Cancer Research Annual Meeting 2010  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Papageorgiou, A.
Right arrow Articles by McConkey, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Papageorgiou, A.
Right arrow Articles by McConkey, D. J.
[Cancer Research 64, 8973-8979, December 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Interferon-Induced Apoptosis in Human Bladder Cancer Cells

Angela Papageorgiou1, Laura Lashinger1, Randall Millikan2, H. Barton Grossman3, William Benedict2, Colin P. N. Dinney1,3 and David J. McConkey1

Departments of 1 Cancer Biology, 2 Genitourinary Medical Oncology, and 3 Urology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Immunomodulators such as Bacillus Calmette-Guerin and interferon are clinically active in transitional cell carcinoma of the bladder, but their mechanisms of action remain unclear. Here we investigated the effects of IFN{alpha} on tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression and apoptosis in a panel of 20 human bladder cancer cell lines. Six (30%) displayed significant DNA fragmentation in response to increasing concentrations of IFN{alpha} (10–100,000 units/mL). In these lines IFN{alpha} induced early activation of caspase-8, and DNA fragmentation was blocked by a caspase-8-selective inhibitor (IETDfmk), consistent with the involvement of death receptor(s) in cell death. IFN{alpha} stimulated marked increases in TRAIL mRNA and protein in the majority of IFN-sensitive and IFN-resistant cell lines. A blocking anti-TRAIL antibody significantly inhibited IFN-induced DNA fragmentation in four of six IFN-sensitive cell lines, confirming that TRAIL played a direct role in cell death. Bortezomib (PS-341, Velcade), a potent TRAIL-sensitizing agent, increased sensitivity to IFN{alpha} in two of the IFN-resistant cell lines that produced large amounts of TRAIL in response to IFN treatment. Our data show that IFN-induced apoptosis in bladder cancer cells frequently involves autocrine TRAIL production. Combination therapy strategies aimed at overcoming TRAIL resistance may be very effective in restoring IFN sensitivity in a subset of human bladder tumors.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The immunomodulator Bacillus Calmette-Guerin (BCG) is the current frontline therapy for superficial transitional cell carcinoma (TCC) of the bladder and produces response rates 50 to 89% in previously untreated patients with locally invasive disease (1) . BCG seems to induce tumor regression by stimulating host cells to produce inflammatory cytokines, including tumor necrosis factor-{alpha} (2 , 3) , IFNs (4 , 5) , and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a death receptor ligand that triggers tumor cell apoptosis after binding its surface receptors (DR4, DR5; ref. 6 ). Recent work indicates that IFNs also display promising activity in TCC (7) and that they can augment the effects of local BCG (8) . Importantly, unlike BCG, IFN{alpha} can be delivered systemically, allowing it to be used in patients with disseminated cancer. Preclinical studies have shown that IFNs prevent the growth of orthotopic human bladder tumors in nude mice by inhibiting angiogenesis (9, 10, 11) . However, the possibility that IFNs can also directly induce apoptosis in human bladder cancer cells has not been systematically addressed. We therefore undertook the present study to characterize the effects of IFN on apoptosis within a panel of common TCC cell lines and identify the molecular mechanisms underlying cell death.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Reagents.
RT4, 253J-P, and T24 were purchased from American Type Culture Collection (Manassas, VA). The 253J B-V metastatic variant was isolated from the 253J-P cells by orthotopic "recycling" as described previously (12) . Cell lines in the UM-UC series were provided by Dr. Barton Grossman (Department of Urology, University of Texas M. D. Anderson Cancer Center). KU7 cells were provided by Dr. William Benedict. All cell lines are human bladder TCC with the exception of UC4, which is an adenocarcinoma, and UC5 and UC15, which are squamous cell carcinomas. Cells were grown in MEM (Life Technologies, Inc., Rockville, MD) supplemented with 10% fetal bovine serum and 1% each of MEM vitamin solution (Life Technologies, Inc.), sodium pyruvate (BioWhitaker, Walkersville, MD), L-glutamine (BioWhitaker), L-glutamine, penicillin/streptomycin solution, and nonessential amino acids (Life Technologies, Inc.) in a 5% CO2 incubator.

Interferon-{alpha}-2A (Roferon, Roche Applied Science, Indianapolis, IN) was purchased from the University of Texas M. D. Anderson Cancer Center Pharmacy. Recombinant TRAIL, the antihuman TRAIL neutralizing monoclonal antibody, and the TRAIL ELISA kit were purchased from R&D Systems (Minneapolis, MN). Other antibodies were obtained from the following commercial sources: IFN regulatory factor-1 (IRF-1, Santa Cruz Biotechnology, Santa Cruz, CA), phosphorylated STAT1 (Cell Signaling, Beverly, MA), caspase-8 (BD Pharmigen, San Diego, CA), Bortezomib (Velcade, PS-341) was provided by Millennium Pharmaceuticals, Inc (Cambridge, MA). Caspase-8-selective inhibitor (IETDfmk) and synthetic substrate (IETD-AFC) were obtained from Enzyme Systems Products, Inc. (Dublin, CA).

