Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peng, X.
Right arrow Articles by Christov, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, X.
Right arrow Articles by Christov, K.
[Cancer Research 64, 8911-8918, December 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

A Novel RARß Isoform Directed by a Distinct Promoter P3 and Mediated by Retinoic Acid in Breast Cancer Cells

Xinjian Peng1, Takeshi Maruo3, Yanxia Cao2, Vasu Punj1, Rajeshwari Mehta1, Tapas K. Das Gupta1 and Konstantin Christov1

1 Department of Surgical Oncology, University of Illinois at Chicago, and 2 Department of Internal Medicine, Rush University Medical Center, Chicago, Illinois; and 3 Department of Obstetrics and Gynecology, Kobe University School of Medicine, Kobe, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Retinoids regulate gene transcription through activating retinoic acid receptors (RARs)/retinoic X receptors (RXRs). Of the three RAR receptors ({alpha}, ß, and {gamma}), RARß has been considered a tumor suppressor gene. Here, we identified a novel RARß isoform-RARß5 in breast epithelial cells, which could play a negative role in RARß signaling. Similar to RARß2, the first exon (59 bp) of RARß5 is RARß5 isoform specific, whereas the other exons are common to all of the RARß isoforms. The first exon of RARß5 does not contain any translation start codon, and therefore its protein translation begins at an internal methionine codon of RARß2, lacking the A, B, and part of C domain of RARß2. RARß5 protein was preferentially expressed in estrogen receptor-negative breast cancer cells and normal breast epithelial cells that are relatively resistant to retinoids, whereas estrogen receptor-positive cells that did not express detectable RARß5 protein were sensitive to retinoid treatment, suggesting that this isoform may affect the cellular response to retinoids. RARß5 isoform is unique among all of the RARs, because a corresponding isoform was not detectable for either RAR{alpha} or RAR{gamma}. RARß5 mRNA was variably expressed in normal and cancerous breast epithelial cells. Its transcription was under the control of a distinct promoter P3, which can be activated by all-trans-retinoic acid (atRA) and other RAR/RXR selective retinoids in MCF-7 and T47D breast cancer cells. We mapped the RARß5 promoter and found a region -302/-99 to be the target region of atRA. In conclusion, we identified and initially characterized RARß5 in normal, premalignant, and malignant breast epithelial cells. RARß5 may serve as a potential target of retinoids in prevention and therapy studies.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The biological effects of retinoids are mainly mediated by two families of nuclear receptors: retinoic acid receptors (RARs) and retinoic X receptors (RXRs), each consisting of three receptor subtypes ({alpha}, ß, {gamma}; refs. 1 , 2 ). In addition, each RAR gene generates multiple isoforms by either alternative splicing or differential usage of two promoters (1 , 2) . RARs/RXRs belong to the superfamily of nuclear receptors that mediate the transcriptional effects of steroid hormones, vitamin D, and thyroid hormone (3) . RARs preferentially dimerize with RXRs to form RAR-RXR heterodimers that are thought to be obligatory intermediates in the effects of RAR ligands on gene expression (4) . RXRs also can homodimerize to form transcriptionally active complexes (5) . Homo- and heterodimeric retinoid receptor complexes bind to distinct retinoid response elements embedded in the regulatory regions of retinoid-responsive genes (6) . Although there is considerable variability in the sequence and structure of the retinoid response elements in retinoid-regulated genes, they conform to a general canonical sequence in which two directly repeated receptor-binding hexanucleotide motifs [consensus (A/G)G(G/T)TCA] are separated by a variable number of intervening nucleotides (6) .

RARß itself is a retinoid target gene and believed to play a role as a tumor suppressor gene in tumorigenesis (7) . The human RARß gene was first identified from hepatocellular carcinoma in 1987 (8) , followed by the identification of retinoic acid response element (RARE) in its promoter region (9) . In the mice, the RARß gene generates four distinct transcripts: splice variants RARß1 and RARß3 from transcription at promoter P1, and RARß2 and RARß4 from the RARE-containing P2 promoter (2 , 10) . In the human, only RARß2 and RARß4 transcripts have been identified in normal adult cells (11) . Human RARß1 is expressed in fetal tissues and some small cell lung carcinoma cell lines (12) ; whereas a human homologue of the RARß3 isoform has not been detected (7) . The RARß2 and RARß4 transcripts differ only in the content of their 5'-most exon, a result of alternative splicing (10) . On the basis of homology with other members of the steroid hormone receptor superfamily, six distinct domains (A–F) have been identified within RARs and RXRs (2) . Thus far, all of the identified RAR isoforms are only different at their unique A domain and are derived from two promoters and alternative splicing (11) . Isoforms of a given RAR gene generally contain identical protein sequences B–F (11) .

We’ve been interested in RAR/RXR alteration in the process of breast tumor progression with a MCF10 model (13) . During the characterization of RARß expression in the MCF10 series of cell lines (benign MCF10A, premalignant MCF10AT, and malignant MCF10CA1a cell lines; ref. 14 ), we identified a novel RARß isoform, which we named RARß5. RARß5 mRNA expression is under the control of a distinct promoter P3 and is mediated by all-trans-retinoic acid (atRA) and other RAR/RXR selective ligands in breast cancer cells. It was detected in both normal and breast cancer cells. We also cloned and initially characterized the promoter region of RARß5. The same protein isoform was previously associated with RARß4 transcript (11 , 15) and then termed RARß' (7) . In this study, we have identified RARß5 at both gene and protein level.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
The MCF10A cell line was received from Karmanos Cancer Institute (Detroit, MI) and cultured as described previously (13) . Normal human mammary epithelial cells (HMEC) were purchased from Clonetics (Santa Rosa, CA) and cultured in MEGM with supplements (Clonetics). MCF-7, T47D, and MDA-MB435 cell lines were purchased from American Type Tissue Collection (Manassas, VA). BCA-1 to BCA-11 breast carcinoma cell lines were from breast cancer patients and established in our laboratory (16) . These cell lines are still at their early passages (passage number at 7-10), and their characteristic features are summarized in Appendix 1 as supplemental material. All of these cell lines were cultured in MEM supplemented with 100 units/mL penicillin, 100 µg/mL streptomycin, and 10% fetal bovine serum, 200 µmol/L L-glutamine and 100 µmol/L MEM nonessential amino acids. The atRA was purchased from Sigma (St. Louis, MO). The 9-cis–retinoic acid (9-cisRA), 4-hydroxyphenyl retinamide (4-HPR), and LGD1069 were obtained from the repository of the National Cancer Institute (Bethesda, MD). Am80 (RAR{alpha} selective ligand) was a generous gift from Dr. Koichi Shudo (ITSUU Laboratory, Tokyo, Japan).

Rapid Amplification of cDNA 5'-Ends and cDNA Cloning.
Rapid amplification of cDNA 5'-ends (5'-RACE) was done with SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA) according to the User Manual. RACE PCR was done with a Universal Primer and two RARß2 gene-specific reverse primers located at 1754 bp (RARß2-1754RP, GGACTGTGCTCTGCTGTGTTCCCACTT) and 1216 bp (RARß2-1216RP, GGTCTGCGATGGTCAAGCCAGTGAA) 3' of the RARß2 transcription site. PCR products were cloned into pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced with ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA).

