| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Department of Surgical Oncology, University of Illinois at Chicago, and 2 Department of Internal Medicine, Rush University Medical Center, Chicago, Illinois; and 3 Department of Obstetrics and Gynecology, Kobe University School of Medicine, Kobe, Japan
| ABSTRACT |
|---|
|
|
|---|
, ß, and
), RARß has been considered a tumor suppressor gene. Here, we identified a novel RARß isoform-RARß5 in breast epithelial cells, which could play a negative role in RARß signaling. Similar to RARß2, the first exon (59 bp) of RARß5 is RARß5 isoform specific, whereas the other exons are common to all of the RARß isoforms. The first exon of RARß5 does not contain any translation start codon, and therefore its protein translation begins at an internal methionine codon of RARß2, lacking the A, B, and part of C domain of RARß2. RARß5 protein was preferentially expressed in estrogen receptor-negative breast cancer cells and normal breast epithelial cells that are relatively resistant to retinoids, whereas estrogen receptor-positive cells that did not express detectable RARß5 protein were sensitive to retinoid treatment, suggesting that this isoform may affect the cellular response to retinoids. RARß5 isoform is unique among all of the RARs, because a corresponding isoform was not detectable for either RAR
or RAR
. RARß5 mRNA was variably expressed in normal and cancerous breast epithelial cells. Its transcription was under the control of a distinct promoter P3, which can be activated by all-trans-retinoic acid (atRA) and other RAR/RXR selective retinoids in MCF-7 and T47D breast cancer cells. We mapped the RARß5 promoter and found a region -302/-99 to be the target region of atRA. In conclusion, we identified and initially characterized RARß5 in normal, premalignant, and malignant breast epithelial cells. RARß5 may serve as a potential target of retinoids in prevention and therapy studies. | INTRODUCTION |
|---|
|
|
|---|
, ß,
; refs. 1
, 2
). In addition, each RAR gene generates multiple isoforms by either alternative splicing or differential usage of two promoters (1
, 2)
. RARs/RXRs belong to the superfamily of nuclear receptors that mediate the transcriptional effects of steroid hormones, vitamin D, and thyroid hormone (3)
. RARs preferentially dimerize with RXRs to form RAR-RXR heterodimers that are thought to be obligatory intermediates in the effects of RAR ligands on gene expression (4)
. RXRs also can homodimerize to form transcriptionally active complexes (5)
. Homo- and heterodimeric retinoid receptor complexes bind to distinct retinoid response elements embedded in the regulatory regions of retinoid-responsive genes (6)
. Although there is considerable variability in the sequence and structure of the retinoid response elements in retinoid-regulated genes, they conform to a general canonical sequence in which two directly repeated receptor-binding hexanucleotide motifs [consensus (A/G)G(G/T)TCA] are separated by a variable number of intervening nucleotides (6)
. RARß itself is a retinoid target gene and believed to play a role as a tumor suppressor gene in tumorigenesis (7) . The human RARß gene was first identified from hepatocellular carcinoma in 1987 (8) , followed by the identification of retinoic acid response element (RARE) in its promoter region (9) . In the mice, the RARß gene generates four distinct transcripts: splice variants RARß1 and RARß3 from transcription at promoter P1, and RARß2 and RARß4 from the RARE-containing P2 promoter (2 , 10) . In the human, only RARß2 and RARß4 transcripts have been identified in normal adult cells (11) . Human RARß1 is expressed in fetal tissues and some small cell lung carcinoma cell lines (12) ; whereas a human homologue of the RARß3 isoform has not been detected (7) . The RARß2 and RARß4 transcripts differ only in the content of their 5'-most exon, a result of alternative splicing (10) . On the basis of homology with other members of the steroid hormone receptor superfamily, six distinct domains (AF) have been identified within RARs and RXRs (2) . Thus far, all of the identified RAR isoforms are only different at their unique A domain and are derived from two promoters and alternative splicing (11) . Isoforms of a given RAR gene generally contain identical protein sequences BF (11) .