Quantification of Apoptosis by Propidium Iodide Staining and Fluorescence-Activated Cell Sorter Analysis.
DNA fragmentation was measured by propidium iodide staining and fluorescence-activated cell sorter (PI/FACS) as described previously (13 , 14) . Cells were stored for at least 1 at 4°C in PI solution before analysis by flow cytometry. Cells that contain a subdiploid DNA content are considered apoptotic (14) .

Measurement of STAT-1 Phosphorylation and IRF-1 Protein Accumulation.
Cells were incubated with 10,000 unit/mL IFN{alpha} for the times indicated and lysed for 4 hours at 4°C in lysis buffer [1% Triton X-100, 150 mmol/L NaCl, 25 mmol/L Tris (pH 7.5), 1 mmol/L glycerol phosphate, 1 mmol/L sodium orthovanadate, 1 mmol/L sodium fluoride and a protease inhibitor mixture (Complete Mini tablet, Roche Applied Science)]. Postnuclear extracts were obtained by centrifuging the lysates for 15 minutes at 14,000 rpm (4°C). Protein concentrations were determined by the Bradford method (Bio-Rad, Inc., Hercules, CA). Total lysates (20 µg of protein) were resolved on 12% SDS-PAGE gels and transferred to nitrocellulose membranes as described previously (14) . Blots were probed for 16 hours at 4°C with relevant primary antibodies diluted 1:1,000 in blocking buffer and developed with species-specific secondary antibodies (sheep antimouse horseradish peroxidase, donkey antirabbit horseradish peroxidase, 1:2,000, diluted in blocking buffer, obtained from Amersham, Arlington Heights, IL) for 2 hours at 4°C. Blots were developed by enhanced chemiluminescence (Renaissance, NEN, Boston, MA).

Electrophoretic Mobility Shift Assays.
Cells were incubated with 10,000 units/mL IFN{alpha} in MEM containing 1% serum, harvested by trypsinization, resuspended in 0.5 mL buffer A [10 mmol/L HEPES (pH 7.9), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 1.0 mmol/L EDTA and 3% glycerol], lysed by addition of 0.5 mL buffer B (buffer A containing 10% NP40) and gently layered onto a cushion of 3 mL buffer C (containing 10 mmol/L Tris (pH 7.4), 1.5 mmol/L MgCl2, 25% glycerol). Nuclei were collected by centrifugation for 5 minutes at 3,000 rpm. The pellets were washed with 1 mL cold PBS, and nuclear protein was extracted by resuspending the nuclei and rotating them in a buffer containing 20 mmol/L HEPES (pH 7.9), 400 mmol/L NaCl, 1.0 mmol/L EDTA, 1 mmol/L DTT and 1 mmol/L phenylmethylsulfonyl fluoride at 4°C for 30 minutes. Insoluble material was collected by centrifugation at 12,000 x g for 15 minutes at 4°C, and supernatants were snap-frozen and stored at –80°C. Protein concentrations were determined by the Bradford method.

The cis-inducible element oligonucleotide (GTGCATTTGCCGTAAATCTTGTCTACA) containing a consensus binding site for Stat1 (15) was obtained from Santa Cruz Biotechnology. An aliquot of nuclear extract (10 µg of protein) in 19 µL of binding reaction mixture was incubated at room temperature for 20 minutes with 5X binding buffer (5 mmol/L MgCl2, 2.5 mmol/L EDTA, 250 mmol/L KCl, 50 mmol/L Tris (pH 7.5), and 20% glycerol) and 1 µg of poly(dI·dC). The [{gamma}-32P]ATP-labeled cis-inducible element oligonucleotide (50,000 cpm) was incubated with the above binding reaction for 20 minutes at room temperature. For competition experiments, a 150-fold excess of specific unlabeled double-stranded oligonucleotide was added to the binding reaction. The identity of shifted complexes was confirmed by including an anti-Stat-1 E-23X (Santa Cruz Biotechnology) antibody (2 µg) in the reaction mixture ("supershift" analysis). Protein-DNA complexes were resolved by electrophoresis for 3.5 hours at 150V on 5% polyacrylamide gels, and protein-DNA complexes were detected by autoradiography.

Quantification of Caspase-8-Like Protease Activity.
Cells were then treated with 10,000 units/mL IFN{alpha} with or without 50 µmol/L IETDfmk for 48 hours. In control experiments, cells were treated with 50 ng/mL recombinant human TRAIL (R&D Systems) with or without 50 µmol/L IETDfmk for 3 hours. Caspase-8 activity was measured in cytosolic extracts as described for caspase-3 previously (16) . Liberated AFC fluorescence was determined at 400 nm excitation and 505 nm emission on a Shimadzu 1500 spectrofluorometer (Shimadzu, Kyoto, Japan).