Reverse Transcription-PCR.
RT was done in a final volume of 20 µL with 2 µg total RNA and 100 units of MuLV reverse transcriptase (Invitrogen) at 42°C for 50 minutes. Conventional PCR was mainly used to qualitatively detect gene expression. PCR was done with 1 µL RT product with PCR Supermix (Invitrogen). PCR primer pairs are RARß2 (475FP, GACTGTATGGATGTTCTGTCAG; and 730RP, ATTTGTCCTGGCAGACGAAGCA) and RARß5 (14FP, CTGGAAGGTCGTACACAGTGA; and 343RP, GGACATTCCCACTTC-AAAGC). ß-actin (FP, GTCACCAACTGGGACGACA; and RP, TGGCCATCTCTTGC-TCGAA) was used as an internal control. Real-time PCR was done with 1 µL RT product with 7900HT Sequence Detection System (ABI, Applied Biosystems) and ABI 2 x SYBR Green PCR Master Mix (ABI# 4309155) according to recommended guidelines of ABI. Primer pairs for real-time PCR were RARß2 (584FP, GATTGACCCAAACCGAATGGCAGCA; and 730RP) and RARß5 (15FP, GGAAGGT-CGTACACAGTGAATTTCTCTGAG; and RARß2-730RP); real-time PCR data were analyzed with a software package (ABI Prizm SDS2.1) provided with the instrumentation system.

Expression Vector and In vitro Translation.
The RARß5 expression vector was generated by PCR-cloning with pcDNA3.1/V5-His TOPO TA Expression Kit (Invitrogen). The open reading frame (ORF) of RARß5 was isolated by PCR of 5'-RACE cDNA from MDA-MB435 cells with primers containing RARß5 start and stop codon (RARß5-start, CAGAAGAATATGATTTACACTTGTCACCG; and RARß5-stop, GTCTTATTGCACGA-GTGGTGACTG). RARß2 expression vector pTag (RARß2 ß'-; RARß2 with a mutation to knockout a downstream translation start site) was a generous gift from Dr. Karen Swisshelm (Department of Pathology, University of Washington, Seattle, WA; ref. 11 ). RARß2 insert was cut from pTag (RARß2 ß'-) and ligated into the BamH1 sites of pcDNA3.1 vector (Invitrogen) to generate RARß2 expression vector-pcDNA3.1(RARß2). The pcDNA3.1(RARß2) was used for both in vitro translation to generate RARß2 protein as positive control for Western blot and cotransfection to test the effects of RARß2 expression on RARß5 promoter activity. In vitro translation was done with TNT Quick Coupled Translation kit (Promega, Madison, WI).

Western Blot.
When cells grew to 50 to 70% confluence, cell lysates were prepared and subjected to Western blot analysis as described previously (17) . Two antibodies were used to detect RARß isoforms, one recognizing amino acids 430-447 in the COOH-terminus of RARß2 (sc-552, Santa Cruz Biotechnology Inc., Santa Cruz, CA), the other one recognizing amino acids 407-423 in the COOH-terminus of RARß2 (Geneka Biotechnology Inc., Montreal, Quebec). Another two antibodies recognizing COOH-terminus of RAR{alpha} (sc-551, Santa Cruz Biotechnology Inc.) and RAR{gamma} (sc-550, Santa Cruz Biotechnology Inc.) were used to detect RAR{alpha} and RAR{gamma} isoforms.

The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide Assay for Cell Growth.
Cell proliferation was examined by colorimetric [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; MTT] assay. MTT is a pale yellow substrate that is cleaved by living cells to yield a dark blue formazan product. This process requires active mitochondria, and even freshly dead cells do not cleave substantial amounts of MTT. Briefly, cells (500 cells per well) were seeded in 96-well plates and cultured overnight. Then cells were incubated with 1 µmol/L retinoids, and the media were changed every second day. After 7-day treatment, 0.01 mL of MTT solution (5 mg/mL) was added to each well, mixed gently, and incubated with the cells at 37°C for 2 to 3 hours. The media were carefully removed, 0.1 mL of DMSO was added to each well, and plates were assayed for cell proliferation as described previously (18) .

RARß5 Promoter-Luciferase Reporter Plasmids.
The 1-kb 5' flanking region (P-1000/+33 relative to the transcription start site) of RARß5 was first isolated by PCR from genomic DNA extracted from MDA-MB435 breast cancer cells with Advantage 2 PCR kit (Clontech). Primer pairs were designed to contain a Kpn restriction site at the 5' end of the forward primer and a Xho restriction site at the 5' end of the reverse primer. The PCR product was first cloned to the pCR4-TOPO vector, and then subcloned to the Kpn/Xho sites of the promoterless PGL3 basic vector (Promega). Orientation and sequence of all of the constructs were verified by direct sequencing. All of the other promoter deletion mutation constructs (P-428/+33, –323/+33, –302/+33, –177/+33, –99/+33) were cloned in the same way with PGL3-P-1000/+33 as a template.