Weve been interested in RAR/RXR alteration in the process of breast tumor progression with a MCF10 model (13) . During the characterization of RARß expression in the MCF10 series of cell lines (benign MCF10A, premalignant MCF10AT, and malignant MCF10CA1a cell lines; ref. 14 ), we identified a novel RARß isoform, which we named RARß5. RARß5 mRNA expression is under the control of a distinct promoter P3 and is mediated by all-trans-retinoic acid (atRA) and other RAR/RXR selective ligands in breast cancer cells. It was detected in both normal and breast cancer cells. We also cloned and initially characterized the promoter region of RARß5. The same protein isoform was previously associated with RARß4 transcript (11 , 15) and then termed RARß' (7) . In this study, we have identified RARß5 at both gene and protein level.
| MATERIALS AND METHODS |
|---|
|
|
|---|
/ß selective ligand) was a generous gift from Dr. Koichi Shudo (ITSUU Laboratory, Tokyo, Japan).
Rapid Amplification of cDNA 5'-Ends and cDNA Cloning.
Rapid amplification of cDNA 5'-ends (5'-RACE) was done with SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA) according to the User Manual. RACE PCR was done with a Universal Primer and two RARß2 gene-specific reverse primers located at 1754 bp (RARß2-1754RP, GGACTGTGCTCTGCTGTGTTCCCACTT) and 1216 bp (RARß2-1216RP, GGTCTGCGATGGTCAAGCCAGTGAA) 3' of the RARß2 transcription site. PCR products were cloned into pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced with ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA).
Reverse Transcription-PCR.
RT was done in a final volume of 20 µL with 2 µg total RNA and 100 units of MuLV reverse transcriptase (Invitrogen) at 42°C for 50 minutes. Conventional PCR was mainly used to qualitatively detect gene expression. PCR was done with 1 µL RT product with PCR Supermix (Invitrogen). PCR primer pairs are RARß2 (475FP, GACTGTATGGATGTTCTGTCAG; and 730RP, ATTTGTCCTGGCAGACGAAGCA) and RARß5 (14FP, CTGGAAGGTCGTACACAGTGA; and 343RP, GGACATTCCCACTTC-AAAGC). ß-actin (FP, GTCACCAACTGGGACGACA; and RP, TGGCCATCTCTTGC-TCGAA) was used as an internal control. Real-time PCR was done with 1 µL RT product with 7900HT Sequence Detection System (ABI, Applied Biosystems) and ABI 2 x SYBR Green PCR Master Mix (ABI# 4309155) according to recommended guidelines of ABI. Primer pairs for real-time PCR were RARß2 (584FP, GATTGACCCAAACCGAATGGCAGCA; and 730RP) and RARß5 (15FP, GGAAGGT-CGTACACAGTGAATTTCTCTGAG; and RARß2-730RP); real-time PCR data were analyzed with a software package (ABI Prizm SDS2.1) provided with the instrumentation system.
Expression Vector and In vitro Translation.
The RARß5 expression vector was generated by PCR-cloning with pcDNA3.1/V5-His TOPO TA Expression Kit (Invitrogen). The open reading frame (ORF) of RARß5 was isolated by PCR of 5'-RACE cDNA from MDA-MB435 cells with primers containing RARß5 start and stop codon (RARß5-start, CAGAAGAATATGATTTACACTTGTCACCG; and RARß5-stop, GTCTTATTGCACGA-GTGGTGACTG). RARß2 expression vector pTag (RARß2 ß'-; RARß2 with a mutation to knockout a downstream translation start site) was a generous gift from Dr. Karen Swisshelm (Department of Pathology, University of Washington, Seattle, WA; ref. 11
). RARß2 insert was cut from pTag (RARß2 ß'-) and ligated into the BamH1 sites of pcDNA3.1 vector (Invitrogen) to generate RARß2 expression vector-pcDNA3.1(RARß2). The pcDNA3.1(RARß2) was used for both in vitro translation to generate RARß2 protein as positive control for Western blot and cotransfection to test the effects of RARß2 expression on RARß5 promoter activity. In vitro translation was done with TNT Quick Coupled Translation kit (Promega, Madison, WI).
