract] [Full Text] [PDF]

				W. Huang, G. Saberwal, E. Horvath, C. Zhu, S. Lindsey, and E. A. Eklund Leukemia-Associated, Constitutively Active Mutants of SHP2 Protein Tyrosine Phosphatase Inhibit NF1 Transcriptional Activation by the Interferon Consensus Sequence Binding Protein. Mol. Cell. Biol., September 1, 2006; 26(17): 6311 - 6332. [Abstract] [Full Text] [PDF]

				E. Heiss, K. Masson, C. Sundberg, M. Pedersen, J. Sun, S. Bengtsson, and L. Ronnstrand Identification of Y589 and Y599 in the juxtamembrane domain of Flt3 as ligand-induced autophosphorylation sites involved in binding of Src family kinases and the protein tyrosine phosphatase SHP2 Blood, September 1, 2006; 108(5): 1542 - 1550. [Abstract] [Full Text] [PDF]

				N. Wang, Z. Li, R. Ding, G. D. Frank, T. Senbonmatsu, E. J. Landon, T. Inagami, and Z. J. Zhao Antagonism or Synergism: ROLE OF TYROSINE PHOSPHATASES SHP-1 AND SHP-2 IN GROWTH FACTOR SIGNALING J. Biol. Chem., August 4, 2006; 281(31): 21878 - 21883. [Abstract] [Full Text] [PDF]

				A. Charest, E. W. Wilker, M. E. McLaughlin, K. Lane, R. Gowda, S. Coven, K. McMahon, S. Kovach, Y. Feng, M. B. Yaffe, et al. ROS Fusion Tyrosine Kinase Activates a SH2 Domain-Containing Phosphatase-2/Phosphatidylinositol 3-Kinase/Mammalian Target of Rapamycin Signaling Axis to Form Glioblastoma in Mice. Cancer Res., August 1, 2006; 66(15): 7473 - 7481. [Abstract] [Full Text] [PDF]

				A. L. Brown, C. R. Wilkinson, S. R. Waterman, C. H. Kok, D. G. Salerno, S. M. Diakiw, B. Reynolds, H. S. Scott, A. Tsykin, G. F. Glonek, et al. Genetic regulators of myelopoiesis and leukemic signaling identified by gene profiling and linear modeling J. Leukoc. Biol., August 1, 2006; 80(2): 433 - 447. [Abstract] [Full Text] [PDF]

				L. Chen, S.-S. Sung, M. L. R. Yip, H. R. Lawrence, Y. Ren, W. C. Guida, S. M. Sebti, N. J. Lawrence, and J. Wu Discovery of a Novel Shp2 Protein Tyrosine Phosphatase Inhibitor Mol. Pharmacol., August 1, 2006; 70(2): 562 - 570. [Abstract] [Full Text] [PDF]

				M. Scherr, A. Chaturvedi, K. Battmer, I. Dallmann, B. Schultheis, A. Ganser, and M. Eder Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML) Blood, April 15, 2006; 107(8): 3279 - 3287. [Abstract] [Full Text] [PDF]

				M. I. Kontaridis, K. D. Swanson, F. S. David, D. Barford, and B. G. Neel PTPN11 (Shp2) Mutations in LEOPARD Syndrome Have Dominant Negative, Not Activating, Effects J. Biol. Chem., March 10, 2006; 281(10): 6785 - 6792. [Abstract] [Full Text] [PDF]

				W.-M. Yu, H. Daino, J. Chen, K. D. Bunting, and C.-K. Qu Effects of a Leukemia-associated Gain-of-Function Mutation of SHP-2 Phosphatase on Interleukin-3 Signaling J. Biol. Chem., March 3, 2006; 281(9): 5426 - 5434. [Abstract] [Full Text] [PDF]

				K. Oishi, K. Gaengel, S. Krishnamoorthy, K. Kamiya, I.-K. Kim, H. Ying, U. Weber, L. A. Perkins, M. Tartaglia, M. Mlodzik, et al. Transgenic Drosophila models of Noonan syndrome causing PTPN11 gain-of-function mutations Hum. Mol. Genet., February 15, 2006; 15(4): 543 - 553. [Abstract] [Full Text] [PDF]

				T. Brummer, D. Schramek, V. M. Hayes, H. L. Bennett, C. E. Caldon, E. A. Musgrove, and R. J. Daly Increased Proliferation and Altered Growth Factor Dependence of Human Mammary Epithelial Cells Overexpressing the Gab2 Docking Protein J. Biol. Chem., January 6, 2006; 281(1): 626 - 637. [Abstract] [Full Text] [PDF]

				L. Yuan, W.-M. Yu, M. Xu, and C.-K. Qu SHP-2 Phosphatase Regulates DNA Damage-induced Apoptosis and G2/M Arrest in Catalytically Dependent and Independent Manners, Respectively J. Biol. Chem., December 30, 2005; 280(52): 42701 - 42706. [Abstract] [Full Text] [PDF]

				R. Xu, Y. Yu, S. Zheng, X. Zhao, Q. Dong, Z. He, Y. Liang, Q. Lu, Y. Fang, X. Gan, et al. Overexpression of Shp2 tyrosine phosphatase is implicated in leukemogenesis in adult human leukemia Blood, November 1, 2005; 106(9): 3142 - 3149. [Abstract] [Full Text] [PDF]

				C. P. Kratz, C. M. Niemeyer, R. P. Castleberry, M. Cetin, E. Bergstrasser, P. D. Emanuel, H. Hasle, G. Kardos, C. Klein, S. Kojima, et al. The mutational spectrum of PTPN11 in juvenile myelomonocytic leukemia and Noonan syndrome/myeloproliferative disease Blood, September 15, 2005; 106(6): 2183 - 2185. [Abstract] [Full Text] [PDF]

				S. Frohling, C. Scholl, D. G. Gilliland, and R. L. Levine Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications J. Clin. Oncol., September 10, 2005; 23(26): 6285 - 6295. [Abstract] [Full Text] [PDF]

				H. Keilhack, F. S. David, M. McGregor, L. C. Cantley, and B. G. Neel Diverse Biochemical Properties of Shp2 Mutants: IMPLICATIONS FOR DISEASE PHENOTYPES J. Biol. Chem., September 2, 2005; 280(35): 30984 - 30993. [Abstract] [Full Text] [PDF]

				K. Yokoyama, H. Higashi, S. Ishikawa, Y. Fujii, S. Kondo, H. Kato, T. Azuma, A. Wada, T. Hirayama, H. Aburatani, et al. Functional antagonism between Helicobacter pylori CagA and vacuolating toxin VacA in control of the NFAT signaling pathway in gastric epithelial cells PNAS, July 5, 2005; 102(27): 9661 - 9666. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bentires-Alj, M. Articles by Neel, B. G. Search for Related Content PubMed PubMed Citation Articles by Bentires-Alj, M. Articles by Neel, B. G.