Cell Transfections and Luciferase Assay.
MCF-7 and T47D cells were plated at 1 to 1.2 x 105 cells per well in 12-well plates. After overnight incubation, the media were replaced by MEM containing 2% fetal bovine serum. Transient transfection was done in the same media with Lipofectamine 2000 (Invitrogen). Cells were transfected with 0.5 µg/well promoter constructs (0.5 µg/well for PGL3-P-1000/+33, the amount of other deletion mutants was correspondingly adjusted to make each well contain the same amount of the plasmids) with or without 0.5 µg/well pcDNA3.1 empty vector or 0.64 µg/well pcDNA3.1(RARß2) expression vector. A 20 ng/well pCMVßgal vector (Clontech) was cotransfected as an internal control for transfection efficiency. After 5 hours incubation, the medium was replaced with a fresh one containing 1 µmol/L atRA or other retinoids or DMSO (solvent control, 1 µL/10 mL media), and cells were incubated for an additional 24 hours. Luciferase and ß-galactosidase activities were assayed with Luciferase Reporter Assay Kit and Luminescent ß-gal detection kit II (Clontech).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A Novel RARß Transcript in MCF10A Breast Epithelial Cells.
During characterization of RARß2 expression in MCF10A series of cell lines (14) , with primers recognizing RARß2 coding region, we detected RARß2 transcript by reverse transcription (RT)-PCR; but we failed to detect RARß2 transcript with primers recognizing RARß2 5'-untranslated region (UTR). Hence, to examine the 5' region of RARß2 in MCF10A cells, we did a 5'-RACE analysis of the MCF10A total RNA with two RARß2 specific primers (Fig. 1A)Citation . Using these two primers, we failed to detect the expected RARß2 fragments with size ~1.8 kb and ~1.3 kb, respectively, but did consistently detect a band with a smaller size (~0.6 kb shorter). The 5'-RACE product was cloned and sequenced. The Blast search of GenBank suggests it to be a novel RARß isoform that has not yet been reported, henceforth it is referred to as RARß5. The 5' end sequence of RARß5 cDNA is presented in Fig. 1BCitation . Only the first exon (Fig. 1Citation ; exon 6, 58 bp, bold) is RARß5 specific. We also used another primer set designed in terms of the RARß5-specific sequence (RARß5-14FP) and the 3'-UTR sequence of RARß2 (RARß2-1827RP) to amplify a fragment spanning the whole coding region of RARß5. Cloning and sequencing analysis of this PCR product showed a unique first exon of the RARß5, whereas all of the downstream exons are common to all of the isoforms of RARß. Alignment of the first exon of RARß5 to bacterial artificial chromosome (BAC) clones RP11-421F9 and RP11-733H11 (GenBank accession nos. AC133141.2 and AC098477.2) shows that the first exon of RARß5 is located ~29.4 kb downstream of the first exon (exon 5) of RARß2 and ~2.8 kb upstream of the second exon of RARß2. Therefore, this novel exon is numbered exon 6, and numeration for the downstream exons is updated from what was reported previously (ref. 11 ; Fig. 1CCitation ). The 5'-UTR of RARß5 mRNA is 237 nucleotides long and contains 2 upstream ORFs (uORFs; Fig. 1BCitation ). We note in this respect that both RARß2 and RARß4 contain multiple uORFs (8 , 11) that could play a role in tightly controlling translation efficiency. Differing from RARß2, the first exon of RARß5 does not contain any translation start codon, the 5'-most AUG of the RARß5 transcript with the RARß5 coding sequence is located at nucleotide 238 of RARß5 mRNA (within the third exon of RARß5) and corresponds to an internal methionine codon at amino acid 113 of the RARß2 protein (Fig. 1, B and C)Citation . This AUG is within an appropriate nucleotide context for translation initiation (19) and would result in a protein of 336 amino acids with an estimated molecular mass of ~37 kDa (Fig. 1C)Citation . In vitro translation of RARß5 expression vector confirmed that this AUG is a functional translation initiation codon (Fig. 1D)Citation . It should be noted that in vitro translation generated multiple protein bands, which is consistent with a previous report and might not happen in the cells (11) , probably because of lack of the whole UTR region in the expression vector and lack of natural chromatin environment. This RARß5 protein product is identical to a truncated RARß2 or RARß4 protein reported previously (7 , 11) . The predicted amino acid sequence is given in Fig. 1ECitation .



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Identification of RARß5 in MCF10A cells. A, agarose gel analysis of 5'-RACE products. The RACE products with MCF10A total RNA were analyzed by agarose gel and a novel RARß isoform, RARß5, was identified. M, 100-bp DNA ladder; 1, 5'-RACE PCR with primers UPM and RARß2–1754R; 2, 5'-RACE PCR with primers UPM and RARß2–1216R. B, 5' end sequence of the RARß5 cDNA. Nucleotides are numbered relative to the transcription start site. The new exon (exon 6) sequence is bolded. Translation of RARß5 begins at +238 of the RARß5 transcript, indicated above bold right-angled arrow. The uORFs in the 5' UTR are underlined and labeled above their coding sequence. Exon junctions are indicated above straight arrow. C, a schematic diagram showing comparison of RARß5 and RARß2 mRNA and protein structures. Protein domains (A–F) of the RARß isoforms are depicted to scale above (RARß2) or below (RARß5) diagrams representing their respective mRNA sequences. The molecular masses are the theoretical values predicted on the basis of amino acid sequence. The positions of the translation start site and stop codon are indicated with short arrows along the mRNA diagrams. Note that the RARß5 translation begins within the C region, resulting in loss of the A, B domains and half of the C domain. D, Western blot analysis of products of in vitro translation with RARß5 expression vector. E, predicted amino acid sequence of RARß5.

 
AtRA Mediated Expression and Regulation of RARß5.
Identification of RARß5 raised a question as to whether its expression is mediated by atRA. To directly examine the presence of RARß5 in comparison with RARß2 in patients, we used the human breast cancer cells derived from the patients and being in early in vitro (<10) passages. In addition, we also examined the expression of both RARß isoforms in established breast cancer cell lines and normal human mammary epithelial cells. RT-PCR analysis showed that all of the examined breast cancer cells expressed detectable RARß5 mRNA, but its expression was differentially regulated by atRA treatment (Fig. 2A)Citation . It was up-regulated by atRA in BCA-1, 3, and 4 cells, whereas BCA-8 showed a slight down-regulation of RARß5 by atRA. Similarly, the level of RARß2 was up-regulated by atRA in some cells (BCA-1, 3, 4, 8, 9, and 10), whereas in others it remained unaltered. However, no correlation between RARß2 and RARß5 expression could be established. Since in breast cancer, estrogen receptor (ER) plays a critical role in its response to various chemotherapeutic agents and to quantitate the expression of RARß5 and RARß2 mRNA, we did real-time PCR with HMEC, ER-positive breast cancer cell lines MCF-7 and T47D, and the ER-negative breast cancer cell line MDA-MB435 that expresses a high level of RARß2 mRNA (11) . Real-time PCR clearly showed that RARß5 was preferentially up-regulated by atRA in MCF-7 cells, whereas RARß2 was preferentially up-regulated by atRA in T47D cells (Fig. 2B)Citation . ER-negative MDA-MB435 cells expressed a high level of RARß2 but a low level of RARß5 relative to HMEC cells. RARß5 and ß2 were consistently expressed at a low level in ER-positive MCF-7 and T47D cells relative to normal HMEC cells (Fig. 2B)Citation . Because other retinoids function through a similar mechanism in the cells, it is reasonable to expect that other retinoids might also mediate RARß5 expression. By using conventional RT-PCR, we confirmed that 4-HPR and 9-cisRA also differentially up-regulated RARß5 expression in MCF-7, T47D, and BCA-3 cells. Fig. 2CCitation presents data showing real-time RT-PCR analysis of RARß5 expression mediated by different RAR/RXR selective ligands in T47D cells. In addition to atRA, Am80 (RARß/{alpha} selective ligand) and LGD1069 (RXR selective ligand) also significantly up-regulated RARß5 expression, whereas 4-HPR (a weak RAR{gamma} ligand) and 9-cisRA (RAR/RXR ligand) had relatively low efficacy in mediating RARß5 expression (Fig. 2C)Citation .



View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. RT-PCR analysis of RARß5 and RARß2 mRNA expression and regulation by retinoids. A. Cells were treated with 1 µmol/L atRA for two days, and total RNA was subjected to RT-PCR analysis with specific primers. Both RARß5 and RARß2 are differentially expressed in all of these tumor cells and regulated by atRA. B. Real-time PCR analysis showing relative levels of RARß5 and RARß2 mRNA normalized to ß-actin (the basal RARß mRNA level in HMEC is set as 1) after atRA treatment (1 µmol/L atRA for 24 hours) in HMEC and breast cancer cell lines. Results are expressed as the mean value of two independent experiments. C. Real-time PCR analysis showing relative levels of RARß5 mRNA normalized to ß-actin after treatment with RAR/RXR selective ligands (1 µmol/L for 24 hours) in T47D cells. The atRA served as a positive control. Results are expressed as the mean value of duplicate analyses of the same cDNA samples.