Western Blot.
When cells grew to 50 to 70% confluence, cell lysates were prepared and subjected to Western blot analysis as described previously (17)
. Two antibodies were used to detect RARß isoforms, one recognizing amino acids 430-447 in the COOH-terminus of RARß2 (sc-552, Santa Cruz Biotechnology Inc., Santa Cruz, CA), the other one recognizing amino acids 407-423 in the COOH-terminus of RARß2 (Geneka Biotechnology Inc., Montreal, Quebec). Another two antibodies recognizing COOH-terminus of RAR
(sc-551, Santa Cruz Biotechnology Inc.) and RAR
(sc-550, Santa Cruz Biotechnology Inc.) were used to detect RAR
and RAR
isoforms.
The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide Assay for Cell Growth.
Cell proliferation was examined by colorimetric [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; MTT] assay. MTT is a pale yellow substrate that is cleaved by living cells to yield a dark blue formazan product. This process requires active mitochondria, and even freshly dead cells do not cleave substantial amounts of MTT. Briefly, cells (500 cells per well) were seeded in 96-well plates and cultured overnight. Then cells were incubated with 1 µmol/L retinoids, and the media were changed every second day. After 7-day treatment, 0.01 mL of MTT solution (5 mg/mL) was added to each well, mixed gently, and incubated with the cells at 37°C for 2 to 3 hours. The media were carefully removed, 0.1 mL of DMSO was added to each well, and plates were assayed for cell proliferation as described previously (18)
.
RARß5 Promoter-Luciferase Reporter Plasmids.
The 1-kb 5' flanking region (P-1000/+33 relative to the transcription start site) of RARß5 was first isolated by PCR from genomic DNA extracted from MDA-MB435 breast cancer cells with Advantage 2 PCR kit (Clontech). Primer pairs were designed to contain a Kpn restriction site at the 5' end of the forward primer and a Xho restriction site at the 5' end of the reverse primer. The PCR product was first cloned to the pCR4-TOPO vector, and then subcloned to the Kpn/Xho sites of the promoterless PGL3 basic vector (Promega). Orientation and sequence of all of the constructs were verified by direct sequencing. All of the other promoter deletion mutation constructs (P-428/+33, 323/+33, 302/+33, 177/+33, 99/+33) were cloned in the same way with PGL3-P-1000/+33 as a template.
Cell Transfections and Luciferase Assay.
MCF-7 and T47D cells were plated at 1 to 1.2 x 105 cells per well in 12-well plates. After overnight incubation, the media were replaced by MEM containing 2% fetal bovine serum. Transient transfection was done in the same media with Lipofectamine 2000 (Invitrogen). Cells were transfected with 0.5 µg/well promoter constructs (0.5 µg/well for PGL3-P-1000/+33, the amount of other deletion mutants was correspondingly adjusted to make each well contain the same amount of the plasmids) with or without 0.5 µg/well pcDNA3.1 empty vector or 0.64 µg/well pcDNA3.1(RARß2) expression vector. A 20 ng/well pCMVßgal vector (Clontech) was cotransfected as an internal control for transfection efficiency. After 5 hours incubation, the medium was replaced with a fresh one containing 1 µmol/L atRA or other retinoids or DMSO (solvent control, 1 µL/10 mL media), and cells were incubated for an additional 24 hours. Luciferase and ß-galactosidase activities were assayed with Luciferase Reporter Assay Kit and Luminescent ß-gal detection kit II (Clontech).