RNase Protection Assays.
Cells were preincubated overnight in MEM medium containing 1% serum and then exposed to 10,000 units/mL IFN{alpha} for 8 hours. We isolated total RNA from cultured cells using an RNeasy kit (Qiagen, Valencia, CA), and RNase protection assay was done using a RiboQuant Multi-Probe kit and the Apo-3D probe set (BD Biosciences, San Diego, CA) according to the manufacturers’ instructions.

Quantification TRAIL Protein Expression.
Cells were incubated with 10,000 units/mL IFN{alpha} for 48 hours. The Centricon filtration system (10,000 kDa cutoff, Amicon, Bedford, MA) was used to concentrate conditioned media, and cell pellets were lysed for 30 minutes in a buffer supplied by the manufacturer. The concentrated conditioned media and cellular extracts were assayed for TRAIL content by ELISA according to the manufacturer’s instructions. TRAIL standard curves were generated for each experiment and were used to calculate sample TRAIL content by linear regression analysis. Surface TRAIL expression was measured by immunofluorescence staining and flow cytometry as described previously (17) .


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Concentration-Dependent Effects of IFN{alpha} on Apoptosis.
We exposed a panel of 20 human bladder cancer cell lines to increasing concentrations of recombinant IFN{alpha} (Roferon) and measured apoptosis-associated DNA fragmentation 48 hours later by PI staining and FACS analysis. Six of the cell lines displayed statistically significant (P < 0.05) increases in apoptosis (Fig. 1Citation ; Table 1Citation ). Further analyses with representative IFN-sensitive and IFN-resistant cell lines revealed that resistance was not caused by major defects in IFN receptor-mediated signal transduction. Specifically, although the levels of IFN{alpha}-induced STAT-1 phosphorylation (Fig. 2A)Citation and IRF-1 protein accumulation (Fig. 2B)Citation seemed to be somewhat lower in IFN-resistant cells, IFN{alpha} stimulated comparable increases in STAT-1 DNA binding activity in all of the lines examined (Fig. 2C)Citation .



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. IFN{alpha}-induced apoptosis. Cells were incubated with the indicated concentrations of IFN{alpha} for 48 hours, and DNA fragmentation was measured by propidium iodide staining and FACS analysis. Mean ± SD, n = 3.

 

View this table:
[in this window]
[in a new window]

 
Table 1 IFN and TRAIL sensitivity in 20 human bladder cancer cell lines

 


View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. IFN-induced signal transduction in representative IFN-sensitive and IFN-resistant cell lines. A. IFN-induced STAT1 phosphorylation. Phosphorylated STAT1 levels were determined by immunoblotting as described in "Materials and Methods." Results are from one experiment that was characteristic of three. B, IFN-induced accumulation of IRF-1. IRF-1 protein levels were determined by immunoblotting as described in "Materials and Methods." Results of one experiment typical of 3. C, IFN-induced STAT1 DNA binding. STAT1 DNA binding activity was measured by electrophoretic mobility shift assay as described in "Materials and Methods." Lanes c, cold competition; Lanes ss, supershift with anti-STAT1 antibody. Results are representative of those obtained in three separate experiments.

 
IFN-Induced Apoptosis Is Associated with Caspase-8-Like Protease Activation.
Recent studies suggest that death receptors are involved in IFN-mediated apoptosis in other model systems (18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29) . Therefore, we investigated the effects of IFN{alpha} caspase-8 activation, which is an early event associated with death receptor ligation. Consistent with the hypothesis, IFN{alpha} induced time-dependent (data not shown) caspase-8-like protease activation in both of the IFN-sensitive cell lines examined (Fig. 3A)Citation . The levels of caspase-8 activation were similar to those observed in cells treated with recombinant human TRAIL, and caspase-8 activation was blocked by the peptide caspase-8 inhibitor, IETDfmk (ref. 30 ; Fig. 3ACitation and data not shown). Immunoblotting confirmed that IFN{alpha} promoted the conversion of procaspase-8 into the processed/active form of the protease (Fig. 3B)Citation . IETDfmk also reduced the levels of IFN-induced DNA fragmentation to background in all of the cell lines tested (Fig. 3C)Citation .



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Role of caspase-8 in IFN{alpha}-induced apoptosis. A, IFN{alpha}-induced caspase-8 activation. Caspase-8-like protease activity was measured in cytosolic extracts with IETD-AFC as described in "Materials and Methods." Mean ± SD, n = 3. B, IFN{alpha}-induced proteolytic processing of caspase-8. The processed (active) fragment of caspase-8 was measured by immunoblotting as described in "Materials and Methods." Results shown are typical of those obtained in three separate experiments. C, effects of a peptide caspase-8 inhibitor. Cells were treated with 10,000 units/mL IFN{alpha} for 48 hours in the absence or presence of 50 µmol/L IETDfmk, and DNA fragmentation was quantified by propidium iodide staining and FACS analysis as described in "Materials and Methods." Mean ± SD, n = 3.