 
RARß5 Protein Expression in Correlation to Cellular Resistance to atRA.
We did Western blot to analyze RARß protein expression in a panel of breast epithelial cells (normal HMEC; ER-positive MCF7 and T47D; ER-negative MDA-MB231, MDA-MB435, human breast carcinoma BCA-2 and BCA-8, MCF10A benign, and MCF10AT premalignant breast epithelial cells) with two RARß polyclonal antibodies that were raised against amino acids at the COOH-terminal (a region common among human RARß isoforms). A protein band with the expected molecular mass (~37 kDa) was detected in HMEC, MDA-MB231, BCA-2, MCF10A, and MCF10AT cells by both antibodies (Fig. 3, A and B)Citation , suggesting this protein could be RARß5. An RARß2 protein band (~55 kDa) was only detected from the in vitro translation product (Fig. 3D)Citation . None of the cell lines expressed detectable RARß2. In another experiment, we were not able to detect RARß2 protein expression in all of the BCA (-1, -2..., -11) cell lines, but we detected RARß2 protein in HMEC cells that were from a different source (Cambrex Bio Science Inc., Walkersville, MA)4 with the same antibody (C-19, Santa Cruz Biotechnology), indicating that RARß2 protein expression could be cell-type specific. The ~37 kDa protein detected in this study could be identical to the RARß protein isoform (termed RARß4, ~40 kDa) identified previously in breast cancer cells (11) , because same antibody was used for the detection, and the molecular size is also very close considering the 10% margin of error for our molecular mass standards. This RARß protein isoform seemed to be preferentially expressed in ER-negative normal and cancerous breast epithelial cells, but it was not detectable in ER-positive breast cancer line MCF-7 and T47D.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Detection of endogenous levels of RARß5 protein in normal and breast cancer cells and cellular sensitivity to retinoid treatment. A and B. Western blot analysis of cell extracts of various cells with RARß specific antibodies. Twenty micrograms (A) and 60 µg (B) of the total proteins from each cell line were loaded for immunoblot analysis with two polyclonal antibodies raised against different COOH-terminal RARß epitopes [A, antibody recognizing amino acids 430-447 of RARß2 (sc-552, Santa Cruz Biotechnology); and B, antibody recognizing amino acids 407-423 of RARß2 (16021053, Geneka)], respectively. RARß5 protein was detected as a ~37 kDa protein band. C. ß-actin was used as an internal control. D. Western blot analysis of products of in vitro translation with different vectors. The positions of molecular mass markers are indicated to the right. RARß2 (~55 kDa) was not detectable in any of the cell lines except positive control (D). E, MTT assay of cell proliferation in response to retinoids. Data are expressed as the percentage of DMSO control ± SD of 8 wells. All of the data shown are representative of three independent experiments. **, P < 0.01 compared with control; ***, P < 0.001 compared with control.

 
To evaluate whether RARß5 expression is associated with cellular resistance to retinoids, cell lines expressing different level of RARß5 protein (Fig. 3, A and B)Citation were selected to assess their sensitivity to retinoids with MTT assay. Immortalized benign MCF10A cells, which express high level of RARß5, were resistant to both atRA and 4-HPR; ER-negative MDA-MB231 cells, which also express RARß5 protein, showed resistance to atRA, but 4-HPR effectively inhibited the proliferation of MDA-MB231 cells. ER-positive MCF-7 and T47D cells in which RARß5 protein expression was not detectable were sensitive to both atRA and 4-HPR (Fig. 3E)Citation . In addition, MDA-MB435, MCF10AT, and BCA-2 cells, which express detectable RARß5 protein, were relatively resistant to atRA (data now shown). These results suggest that RARß5 might contribute to cellular resistance to atRA, which functions through receptor-dependent pathway. RARß5 did not have much influence on the effect of 4-HPR, which functions through both receptor-dependent and independent pathway (20) .

Sequence Analysis of 5' Flanking Region of RARß5.
Although the RARß5 regulation pattern by atRA was more or less similar to that of RARß2, in some cells such as BCA-2 and BCA-8, MCF-7 and T47D, the expression pattern was significantly different. Sequence alignment showed that the first exon of RARß5 is far away (~30 kb) from the P2 promoter, suggesting that RARß5 and RARß2 use different promoters. Therefore, we cloned and sequenced the 1-kb 5' flanking region of RARß5. Fig. 4Citation shows the 480-bp 5' flanking sequence of RARß5. The 5' flanking sequence (–1000/–59) of RARß5 was analyzed with several promoter identification programs including Proscan (21) , Promoter 2.0 (22) , BDGP: Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter (http://genes.mit.edu/McPromoter.html), PromoterInspector (http://www.genomatix.de/). None of these programs was able to predict this promoter. The region close to the putative transcription start site lacks the canonical TATA and CCAAT boxes, but a TATA-like box (TATAATT) is present 42 bp upstream of the transcription start site. Additional analysis with MatInspector (23) and TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH. html) identified DNA binding sites for AP-1, GATA, SRY, CEBP/ß, NFAT, OCT1, and so forth at the region –500/+1 (Fig. 4)Citation . In addition, Promo (24) identified a binding site for RXR{alpha} at 312 bp upstream of the transcription start site. However, these are the potential binding sites, and tests for functionality need to be done to confirm their importance.



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Nucleotide sequence of the 5' flanking region of human RARß5 gene. Transcription start site is underlined in bold. Shading denotes the core sequence of potential transcription binding sites with high identity to authentic core and matrix sequences as identified by MatInspector V2.2. Nucleotides are numbered negatively to the left of the sequence with nucleotide +1 corresponding to the transcription start site. A TATA-like consensus sequence is boxed.

 
Transcription Start Site of RARß5.
To determine the transcription start site of RARß5, we did 5'-RACE analysis on mRNA from MDA-MB435 and MCF10A cells. The 5' regions of both RARß2 and RARß5 were cloned from MDA-MB435 cells and sequenced. Because only a single transcription start site in the human RARß2 gene has been defined (9) , RARß2 cDNA cloning and sequencing served as a good control for mapping the transcription start site of RARß5 with 5'-RACE analysis. In total, six RARß5-positive clones from MCF10A 5'-RACE products and four RARß5-positive and two RARß2-positive clones from MDA-MB435 were sequenced. Sequence analysis showed a single transcription start site of RARß5 in both MCF10A and MDA-MB435 cells (Table 1)Citation . Interestingly, a single nucleotide (A) deletion close to transcription start site was found in five of the six clones from MCF10A cells and in all four clones from MDA-MB435 cells. However, as no deletion was found in the corresponding DNA region in MDA-MB435 cells, it seems that the deletion happened during the transcription process. Two transcription start sites [+1 and –11; +1 identifies the first nucleotide of the putative transcription start site based on GenBank sequence data (NM_000965)] of RARß2 were identified in MDA-MB435 cells; it seems that RARß2 has multiple transcription start sites in this cancer cell line.