| RESULTS |
|---|
|
|
|---|
1.8 kb and
1.3 kb, respectively, but did consistently detect a band with a smaller size (
0.6 kb shorter). The 5'-RACE product was cloned and sequenced. The Blast search of GenBank suggests it to be a novel RARß isoform that has not yet been reported, henceforth it is referred to as RARß5. The 5' end sequence of RARß5 cDNA is presented in Fig. 1B
29.4 kb downstream of the first exon (exon 5) of RARß2 and
2.8 kb upstream of the second exon of RARß2. Therefore, this novel exon is numbered exon 6, and numeration for the downstream exons is updated from what was reported previously (ref. 11
; Fig. 1C
37 kDa (Fig. 1C)
|
selective ligand) and LGD1069 (RXR selective ligand) also significantly up-regulated RARß5 expression, whereas 4-HPR (a weak RAR
ligand) and 9-cisRA (RAR/RXR ligand) had relatively low efficacy in mediating RARß5 expression (Fig. 2C)
|
37 kDa) was detected in HMEC, MDA-MB231, BCA-2, MCF10A, and MCF10AT cells by both antibodies (Fig. 3, A and B)
55 kDa) was only detected from the in vitro translation product (Fig. 3D)
37 kDa protein detected in this study could be identical to the RARß protein isoform (termed RARß4,
40 kDa) identified previously in breast cancer cells (11)
, because same antibody was used for the detection, and the molecular size is also very close considering the 10% margin of error for our molecular mass standards. This RARß protein isoform seemed to be preferentially expressed in ER-negative normal and cancerous breast epithelial cells, but it was not detectable in ER-positive breast cancer line MCF-7 and T47D.
|
Sequence Analysis of 5' Flanking Region of RARß5.
Although the RARß5 regulation pattern by atRA was more or less similar to that of RARß2, in some cells such as BCA-2 and BCA-8, MCF-7 and T47D, the expression pattern was significantly different. Sequence alignment showed that the first exon of RARß5 is far away (
30 kb) from the P2 promoter, suggesting that RARß5 and RARß2 use different promoters. Therefore, we cloned and sequenced the 1-kb 5' flanking region of RARß5. Fig. 4
shows the 480-bp 5' flanking sequence of RARß5. The 5' flanking sequence (1000/59) of RARß5 was analyzed with several promoter identification programs including Proscan (21)
, Promoter 2.0 (22)
, BDGP: Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter (http://genes.mit.edu/McPromoter.html), PromoterInspector (http://www.genomatix.de/). None of these programs was able to predict this promoter. The region close to the putative transcription start site lacks the canonical TATA and CCAAT boxes, but a TATA-like box (TATAATT) is present 42 bp upstream of the transcription start site. Additional analysis with MatInspector (23)
and TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH. html) identified DNA binding sites for AP-1, GATA, SRY, CEBP/ß, NFAT, OCT1, and so forth at the region 500/+1 (Fig. 4)
. In addition, Promo (24)
identified a binding site for RXR
at 312 bp upstream of the transcription start site. However, these are the potential binding sites, and tests for functionality need to be done to confirm their importance.
|
|
|
We also examined RARß5 promoter activity in the presence of other RAR/RXR selective ligands in both MCF-7 and T47D cells. As shown in Fig. 6, A and B
, all of the tested RAR/RXR selective ligands differentially increased RARß5 promoter activity, whereas Am80 showed the highest efficacy. These data also confirmed our RT-PCR analysis (Fig. 2C)
.
|
and RAR
, because a similar internal start codon is present in both RAR
and RAR
at similar positions. In addition, we also observed a similar protein band at the position of
37 kDa in MCF-7 and MDA-MB231 cells through Western blot analysis with RAR
- and RAR
-specific antibodies that are not cross-reactive with each other and recognize the COOH-terminus of the corresponding RAR isoform. Therefore, we first 5'-RACEanalyzed the mRNA extracted from MCF-7 and MDA-MB231 cells with RAR
-specific primers but failed to detect any expected cDNA band with a smaller size corresponding to the putative truncated RAR
. Only a single RAR
band of an expected size corresponding to full-length RAR
was detected (data not shown). Because these receptor isoforms degrade quickly, we therefore hypothesized that the observed protein band of low molecular size for RAR
and RAR
might be a fragment generated from protease cleavage. We used cell permeable proteasome inhibitor MG132, which can inhibit the degradation of RAR
and RAR
(25)
. MG132 treatment completely blocked the generation of this fragment (Fig. 7)
and RAR
. The biochemical and biological properties of these RAR
and RAR
fragments are not clear at present. When cells were treated with MG132, a corresponding equivalent band of RARß5 was observed. Whether the expression of RARß5 protein is because of inhibition of protein degradation or induction by MG132 treatment still needs additional in-depth studies.
|
degradation in both cell lines as observed in MCF-7 cells (25)
.