 
Role of TRAIL in IFN-Induced Apoptosis.
We next investigated the effects of IFN{alpha} on the expression of death receptor pathway components using multiprobe RNase protection assays. IFN increased TRAIL mRNA levels in all of the IFN-sensitive lines (Fig. 4A)Citation and in most of the IFN-resistant lines (Fig. 4B)Citation . The TRAIL receptor, DR4, was also up-regulated by IFN in most of the cell lines (Fig. 4)Citation . Some of the cell lines also displayed increases in Fas expression (Fig. 4A and B)Citation , but these changes were less dramatic and were not observed in the majority of IFN-sensitive cells (Fig. 4A)Citation . A small subset of IFN-resistant cells (n = 3) failed to display any increase in TRAIL mRNA levels in response to IFN treatment (Fig. 4C)Citation . IFN also increased TRAIL protein production in most of the cell lines (15 of 20) as measured by ELISA (Table 1)Citation . Surface staining and FACS analysis confirmed that IFN increased surface TRAIL expression in IFN-sensitive (RT-4) as well as IFN-resistant (UM-UC5, UM-UC7, UM-UC11) bladder cancer cells (Fig. 4D)Citation .



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effects of IFN{alpha} on death receptor pathway mRNA and surface TRAIL expression. Death receptor pathway transcripts were measured by multiprobe RNase protection assay as described in "Materials and Methods." Results shown are representative of three separate experiments. A, IFN-sensitive cell lines. TNFR, tumor necrosis factor receptor; RIP, receptor-interacting protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. B, IFN-resistant cell lines that expressed TRAIL. C, IFN-resistant cell lines that did not express TRAIL. D, surface TRAIL expression was measured by immunofluorescence staining and FACS analysis as described in "Materials and Methods." Results are representative of those obtained in three independent experiments. Blue traces, staining controls; red traces, untreated cells; green traces, cells treated with 10,000 units/mL IFN{alpha} for 24 hours. The rightward shift in the green peak indicates increased surface TRAIL expression.

 
We used a neutralizing anti-TRAIL antibody (25 , 26 , 29) to determine whether or not IFN-induced apoptosis was dependent on TRAIL production. The antibody significantly inhibited IFN-induced DNA fragmentation in four of six of the cell lines (Fig. 5Citation and data not shown). The antibody also consistently reduced levels of IFN-induced DNA fragmentation in the UM-UC6 cells, but the differences observed did not reach statistical significance, and it had no effect in UM-UC-10 cells (data not shown), presumably because they do not express TRAIL (Table 1)Citation . In other experiments neither a blocking anti-Fas antibody nor an isotype-matched control antibody had any effect on IFN-induced DNA fragmentation (data not shown).



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effects of a blocking anti-TRAIL antibody on IFN{alpha}-induced apoptosis. Cells were incubated with 10,000 units/mL IFN{alpha} for 48 hours in the absence or presence of a blocking anti-TRAIL antibody (10 µg/mL), and DNA fragmentation was measured by propidium iodide staining and FACS analysis as described in "Materials and Methods." Mean ± SD, n = 3. Levels of inhibition were as follows: 253J-P, 59%; RT4, 56%; UM-UC-4, 37%; UM-UC-6, 23% (not statistically significant); UM-UC-10, 0%; UM-UC-12, 48%.

 
Effects of Exogenous TRAIL on Apoptosis.
Because most of the IFN-resistant cell lines produced TRAIL in response to IFN{alpha}, we wondered whether TRAIL resistance could account for IFN resistance. To address this possibility, we incubated the 20 bladder cancer cell lines in our panel for 24 hours in the absence or presence of 50 ng/mL recombinant human TRAIL and quantified the levels of DNA fragmentation by PI/FACS. Most of the cell lines (16 of 20) displayed significant increases in DNA fragmentation, but the magnitudes of the responses were heterogeneous (Table 1)Citation .