View this table:
[in this window]
[in a new window]

 
Table 1 Transcriptional initiation site mapping (5'-RACE) of the hRARß5 gene in breast epithelial cells

 
RARß5 Promoter Activity.
A series of RARß5 promoter-luciferase reporter vectors were constructed. When these constructs were transfected into MCF-7 and T47D cells (which are ER-positive and responsive to atRA) and assayed for reporter gene activity, although differential promoter activity was observed in the two cell lines, the region –99/+33 consistently showed negligible or very low promoter activity in the two cell lines, suggesting either the existence of a negative regulatory element within this region or the presence of a strong activator in the region between –177 and –99 (Fig. 5, A and B)Citation . In MCF-7 cells, PGL3–1000/+33, 428/+33, –323/+33, –302/+33, and –177/+33 exhibited significant basal promoter activity (relative to the empty PGL3 Basic vector control). The atRA treatment additionally increased promoter activity by 2- to 5-fold in MCF-7 cells but only 2- to 3-fold in T47D cells, which was in agreement with real-time PCR results (Fig. 2B)Citation . Deletion of region –302/–177 significantly decreased promoter activity induced by atRA in MCF-7 cells. On the basis of transfection assay data from both cell lines, it seems that the promoter region –302/–99 is the target region for atRA stimulation, whereas no RARE/RXRE was identified in this region. Therefore, either the target binding site has not been identified, or the stimulatory effect caused by atRA is an indirect effect.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. RARß5 promoter activity in MCF-7 and T47D cells. A and B, a region –302/–99 was found to be the target region for atRA-induced promoter activity. RARß5 promoter activity was assayed in MCF-7 (A) and T47D (B) cells transfected with deletion mutants in the 5' region. C and D, effects of cotransfection of RARß2 expression vector on promoter activity in MCF-7 (C) and T47D (D) cells. Schematic representations of the 5' deletion constructs are shown to the left of the graph (A). Results are of three independent experiments done in triplicate; bars, mean ± SEM. Relative luciferase activity, luciferase activity normalized to ß-galactosidase. *, P < 0.05 compared with the corresponding control.

 
Because atRA functions through receptor-dependent pathway, we hypothesized that expression of RARß2 could affect RARß5 promoter activity mediated by atRA. To test this hypothesis, RARß2 expression vector (pcDNA3.1-RARß2) was cotransfected with RARß5 promoter constructs into MCF-7 and T47D cells. After transfection, the cells were incubated in the presence or absence of atRA for 24 hours, and luciferase assay was done for promoter activity. Surprisingly, cotransfection of the empty vector pcDNA3.1 also greatly increased RARß5 promoter activity, whereas cotransfection of RARß2 expression vector pcDNA3.1-RARß2 did not cause a significant increase in promoter activity relative to the control (Fig. 5, C and D)Citation ; however, in the presence of atRA, RARß2 expression did significantly increase promoter activity compared with that of empty vector-transfected cells in MCF-7 cells (Fig. 5C)Citation , suggesting that activation of RARß5 promoter activity by atRA is receptor dependent.

We also examined RARß5 promoter activity in the presence of other RAR/RXR selective ligands in both MCF-7 and T47D cells. As shown in Fig. 6, A and BCitation , all of the tested RAR/RXR selective ligands differentially increased RARß5 promoter activity, whereas Am80 showed the highest efficacy. These data also confirmed our RT-PCR analysis (Fig. 2C)Citation .



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. RARß5 promoter activity is up-regulated by various RAR/RXR selective ligands in MCF-7 and T47D cells. Cells were transfected with PGL3–1000/+33-RARß5 promoter construct and treated with 1 µmol/L retinoids for 24 hours. Results are from triplicate wells of one experiment; bars, mean ± SEM. RLU, relative luciferase activity normalized to ß-gal. The atRA treatment served as a positive control.

 
Is RARß5 a Unique Isoform among RARs?
The identification of RARß5 raises the question as to whether corresponding isoform exists in the other two RARs. Sequence analysis revealed the possibility of existence of a corresponding isoform in both RAR{alpha} and RAR{gamma}, because a similar internal start codon is present in both RAR{alpha} and RAR{gamma} at similar positions. In addition, we also observed a similar protein band at the position of ~37 kDa in MCF-7 and MDA-MB231 cells through Western blot analysis with RAR{alpha}- and RAR{gamma}-specific antibodies that are not cross-reactive with each other and recognize the COOH-terminus of the corresponding RAR isoform. Therefore, we first 5'-RACE–analyzed the mRNA extracted from MCF-7 and MDA-MB231 cells with RAR{alpha}-specific primers but failed to detect any expected cDNA band with a smaller size corresponding to the putative truncated RAR{alpha}. Only a single RAR{alpha} band of an expected size corresponding to full-length RAR{alpha} was detected (data not shown). Because these receptor isoforms degrade quickly, we therefore hypothesized that the observed protein band of low molecular size for RAR{alpha} and RAR{gamma} might be a fragment generated from protease cleavage. We used cell permeable proteasome inhibitor MG132, which can inhibit the degradation of RAR{alpha} and RAR{gamma} (25) . MG132 treatment completely blocked the generation of this fragment (Fig. 7)Citation , showing that these bands are products of protease cleavage of RAR{alpha} and RAR{gamma}. The biochemical and biological properties of these RAR{alpha} and RAR{gamma} fragments are not clear at present. When cells were treated with MG132, a corresponding equivalent band of RARß5 was observed. Whether the expression of RARß5 protein is because of inhibition of protein degradation or induction by MG132 treatment still needs additional in-depth studies.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. RARß5 is unique among all of the RARs and not a cleaved product from RARß. Western blot analysis of RARß, RAR{alpha}, and RAR{gamma} in MCF-7 cells. MCF-7 cells were treated with DMSO (control) or MG132 (50 µmol/L) for 5 hours, cell lysates (50 µg) were subjected to Western blot analysis with polyclonal antibodies against RARß (Santa Cruz Biotechnology, sc-552), RAR{alpha} (Santa Cruz Biotechnology, sc-551), and RAR{gamma} (Santa Cruz Biotechnology, sc-550).

 
Because a major level of regulatory control by retinoids is post-translational, we examined effect of atRA treatment on RARß5 protein expression with and without proteasomal inhibition. Because proteasomal inhibitors are generally cytotoxic, a period of 8.5 hours was found not to trigger significant cell death in the cells examined. Cells were treated for 8 and 24 hours with 1 µmol/L atRA, and then treated with or without 40 µmol/L MG132 for the final 8.5 hours. We did not observe significant alteration of RARß5 protein level in MDA-MB435 cells; however, no RARß protein was detectable in T47D cells in either condition (data not shown). Nevertheless, MG132 effectively blocked atRA-induced RAR{alpha} degradation in both cell lines as observed in MCF-7 cells (25) .