Genomic Structure of RARß5 in Comparison to RARß2.
On the basis of the identified RARß5 cDNA sequence, the known RARß2 sequence, and the published Human Genome Project Data (http://www.ncbi.nlm.nih.gov/genome/guide/human/), we were able to elucidate the complex organization of the RARß5 and RARß2 genes. BLAST search permitted us to align the first three exons of RARß5 to a 70560-bp BAC clone RP11-421F9 (GenBank accession no. AC133141) mapped to chromosome 3p24. Similarly, the remaining exons were precisely aligned within another 189308-bp BAC clone RP11-659P16 (GenBank accession no. AC093416). Then the first exon of RARß2 was aligned within the 198468-bp BAC clone RP11-733H11 (GenBank accession no. AC098477). Additional alignment of these three clones showed a 4145-bp overlap between clones RP11-733H11 and RP11-421F9 and a1862-bp overlap between clones RP11-421F9 and RP-659P16 (Fig 8B)
, showing the continuity of the gene sequence in these BAC clones. An analysis of these three BAC clones revealed that the RARß5 gene spans over 130-kb of DNA, whereas the RARß2 gene spans over 160 kb of DNA. All of the splice junctions conform to the GT/AG rule for splice donor and acceptor sites (ref. 26
; Fig. 8A
). Fig. 8B
summarizes our analysis on the genomic structures of hRARß5 and hRARß2 genes, and a new numeration for their exons is proposed herewith.
|
| DISCUSSION |
|---|
|
|
|---|
In this study, we identified RARß5, a novel RARß isoform directed by a distinct promoter P3. We also provided the first evidence showing that RARß5 protein is identical to RARß4 or RARß', a previously identified truncated RARß protein (7 , 11) . In 1999, Sommer et al. (11) identified a 40 kDa RARß protein isoform, which was interpreted as RARß4. This RARß protein isoform was found to be elevated in human breast tumor cells, especially in cytoplasm relative to RARß2 protein. In 2002, Chen et al. (7) showed an antagonistic role for this RARß protein isoform in signaling by retinoic acid and termed it RARß', and its expression was interpreted as "leaky scanning." In the same year, another group (15) showed that the expression of this protein isoform is associated with cellular resistance in response to retinoids. They also interpreted it as RARß4 and tried to link the protein expression to RARß4 mRNA expression. These data seemed correct, but the interpretation on the generation of that RARß (RARß4 or RARß') protein isoform seems questionable. There has been no evidence showing that the protein isoform is translated from endogenous RARß2 or RARß4 transcripts. The interpretation on the generation of that RARß protein isoform was based on transfection and in vitro translation experiments, in which the expression vectors generally do not contain full-length 5' and 3'UTR, and the reporter genes are not in a natural chromatin environment. In addition, the existence of multiple uORFs in the long 5'UTR region of RARß2 and RARß4 could also inhibit leaky scanning (30) . Some cells such as MCF10A series of cell lines do not express detectable RARß4 mRNA,5 the same protein isoform could only be from RARß5 transcript in these cells. The identification of RARß5 in breast epithelial cells suggests that RARß' is the primary translation product from ORF of RARß5 transcript. Should leaky scanning occur with RARß2 or RARß4, it might result in RARß' at a very low level (30 , 31) . Moreover, the existence of multiple uORFs and the long leader sequence in RARß isoform mRNAs could be a signal that their translations are under tight control.