Effects of Bortezomib on IFN-Induced Apoptosis.
Some of the most impressive IFN-induced increases in TRAIL production were observed in cell lines that were resistant to TRAIL-induced apoptosis (i.e., UM-UC-7, Table 1Citation ). We therefore wondered whether an agent that is capable of enhancing TRAIL sensitivity would also sensitize cells to IFN{alpha}. The proteasome inhibitor, bortezomib, functions as an extremely potent TRAIL sensitizing agent in TRAIL-resistant bladder cancer cells (Fig. 6ACitation 4 ). Furthermore, bortezomib synergized with IFN to promote apoptosis in cells that were completely resistant to IFN alone (Fig. 6A)Citation . The blocking anti-TRAIL antibody partially inhibited these effects and also reduced the levels of DNA fragmentation observed in the UM-UC5 cells treated with bortezomib alone (Fig. 6B)Citation , presumably because direct cytotoxic effects of bortezomib involved the TRAIL that was produced by the cells at baseline (Fig. 4D)Citation . These results strongly suggest that modulation of TRAIL sensitivity can enhance IFN-induced apoptosis.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Synergistic effects of bortezomib (Velcade, PS-341) and IFN on apoptosis. A, effects of bortezomib on IFN- and TRAIL-induced DNA fragmentation. Cells were incubated with IFN (10,000 units/mL) for 24 hours or recombinant human TRAIL (25 ng/mL) for 12 hours in the absence or presence of 10 nmol/L bortezomib (BZ), and DNA fragmentation was quantified by PI/FACS. Mean ± SD, n = 3. B, effects of a blocking anti-TRAIL antibody on apoptosis. Cells were incubated with IFN, bortezomib, or both agents in the absence or presence of a blocking anti-TRAIL antibody (10 mg/mL) for 24 hours, and DNA fragmentation was measured by PI/FACS. Mean ± SD, n = 3. *, P < 0.05 versus control. {square}, UM-UC-5; {blacksquare}, UM-UC-7.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous studies in human bladder xenografts have shown that IFN{alpha} is a strong inhibitor of bladder cancer growth in vitro and in vivo. The antiangiogenic effects of IFN have been linked to its ability to down-regulate tumor angiogenesis by inhibiting angiogenic factor production and stimulating the expression of antiangiogenic proteins (9, 10, 11 , 31) . Here we investigated effects of IFN on apoptosis within a diverse panel of 20 human bladder cancer cell lines. Thirty percent of the lines displayed statistically significant, IFN-induced increases in DNA fragmentation. Analysis of the molecular mechanisms involved revealed a central role for autocrine TRAIL production in the responses observed, consistent with observations made in other model systems (25 , 26 , 29 , 32 , 33) . The failure of IFN{alpha} to stimulate apoptosis in the other 14 lines was not caused by global defect(s) in IFN signal transduction or TRAIL expression. Assuming that this panel of cell lines reflects the spectrum of tumors found in patients, our results suggest that IFN-induced apoptosis will contribute to tumor growth inhibition in a subset of cases and that specific strategies to reverse baseline IFN resistance will have a major impact on its clinical activity.

Although TRAIL expression was important for IFN-mediated apoptosis, other mechanisms also contributed to cell death. The most obvious example of this was found in the UM-UC-10 cells, which were among the most IFN-sensitive lines in the panel but did not express TRAIL in response to IFN treatment (Fig. 1Citation , Table 1Citation ). Previous studies have implicated the transcription factor IRF-1 and the protein kinase regulated by RNA (PKR) in IFN-induced apoptosis in other model systems (28) , making them attractive candidate mediators of this TRAIL-independent cell death.

Most of the cell lines that produced the largest amounts of TRAIL (UC5, UC7, UC11, and UC17) were among the least sensitive to IFN, and some of them were cross-resistant to exogenous TRAIL. We found that these cells could be sensitized to IFN by treating them with the proteasome inhibitor, bortezomib, a potent TRAIL-sensitizing agent (Fig. 6ACitation ; ref. 34, 35, 36 ). The apoptosis induced by IFN plus bortezomib was inhibited by a neutralizing anti-TRAIL antibody (Fig. 6B)Citation , which suggests that cell death was at least partially TRAIL-dependent. Thus, other TRAIL sensitizers (flavopiridol, histone deacetylase inhibitors; ref. 37, 38, 39, 40 ) may also synergize with IFN{alpha} to promote the killing of this subset of cells.

IFN{alpha} and other immunomodulators are considered among the most active bladder cancer therapies, but it has been impossible to predict which patients will benefit from them. A very recent study found that urine TRAIL levels correlated with response in patients treated with BCG for superficial TCC (6) , and IFNs are among the cytokines implicated in the effects of this agent. In ongoing studies, we are using quantitative immunofluorescence-based methods to measure TRAIL expression and apoptosis in biopsies obtained from patients enrolled in a clinical trial designed to measure the biological effects of IFN{alpha} in patients with TCC in a neoadjuvant setting. It is possible that by monitoring TRAIL expression and apoptosis, we will be able to identify those patients who are benefiting from systemic IFN at an early point in the course of therapy.