Genomic Structure of RARß5 in Comparison to RARß2.
On the basis of the identified RARß5 cDNA sequence, the known RARß2 sequence, and the published Human Genome Project Data (http://www.ncbi.nlm.nih.gov/genome/guide/human/), we were able to elucidate the complex organization of the RARß5 and RARß2 genes. BLAST search permitted us to align the first three exons of RARß5 to a 70560-bp BAC clone RP11-421F9 (GenBank accession no. AC133141) mapped to chromosome 3p24. Similarly, the remaining exons were precisely aligned within another 189308-bp BAC clone RP11-659P16 (GenBank accession no. AC093416). Then the first exon of RARß2 was aligned within the 198468-bp BAC clone RP11-733H11 (GenBank accession no. AC098477). Additional alignment of these three clones showed a 4145-bp overlap between clones RP11-733H11 and RP11-421F9 and a1862-bp overlap between clones RP11-421F9 and RP-659P16 (Fig 8B)Citation , showing the continuity of the gene sequence in these BAC clones. An analysis of these three BAC clones revealed that the RARß5 gene spans over 130-kb of DNA, whereas the RARß2 gene spans over 160 kb of DNA. All of the splice junctions conform to the GT/AG rule for splice donor and acceptor sites (ref. 26 ; Fig. 8ACitation ). Fig. 8BCitation summarizes our analysis on the genomic structures of hRARß5 and hRARß2 genes, and a new numeration for their exons is proposed herewith.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Schematic representation of genomic structure of the hRARß5 gene in comparison with hRARß2. A. The intron-exon boundaries around exon 6 (the first exon of RARß5) are shown. Exon and intron sequences are represented by capital and lowercase letters, respectively. The canonical acceptor (ag) and donor (gt) splice sites are bolded. B, organization of the hRARß2 and hRARß5 genes and their alignment to BCA clones. RARß2 is driven by promoter P2, whereas RARß5 is directed by promoter P3. RARß2 and RARß5 only differ in their first exons; exon 7 to 13 are common to all of the RARß isoforms. Exons are represented by black boxes, and lengths are shown in bp. Intron lengths (kb) were determined based on alignment of the cDNA sequence of RARß5 and RARß2 to BAC clones. The black boxes in BAC clones represent the overlapping region between the clones.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The major biological effect and gene expression induced by retinoids are believed to be mediated by nuclear receptors RARs/RXRs. Because RARs and RXRs are primary effectors of retinoid signaling, they themselves seem to be targets for disruption in tumorigenesis. RARß has been extensively studied in human carcinomas, and several studies have suggested that it might play a role in tumor suppression (27, 28, 29) . Therefore, RARß has been considered a target molecule for retinoids in chemoprevention and therapeutic studies.

In this study, we identified RARß5, a novel RARß isoform directed by a distinct promoter P3. We also provided the first evidence showing that RARß5 protein is identical to RARß4 or RARß', a previously identified truncated RARß protein (7 , 11) . In 1999, Sommer et al. (11) identified a 40 kDa RARß protein isoform, which was interpreted as RARß4. This RARß protein isoform was found to be elevated in human breast tumor cells, especially in cytoplasm relative to RARß2 protein. In 2002, Chen et al. (7) showed an antagonistic role for this RARß protein isoform in signaling by retinoic acid and termed it RARß', and its expression was interpreted as "leaky scanning." In the same year, another group (15) showed that the expression of this protein isoform is associated with cellular resistance in response to retinoids. They also interpreted it as RARß4 and tried to link the protein expression to RARß4 mRNA expression. These data seemed correct, but the interpretation on the generation of that RARß (RARß4 or RARß') protein isoform seems questionable. There has been no evidence showing that the protein isoform is translated from endogenous RARß2 or RARß4 transcripts. The interpretation on the generation of that RARß protein isoform was based on transfection and in vitro translation experiments, in which the expression vectors generally do not contain full-length 5' and 3'UTR, and the reporter genes are not in a natural chromatin environment. In addition, the existence of multiple uORFs in the long 5'UTR region of RARß2 and RARß4 could also inhibit leaky scanning (30) . Some cells such as MCF10A series of cell lines do not express detectable RARß4 mRNA,5 the same protein isoform could only be from RARß5 transcript in these cells. The identification of RARß5 in breast epithelial cells suggests that RARß' is the primary translation product from ORF of RARß5 transcript. Should leaky scanning occur with RARß2 or RARß4, it might result in RARß' at a very low level (30 , 31) . Moreover, the existence of multiple uORFs and the long leader sequence in RARß isoform mRNAs could be a signal that their translations are under tight control.

In most of the previous studies, measurements of RARß expression are preferentially made at the mRNA levels (25) , leading to certain level of complexity in understanding its function. All the more, in most of breast cancer cell lines, RARß2 protein was not detected by Western blotting, although its mRNA was detectable (Fig. 2)Citation . We have carried out experiments to address these concerns to a certain extent and to study the expression of RARß5 both at the RNA and protein levels in various patient-derived primary breast cancer cells, established breast cancer cell lines, and immortalized benign MCF10A, premalignant MCF10AT cell lines, and normal human breast epithelial cells. At the mRNA level, RARß5 is expressed in normal human breast epithelial cells as well as in benign, premalignant, and tumor cell lines. In the presence of atRA, the level of RARß2 mRNA is preferentially elevated in contrast to RARß5 in T47D cells. At the protein level, we failed to detect endogenous RARß2 protein by Western blotting but did detect a corresponding RARß5 band in MDA-MB231 and HMEC cells. In agreement with our studies, Tanaka et al. (25) also failed to detect RARß2 protein under their experimental conditions. Hence, either RARß2 protein is not stable, or its expression is too low to be detected in these cells.

RARß5 identification also defines a new type of RARß isoform, which is under the control of a distinct promoter P3, and the protein lacks the A, B, and part of the C domain (the first zinc finger) of other RARß isoforms. The loss of DNA binding ability while retaining the capability to form heterodimers with RXR makes RARß5 act as a trans-dominant–negative regulator of RARß function (7) . We note in this respect that similarly truncated RAR{alpha} isoforms lacking all of the sequence located NH2-terminal to the second zinc finger have been identified previously (32) . Most analogous to RARß5 is the progesterone C mRNA that encodes a NH2-terminally truncated progesterone receptor (33 , 34) . RARß5 protein expression, localization, and function were characterized previously as a truncated RARß protein isoform (7 , 11 , 15) . Unlike some other reported dominant-negative nuclear receptors (35 , 36) , RARß5 does not bind cis-acting DNA elements and therefore cannot directly inactivate gene transcription. RARß5 likely represses by stoichiometric competition, away from the RARE, against other transcription factors within the cell (e.g., RAR{alpha}, RARß, and RAR{gamma}) for transcription cofactors (7) . Although RARß4 protein (identical to RARß5 protein) was reported to be elevated in breast cancer cells (11 , 15) , our data show that both RARß5 mRNA and protein are expressed in normal HMEC cells, indicating that RARß5 is not a tumor-specific isoform; it could be a regulatory factor for RARß target genes in both normal and tumor breast epithelial cells. We could not detect RARß5 protein in ER-positive breast cell lines that are sensitive to retinoids, whereas it can be detected in ER- negative breast cancer cells and normal breast epithelial cells that are relatively resistant to retinoids, indicating that this isoform may contribute to cellular resistance to retinoids. In the metastatic atRA-resistant M-4A4 cell line derived from MDA-MB435 cells, RARß4 protein (identical to RARß5) was elevated in comparison with the isogenic nonmetastatic NM-2C5 cell line, and its protein expression was also up-regulated by atRA after 4- and 6-day treatment (15) , which is consistent with our RT-PCR and MTT data and in agreement with the conclusion that it plays a negative role in RARß2 function (7) .