In most of the previous studies, measurements of RARß expression are preferentially made at the mRNA levels (25)
, leading to certain level of complexity in understanding its function. All the more, in most of breast cancer cell lines, RARß2 protein was not detected by Western blotting, although its mRNA was detectable (Fig. 2)
. We have carried out experiments to address these concerns to a certain extent and to study the expression of RARß5 both at the RNA and protein levels in various patient-derived primary breast cancer cells, established breast cancer cell lines, and immortalized benign MCF10A, premalignant MCF10AT cell lines, and normal human breast epithelial cells. At the mRNA level, RARß5 is expressed in normal human breast epithelial cells as well as in benign, premalignant, and tumor cell lines. In the presence of atRA, the level of RARß2 mRNA is preferentially elevated in contrast to RARß5 in T47D cells. At the protein level, we failed to detect endogenous RARß2 protein by Western blotting but did detect a corresponding RARß5 band in MDA-MB231 and HMEC cells. In agreement with our studies, Tanaka et al. (25)
also failed to detect RARß2 protein under their experimental conditions. Hence, either RARß2 protein is not stable, or its expression is too low to be detected in these cells.
RARß5 identification also defines a new type of RARß isoform, which is under the control of a distinct promoter P3, and the protein lacks the A, B, and part of the C domain (the first zinc finger) of other RARß isoforms. The loss of DNA binding ability while retaining the capability to form heterodimers with RXR makes RARß5 act as a trans-dominantnegative regulator of RARß function (7)
. We note in this respect that similarly truncated RAR
isoforms lacking all of the sequence located NH2-terminal to the second zinc finger have been identified previously (32)
. Most analogous to RARß5 is the progesterone C mRNA that encodes a NH2-terminally truncated progesterone receptor (33
, 34)
. RARß5 protein expression, localization, and function were characterized previously as a truncated RARß protein isoform (7
, 11
, 15)
. Unlike some other reported dominant-negative nuclear receptors (35
, 36)
, RARß5 does not bind cis-acting DNA elements and therefore cannot directly inactivate gene transcription. RARß5 likely represses by stoichiometric competition, away from the RARE, against other transcription factors within the cell (e.g., RAR
, RARß, and RAR
) for transcription cofactors (7)
. Although RARß4 protein (identical to RARß5 protein) was reported to be elevated in breast cancer cells (11
, 15)
, our data show that both RARß5 mRNA and protein are expressed in normal HMEC cells, indicating that RARß5 is not a tumor-specific isoform; it could be a regulatory factor for RARß target genes in both normal and tumor breast epithelial cells. We could not detect RARß5 protein in ER-positive breast cell lines that are sensitive to retinoids, whereas it can be detected in ER- negative breast cancer cells and normal breast epithelial cells that are relatively resistant to retinoids, indicating that this isoform may contribute to cellular resistance to retinoids. In the metastatic atRA-resistant M-4A4 cell line derived from MDA-MB435 cells, RARß4 protein (identical to RARß5) was elevated in comparison with the isogenic nonmetastatic NM-2C5 cell line, and its protein expression was also up-regulated by atRA after 4- and 6-day treatment (15)
, which is consistent with our RT-PCR and MTT data and in agreement with the conclusion that it plays a negative role in RARß2 function (7)
.
Analysis of the RARß5 5' flanking region by computer program failed to predict the P3 promoter, indicating that P3 is not a typical promoter. The functionality of the TATA-like box 42-bp upstream of transcription start site remains unclear. In this respect, another noncanonical TATA box (TATATTA) has been reported in the P2 promoter of RARß (9) . However, cloning and transfection studies of the RARß5 5' flanking region confirmed the presence of P3 promoter. The atRA target promoter region (302/99) lacks any canonical RXRE/RARE elements. The magnitude of activation of the RARß5 promoter by atRA seemed to be cell-type specific. Cotransfection of empty vector pcDNA3.1 resulted in a significant increase in reporter gene activity, the reason is currently unknown; transfection experiment can generate artifacts, and a control (empty) vector must be included for comparison to see the function of the transfected gene. The effect of atRA seems to be at least partially RARß2 dependent, whereas RARß2 overexpression itself might not have a significant effect on RARß5 promoter activity in the absence of ligand-atRA. Other RAR/RXR selective retinoids also differentially increased RARß5 promoter activity, indicating that both RARs and RXRs can be involved in the RARß5 transcriptional activation. Because only two promoters have been previously identified in all of the RAR genes (11) , the identification of this promoter has biological significance. Both RARß2 and RARß5 can be transactivated by atRA in the same cells, whereas their functions seem to be different, revealing a mechanism of fine-tuning atRA-induced transcription.