    FOOTNOTES
 
Grant support: by a SPORE in Bladder Cancer (P50 CA91846, Project 3) to R. Millikan, H.B. Grossman, W. Benedict, C.P.N. Dinney, and D. McConkey.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: David McConkey, Department of Cancer Biology -173, University of Texas M. D. Anderson Cancer Center 1515 Holcombe Boulevard, Houston, Texas 77030. Phone 713-792-8591; Fax: 713-792-8747; E-mail: dmcconke{at}mdanderson.org

4 L.M. Lashinger, S.A. Williams, M. Schrader, C.P.N. Dinney, and D.J. McConkey, manuscript submitted. Back

Received 5/31/04. Revised 9/ 2/04. Accepted 10/12/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Coplen DE, Marcus MD, Myers JA, Ratliff TL, Catalona WJ Long-term followup of patients treated with 1 or 2, 6-week courses of intravesical bacillus Calmette-Guerin: analysis of possible predictors of response free of tumor. J Urol 1990;144:652-7.[Medline]
  2. Bohle A, Nowc C, Ulmer AJ, Musehold, et al Detection of urinary TNF, IL 1, and IL 2 after local BCG immunotherapy for bladder carcinoma. Cytokine 1990;2:175-81.[CrossRef][Medline]
  3. Bohle A, Nowc C, Ulmer AJ, et al Elevations of cytokines interleukin-1, interleukin-2 and tumor necrosis factor in the urine of patients after intravesical bacillus Calmette-Guerin immunotherapy. J Urol 1990;144:59-64.[Medline]
  4. Shapiro A, Kadmon D, Catalona WJ, Ratliff TL Immunotherapy of superficial bladder cancer. J Urol 1982;128:891-4.[Medline]
  5. Jackson AM, Prescott S, Hawkyard SJ, James K, Chisholm G The immunomodulatory effects of urine from patients with superficial bladder cancer receiving intravesical evans BCG therapy. Cancer Immunol Immunother 1993;36:25-30.[CrossRef][Medline]
  6. Ludwig AT, Moore JM, Luo Y, et al Tumor necrosis factor-related apoptosis-inducing ligand: a novel mechanism for Bacillus Calmette-Guerin-induced antitumor activity. Cancer Res 2004;64:3386-90.[Abstract/Free Full Text]
  7. Kamat AM, Lamm DL Immunotherapy for bladder cancer. Curr Urol Rep 2001;2:62-9.[Medline]
  8. O’Donnell MA Combined bacillus Calmette-Guerin and interferon use in superficial bladder cancer. Expert Rev Anticancer Ther 2003;3:809-21.[CrossRef][Medline]
  9. Izawa JI, Sweeney P, Perrotte P, et al Inhibition of tumorigenicity and metastasis of human bladder cancer growing in athymic mice by interferon-beta gene therapy results partially from various antiangiogenic effects including endothelial cell apoptosis. Clin Cancer Res 2002;8:1258-70.[Abstract/Free Full Text]
  10. Slaton JW, Karashima T, Perrotte P, et al Treatment with low-dose interferon-alpha restores the balance between matrix metalloproteinase-9 and E-cadherin expression in human transitional cell carcinoma of the bladder. Clin Cancer Res 2001;7:2840-53.[Abstract/Free Full Text]
  11. Slaton JW, Perrotte P, Inoue K, Dinney CP, Fidler IJ Interferon-alpha-mediated down-regulation of angiogenesis-related genes and therapy of bladder cancer are dependent on optimization of biological dose and schedule. Clin Cancer Res 1999;5:2726-34.[Abstract/Free Full Text]
  12. Dinney CP, Fishbeck R, Singh RK, et al Isolation and characterization of metastatic variants from human transitional cell carcinoma passaged by orthotopic implantation in athymic nude mice. J Urol 1995;154:1532-8.[CrossRef][Medline]
  13. Nicholson DW, Ali A, Thornberry NA, et al Identification and inhibition of the ICE/ced-3 protease necessary for mammalian apoptosis. Nature (Lond) 1995;376:37-43.[CrossRef][Medline]
  14. Kamat AM, Karashima T, Davis DW, et al The proteasome inhibitor bortezomib synergizes with gemcitabine to block the growth of human 253JB-V bladder tumors in vivo. Mol Cancer Ther 2004;3:279-90.[Abstract/Free Full Text]
  15. Shuai K, Ziemiecki A, Wilks AF, et al Polypeptide signalling to the nucleus through tyrosine phosphorylation of Jak and Stat proteins. Nature (Lond) 1993;366:580-3.[CrossRef][Medline]
  16. Nawrocki ST, Bruns CJ, Harbison MT, et al Effects of the proteasome inhibitor PS-341 on apoptosis and angiogenesis in orthotopic human pancreatic tumor xenografts. Mol Cancer Ther 2002;1:1243-53.[Abstract/Free Full Text]