Analysis of the RARß5 5' flanking region by computer program failed to predict the P3 promoter, indicating that P3 is not a typical promoter. The functionality of the TATA-like box 42-bp upstream of transcription start site remains unclear. In this respect, another noncanonical TATA box (TATATTA) has been reported in the P2 promoter of RARß (9) . However, cloning and transfection studies of the RARß5 5' flanking region confirmed the presence of P3 promoter. The atRA target promoter region (–302/–99) lacks any canonical RXRE/RARE elements. The magnitude of activation of the RARß5 promoter by atRA seemed to be cell-type specific. Cotransfection of empty vector pcDNA3.1 resulted in a significant increase in reporter gene activity, the reason is currently unknown; transfection experiment can generate artifacts, and a control (empty) vector must be included for comparison to see the function of the transfected gene. The effect of atRA seems to be at least partially RARß2 dependent, whereas RARß2 overexpression itself might not have a significant effect on RARß5 promoter activity in the absence of ligand-atRA. Other RAR/RXR selective retinoids also differentially increased RARß5 promoter activity, indicating that both RARs and RXRs can be involved in the RARß5 transcriptional activation. Because only two promoters have been previously identified in all of the RAR genes (11) , the identification of this promoter has biological significance. Both RARß2 and RARß5 can be transactivated by atRA in the same cells, whereas their functions seem to be different, revealing a mechanism of fine-tuning atRA-induced transcription.

The corresponding isoform of RARß5 in RAR{alpha} and RAR{gamma} gene seems not to be present, although fragments cleaved from RAR{alpha} and RAR{gamma} protein were detected. Whether the fragments are functional or not and their biochemical properties still need to be determined. It seems RARß5 isoform is unique among all of the RARs and not a cleaved product from other RARß isoforms, which suggest that RARß gene might have different function from other RARs. The expression and regulation of RARß protein is an important issue for functional research of this receptor. We did not observe significant regulation of RARß5 protein by atRA after 24 hours treatment with or without proteasomal inhibition, suggesting that the translational regulation is independent of transcriptional regulation under the experimental condition. The RARß post-translational regulation by retinoids will be addressed in depth in the future studies.

In summary, we have identified a novel, unique RARß isoform (RARß5) and mapped its promoter region. We also initially characterized its expression and transcriptional regulation in normal and cancerous breast epithelial cells. RARß5 identification reveals an additional layer of complexity to retinoid signaling, and this isoform may serve as a potential target of retinoids in breast cancer prevention and therapy studies. Future study on RARß function should include the analysis of RARß5 isoform in both normal and tumor cells and its response to retinoids. Effective inhibition of RARß5 might be necessary for the prevention and treatment of breast and other cancers by retinoids.


    ACKNOWLEDGMENTS
 
We thank Dr. Karen Swisshelm for generously providing RARß2 expression plasmid, Dr. Zhenyu Li (Department of Pharmacology, University of Illinois at Chicago, Chicago, IL) for expert technical assistance in making DNA constructs, Dr. Koichi Shudo (ITSUU Laboratory) for providing Am80 RARß/{alpha} selective retinoid, Marcia Dawson (Burnham Institute, La Jolla, CA) for providing RARß agonists, and Scott Kenndy for editorial assistance.


    FOOTNOTES
 
Grant support: The United States Army Breast Cancer Research Program DAMD17-99-9221 (K. Christov) and the Illinois Department of Public Health Penny Sevens Breast and Cervical Cancer Research Fund (X. Peng).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article may be found at Cancer Research Online at http://cancerres.aacrjournals.org. The sequences reported in this article have been deposited in the GenBank database (accession nos. AY501390-AY501391).

Requests for reprints: Konstantin Christov, Department of Surgical Oncology, University of Illinois at Chicago, 840 South Wood Street (M/C 820), Chicago, IL 60612. Phone: (312) 996-5347; Fax: (312) 996-9365; E-mail: christov{at}uic.edu