The corresponding isoform of RARß5 in RAR
and RAR
gene seems not to be present, although fragments cleaved from RAR
and RAR
protein were detected. Whether the fragments are functional or not and their biochemical properties still need to be determined. It seems RARß5 isoform is unique among all of the RARs and not a cleaved product from other RARß isoforms, which suggest that RARß gene might have different function from other RARs. The expression and regulation of RARß protein is an important issue for functional research of this receptor. We did not observe significant regulation of RARß5 protein by atRA after 24 hours treatment with or without proteasomal inhibition, suggesting that the translational regulation is independent of transcriptional regulation under the experimental condition. The RARß post-translational regulation by retinoids will be addressed in depth in the future studies.
In summary, we have identified a novel, unique RARß isoform (RARß5) and mapped its promoter region. We also initially characterized its expression and transcriptional regulation in normal and cancerous breast epithelial cells. RARß5 identification reveals an additional layer of complexity to retinoid signaling, and this isoform may serve as a potential target of retinoids in breast cancer prevention and therapy studies. Future study on RARß function should include the analysis of RARß5 isoform in both normal and tumor cells and its response to retinoids. Effective inhibition of RARß5 might be necessary for the prevention and treatment of breast and other cancers by retinoids.
| ACKNOWLEDGMENTS |
|---|
selective retinoid, Marcia Dawson (Burnham Institute, La Jolla, CA) for providing RARß agonists, and Scott Kenndy for editorial assistance. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: Supplementary data for this article may be found at Cancer Research Online at http://cancerres.aacrjournals.org. The sequences reported in this article have been deposited in the GenBank database (accession nos. AY501390-AY501391).
Requests for reprints: Konstantin Christov, Department of Surgical Oncology, University of Illinois at Chicago, 840 South Wood Street (M/C 820), Chicago, IL 60612. Phone: (312) 996-5347; Fax: (312) 996-9365; E-mail: christov{at}uic.edu
4 X. Peng, D. Yun, K. Christov, unpublished data. ![]()
5 X. Peng, R. G. Mehta, D. A. Tonetti, K. Christov, unpublished data. ![]()
Received 5/23/04. Revised 9/14/04. Accepted 10/14/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Whyte, Y.-Y. Huang, K. Torres, and R. G. Mehta Molecular Mechanisms of Resveratrol Action in Lung Cancer Cells Using Dual Protein and Microarray Analyses Cancer Res., December 15, 2007; 67(24): 12007 - 12017. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Peng, P. Jhaveri, E. A. Hussain-Hakimjee, and R. G. Mehta Overexpression of ER and VDR is not sufficient to make ER-negative MDA-MB231 breast cancer cells responsive to 1{alpha}-hydroxyvitamin D5 Carcinogenesis, May 1, 2007; 28(5): 1000 - 1007. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang, Z. D. Liang, T.-T. Wu, A. Hoque, H. Chen, Y. Jiang, H. Zhang, and X.-c. Xu Tumor-Suppressive Effect of Retinoid Receptor-Induced Gene-1 (RRIG1) in Esophageal Cancer Cancer Res., February 15, 2007; 67(4): 1589 - 1593. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Peng, R. Mehta, S. Wang, S. Chellappan, and R. G. Mehta Prohibitin is a novel target gene of vitamin d involved in its antiproliferative action in breast cancer cells. Cancer Res., July 15, 2006; 66(14): 7361 - 7369. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Petty, N. Li, A. Biddle, R. Bounds, C. Nitkin, Y. Ma, K. H. Dragnev, S. J. Freemantle, and E. Dmitrovsky A Novel Retinoic Acid Receptor {beta} Isoform and Retinoid Resistance in Lung Carcinogenesis J Natl Cancer Inst, November 16, 2005; 97(22): 1645 - 1651. [Abstract] [Full Text] [PDF] |
||||