  17. Kemp TJ, Moore JM, Griffith TS Human B cells express functional TRAIL/Apo-2 ligand after CpG-containing oligodeoxynucleotide stimulation. J Immunol 2004;173:892-9.[Abstract/Free Full Text]
  18. Panayiotidis P, Ganeshaguru K, Foroni L, Hoffbrand AV Expression and function of the FAS antigen in B chronic lymphocytic leukemia and hairy cell leukemia. Leukemia 1995;9:1227-32.[Medline]
  19. Xu X, Fu XY, Plate J, Chong AS IFN-gamma induces cell growth inhibition by Fas-mediated apoptosis: requirement of STAT1 protein for up-regulation of Fas and FasL expression. Cancer Res 1998;58:2832-7.[Abstract/Free Full Text]
  20. Bernassola F, Scheuerpflug C, Herr I, Krammer PH, Debatin KM, Melino G Induction of apoptosis by IFNgamma in human neuroblastoma cell lines through the CD95/CD95L autocrine circuit. Cell Death Differ 1999;6:652-60.[CrossRef][Medline]
  21. Kaser A, Nagata S, Tilg H Interferon alpha augments activation-induced T cell death by upregulation of Fas (CD95/APO-1) and Fas ligand expression. Cytokine 1999;11:736-43.[CrossRef][Medline]
  22. Lee JK, Sayers TJ, Brooks AD, et al IFN-gamma-dependent delay of in vivo tumor progression by Fas overexpression on murine renal cancer cells. J Immunol 2000;164:231-9.[Abstract/Free Full Text]
  23. Ahn EY, Pan G, Vickers SM, McDonald JM IFN-gamma upregulates apoptosis-related molecules and enhances Fas-mediated apoptosis in human cholangiocarcinoma. Int J Cancer 2002;100:445-51.[CrossRef][Medline]
  24. Schwartzberg LS, Petak I, Stewart C, et al Modulation of the Fas signaling pathway by IFN-gamma in therapy of colon cancer: phase I trial and correlative studies of IFN-gamma, 5-fluorouracil, and leucovorin. Clin Cancer Res 2002;8:2488-98.[Abstract/Free Full Text]
  25. Oshima K, Yanase N, Ibukiyama C, et al Involvement of TRAIL/TRAIL-R interaction in IFN-alpha-induced apoptosis of Daudi B lymphoma cells. Cytokine 2001;14:193-201.[CrossRef][Medline]
  26. Chawla-Sarkar M, Leaman DW, Borden EC Preferential induction of apoptosis by interferon (IFN)-beta compared with IFN-alpha2: correlation with TRAIL/Apo2L induction in melanoma cell lines. Clin Cancer Res 2001;7:1821-31.[Abstract/Free Full Text]
  27. Chawla-Sarkar M, Leaman DW, Jacobs BS, Borden EC IFN-beta pretreatment sensitizes human melanoma cells to TRAIL/Apo2 ligand-induced apoptosis. J Immunol 2002;169:847-55.[Abstract/Free Full Text]
  28. Chawla-Sarkar M, Lindner DJ, Liu YF, et al Apoptosis and interferons: role of interferon-stimulated genes as mediators of apoptosis. Apoptosis 2003;8:237-49.[CrossRef][Medline]
  29. Chen Q, Gong B, Mahmoud-Ahmed AS, et al Apo2L/TRAIL and Bcl-2-related proteins regulate type I interferon-induced apoptosis in multiple myeloma. Blood 2001;98:2183-92.[Abstract/Free Full Text]
  30. Garcia-Calvo M, Peterson EP, Leiting B, Ruel R, Nicholson DW, Thornberry NA Inhibition of human caspases by peptide-based and macromolecular inhibitors. J Biol Chem 1998;273:32608-13.[Abstract/Free Full Text]
  31. Pavlovich CP, Kraling BM, Stewart RJ, et al BCG-induced urinary cytokines inhibit microvascular endothelial cell proliferation. J Urol 2000;163:2014-21.[CrossRef][Medline]
  32. Shin EC, Ahn JM, Kim CH, et al IFN-gamma induces cell death in human hepatoma cells through a TRAIL/death receptor-mediated apoptotic pathway. Int J Cancer 2001;93:262-8.[CrossRef][Medline]
  33. Choi EA, Lei H, Maron DJ, et al Stat1-dependent induction of tumor necrosis factor-related apoptosis-inducing ligand and the cell-surface death signaling pathway by interferon beta in human cancer cells. Cancer Res 2003;63:5299-307.[Abstract/Free Full Text]
  34. An J, Sun YP, Adams J, Fisher M, Belldegrun A, Rettig MB Drug interactions between the proteasome inhibitor bortezomib and cytotoxic chemotherapy, tumor necrosis factor (TNF) alpha, and TNF-related apoptosis-inducing ligand in prostate cancer. Clin Cancer Res 2003;9:4537-45.[Abstract/Free Full Text]
  35. Johnson TR, Stone K, Nikrad M, et al The proteasome inhibitor PS-341 overcomes TRAIL resistance in Bax and caspase 9-negative or Bcl-xL overexpressing cells. Oncogene 2003;22:4953-63.[CrossRef][Medline]