4 X. Peng, D. Yun, K. Christov, unpublished data. Back

5 X. Peng, R. G. Mehta, D. A. Tonetti, K. Christov, unpublished data. Back

Received 5/23/04. Revised 9/14/04. Accepted 10/14/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Giguere V Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signaling. Endocr Rev 1994;15:61-79.[Abstract/Free Full Text]
  2. Chambon P A decade of molecular biology of retinoic acid receptors. FASEB J 1996;10:940-54.[Abstract]
  3. Gudas LJ, Sporn MB, Roberts AB Cellular biology and biochemistry of the retinoids Sporn MB Roberts AB Goodman DS eds. . The retinoids 2nd ed. 1994p. 443-520. Raven Press New York
  4. Durand B, Saunders M, Leroy P, Leid M, Chambon P All-trans and 9-cis retinoic acid induction of CRABPII transcription is mediated by RAR-RXR heterodimers bound to DR1 and DR2 repeated motifs. Cell 1992;71:73-85.[CrossRef][Medline]
  5. Zhang XK, Lehmann J, Hoffmann B, et al Homodimer formation of retinoid X receptor induced by 9-cis retinoic acid. Nature (Lond) 1992;358:581-91.[CrossRef][Medline]
  6. Umesono K, Murakami KK, Thompson CC, Evans RM Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 1991;65:1255-66.[CrossRef][Medline]
  7. Chen LI, Sommer K, Swisshelm K Downstream codons in the retinoic acid recepor ß-2 and ß-4 mRNAs initiate translation of a protein isofom that disrupts retinoid-activated transcription. J Biol Chem 2002;277:35411-21.[Abstract/Free Full Text]
  8. de The H, Marchio A, Tiollais P, Dejean A A novel steroid thyroid hormone receptor-related gene inappropriately expressed in human hepatocellular carcinoma. Nature (Lond) 1987;330:667-70.[CrossRef][Medline]
  9. de The H, Vivanco-Ruiz MDM, Tiollais P Identification of a retinoic acid response element in the retinoic acid receptor ß gene. Nature (Lond) 1990;343:177-80.[CrossRef][Medline]
  10. Nagpal S, Zelent A, Chambon P RAR-ß4, a retinoic acid receptor isoform is generated from RAR-ß2 by alternative splicing and usage of a CUG initiator codon. Proc Nat Acad Sci USA 1992;89:2718-22.[Abstract/Free Full Text]
  11. Sommer KM, Chen LI, Treuting PM, Smith LT, Swisshelm K Elevated retinoic acid receptor ß4 protein in human breast tumor cells with nuclear and cytoplasmic localization. Proc Natl Acad Sci USA 1999;96:8651-6.[Abstract/Free Full Text]
  12. Houle B, Pelletier M, Wu J, Gooddyer C, Bradley WE Fetal isoform of human retinoic acid receptor beta expressed in small cell lung cancer lines. Cancer Res 1994;54:365-9.[Abstract/Free Full Text]
  13. Santner SJ, Dawson PJ, Tait L, et al Malignant MCF10CA1 cell lines derived from premalignant human breast epithelial MCF10AT cells. Breast Cancer Res Treat 2001;65:101-10.[CrossRef][Medline]
  14. Peng X, Yun D, Christov K Breast cancer progression in MCF10A series of cell lines is associated with alterations in retinoic acid and retinoid X receptors and with differential response to retinoids. Int J Oncology 2004;25:961-71.[Medline]
  15. Hayashi K, Goodison S, Urquidi V, et al Differential effects of retinoic acid on the growth of isogenic metastatic and non-metastatic breast cancer cell lines and their association with distinct expression of retinoic acid receptor ß isoforms 2 and 4. Int J Oncol 2003;22:623-9.[Medline]
  16. Mehta RR, Bratescu L, Graves JM, et al Human breast carcinoma cell lines: ultrastructural, genotypic, and immunocytochemical characterization. Anticancer Res 1992;12:683-92.[Medline]
  17. Peng X, Maruo T, Matsuo H, Takekida S, Deguchi J Serum deprivation-induced apoptosis in cultured porcine granulosa cells is characterized by increased expression of p53 protein, Fas antigen and Fas ligand and by decreased expression of PCNA. Endocr J 1998;45:247-53.[Medline]
  18. Carmichael J, DeGraff WG, Gazdar AF, Minna JD, Mitchell JB Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res 1987;47:936-42.[Abstract/Free Full Text]
  19. Kozak M The scanning model for translation: an update. J Cell Biol 1989;108:229-41.[Abstract/Free Full Text]
  20. Clifford JL, Menter DG, Wang M, Lotan R, Lippman SM Retinoid receptor-dependent and -independent effects of N-(4-hydroxyphenyl)retinamide in F9 embryonal carcinoma cells. Cancer Res 1999;59:14-8.[Abstract/Free Full Text]
  21. Prestridge DS Predicting Pol II promoter sequence using transcription factor binding sites. J Mol Biol 1995;249:923-32.[CrossRef][Medline]
  22. Knudsen S Promoter 2.0: for the recognition of PolII promoter sequences. Bioinformatics 1999;15:356-61.[Abstract/Free Full Text]
  23. Quandt K, Frech K, Karas H, Wingender E, Werner T MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 1995;23:4878-84.[Abstract/Free Full Text]
  24. Messeguer X, Escudero R, Farré D, Nuñez O PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 2002;18:333-4.[Abstract/Free Full Text]
  25. Tanaka T, Rodriguez de la Concepcion ML, De Luca LM Involvement of all-trans-retinoic acid in the breakdown of retinoic acid receptors alpha and gamma through proteasomes in MCF-7 human breast cancer cells. Biochem Pharmacol 2001;61:1347-55.[CrossRef][Medline]
  26. Breathnach R, Chambon P Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 1981;50:349-83.[CrossRef][Medline]
  27. Deng G, Lu Y, Zlotnikov G, Thor AD, Smith HS Loss of heterozygosity in normal tissue adjacent to breast carcinomas. Science (Wash DC) 1996;274:2057-9.[Abstract/Free Full Text]
  28. Yang Q, Sakurai T, Kakudo K Retinoic acid receptor ß and breast cancer. Breast Cancer Res Treat 2002;76:167-73.[CrossRef][Medline]
  29. Picard E, Seguin C, Monhoven N, et al Expression of retinoid receptor genes and proteins in non-small-cell lung cancer. J Natl Cancer Inst (Bethesda) 1999;91:1059-66.[Abstract/Free Full Text]
  30. Kozak M Effects of long 5' leader sequences on initiation by eukaryotic ribosomes in vitro. Gene Expr 1991;1:117-25.[Medline]
  31. Kozak M An analysis of vertebrate mRNA sequences: intimations of translational control. J Cell Biol 1991;115:887-903.[Abstract/Free Full Text]
  32. Leroy P, Krust A, Zelent A, et al Multiple isoforms of the mouse retinoic acid receptor a are generated by alternative splicing and differential induction by retinoic acid. EMBO J 1991;10:59-69.[Medline]
  33. Wei LL, Norris BM, Baker CJ An N-terminally truncated third progesterone receptor protein, PR(C), forms heterodimers with PR(B) but interferes in PR(B)-DNA binding. J Steroid Biochem Mol Biol 1997;62:287-97.[CrossRef][Medline]
  34. Wei LL, Hawkins P, Baker C, et al An amino-terminal truncated progesterone receptor isoform, PRc, enhances progestin-induced transcriptional activity. Mol Endocrinol 1996;10:1379-87.[Abstract/Free Full Text]
  35. Pratt MA, Kralova J, McBurney MW A dominant negative mutation of the alpha retinoic acid receptor gene in a retinoic acid-nonresponsive embryonal carcinoma cell. Mol Cell Biol 1990;10:6445-53.[Abstract/Free Full Text]
  36. Durand B, Saunders M, Gaudon C, et al Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoic acid receptor: presence of a conserved autonomous constitutive activating domain and influence of the nature of the response element on AF-2 activity. EMBO J 1994;13:5370-82.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
E. Ohashi, T. Kogai, H. Kagechika, and G. A. Brent
Activation of the PI3 Kinase Pathway By Retinoic Acid Mediates Sodium/Iodide Symporter Induction and Iodide Transport in MCF-7 Breast Cancer Cells
Cancer Res., April 15, 2009; 69(8): 3443 - 3450.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Whyte, Y.-Y. Huang, K. Torres, and R. G. Mehta
Molecular Mechanisms of Resveratrol Action in Lung Cancer Cells Using Dual Protein and Microarray Analyses
Cancer Res., December 15, 2007; 67(24): 12007 - 12017.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
X. Peng, P. Jhaveri, E. A. Hussain-Hakimjee, and R. G. Mehta
Overexpression of ER and VDR is not sufficient to make ER-negative MDA-MB231 breast cancer cells responsive to 1{alpha}-hydroxyvitamin D5
Carcinogenesis, May 1, 2007; 28(5): 1000 - 1007.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Huang, Z. D. Liang, T.-T. Wu, A. Hoque, H. Chen, Y. Jiang, H. Zhang, and X.-c. Xu
Tumor-Suppressive Effect of Retinoid Receptor-Induced Gene-1 (RRIG1) in Esophageal Cancer
Cancer Res., February 15, 2007; 67(4): 1589 - 1593.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Peng, R. Mehta, S. Wang, S. Chellappan, and R. G. Mehta
Prohibitin is a novel target gene of vitamin d involved in its antiproliferative action in breast cancer cells.
Cancer Res., July 15, 2006; 66(14): 7361 - 7369.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
W. J. Petty, N. Li, A. Biddle, R. Bounds, C. Nitkin, Y. Ma, K. H. Dragnev, S. J. Freemantle, and E. Dmitrovsky
A Novel Retinoic Acid Receptor {beta} Isoform and Retinoid Resistance in Lung Carcinogenesis
J Natl Cancer Inst, November 16, 2005; 97(22): 1645 - 1651.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peng, X.
Right arrow Articles by Christov, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, X.
Right arrow Articles by Christov, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online