  36. Sayers TJ, Brooks AD, Koh CY, et al The proteasome inhibitor PS-341 sensitizes neoplastic cells to TRAIL-mediated apoptosis by reducing levels of c-FLIP. Blood 2003;102:303-10.[Abstract/Free Full Text]
  37. Kim DM, Koo SY, Jeon K, et al Rapid induction of apoptosis by combination of flavopiridol and tumor necrosis factor (TNF)-alpha or TNF-related apoptosis-inducing ligand in human cancer cell lines. Cancer Res 2003;63:621-6.[Abstract/Free Full Text]
  38. Taniai M, Grambihler A, Higuchi H, et al Mcl-1 mediates tumor necrosis factor-related apoptosis-inducing ligand resistance in human cholangiocarcinoma cells. Cancer Res 2004;64:3517-24.[Abstract/Free Full Text]
  39. Rosato RR, Almenara JA, Dai Y, Grant S Simultaneous activation of the intrinsic and extrinsic pathways by histone deacetylase (HDAC) inhibitors and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) synergistically induces mitochondrial damage and apoptosis in human leukemia cells. Mol Cancer Ther 2003;2:1273-84.[Abstract/Free Full Text]
  40. Guo F, Sigua C, Tao J, et al Cotreatment with histone deacetylase inhibitor LAQ824 enhances Apo-2L/tumor necrosis factor-related apoptosis inducing ligand-induced death inducing signaling complex activity and apoptosis of human acute leukemia cells. Cancer Res 2004;64:2580-9.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. B. Lesinski, E. T. Raig, K. Guenterberg, L. Brown, M. R. Go, N. N. Shah, A. Lewis, M. Quimper, E. Hade, G. Young, et al.
IFN-{alpha} and Bortezomib Overcome Bcl-2 and Mcl-1 Overexpression in Melanoma Cells by Stimulating the Extrinsic Pathway of Apoptosis
Cancer Res., October 15, 2008; 68(20): 8351 - 8360.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. A. Hadaschik, K. Zhang, A. I. So, L. Fazli, W. Jia, J. C. Bell, M. E. Gleave, and P. S. Rennie
Oncolytic Vesicular Stomatitis Viruses Are Potent Agents for Intravesical Treatment of High-Risk Bladder Cancer
Cancer Res., June 15, 2008; 68(12): 4506 - 4510.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Yoshimoto, N. Morishima, I. Mizoguchi, M. Shimizu, H. Nagai, S. Oniki, M. Oka, C. Nishigori, and J. Mizuguchi
Antiproliferative Activity of IL-27 on Melanoma
J. Immunol., May 15, 2008; 180(10): 6527 - 6535.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Lechner, N. Malloth, T. Seppi, B. Beer, P. Jennings, and W. Pfaller
IFN-{alpha} induces barrier destabilization and apoptosis in renal proximal tubular epithelium
Am J Physiol Cell Physiol, January 1, 2008; 294(1): C153 - C160.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. A. O'Brien, M. A. Richardson, S. F. Mehrbod, D. T. Berg, B. Gerlitz, A. Gupta, and B. W. Grinnell
Activated Protein C Decreases Tumor Necrosis Factor Related Apoptosis-Inducing Ligand by an EPCR- Independent Mechanism Involving Egr-1/Erk-1/2 Activation
Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2634 - 2641.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. M. Kamat, G. Sethi, and B. B. Aggarwal
Curcumin potentiates the apoptotic effects of chemotherapeutic agents and cytokines through down-regulation of nuclear factor-{kappa}B and nuclear factor-{kappa}B-regulated gene products in IFN-{alpha}-sensitive and IFN-{alpha}-resistant human bladder cancer cells
Mol. Cancer Ther., March 1, 2007; 6(3): 1022 - 1030.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. Papageorgiou, A. Kamat, W. F. Benedict, C. Dinney, and D. J. McConkey
Combination therapy with IFN-{alpha} plus bortezomib induces apoptosis and inhibits angiogenesis in human bladder cancer cells
Mol. Cancer Ther., December 1, 2006; 5(12): 3032 - 3041.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Khanbolooki, S. T. Nawrocki, T. Arumugam, R. Andtbacka, M. S. Pino, R. Kurzrock, C. D. Logsdon, J. L. Abbruzzese, and D. J. McConkey
Nuclear factor-{kappa}B maintains TRAIL resistance in human pancreatic cancer cells.
Mol. Cancer Ther., September 1, 2006; 5(9): 2251 - 2260.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Wu, X. Xiao, P. Zhao, G. Xue, Y. Zhu, X. Zhu, L. Zheng, Y. Zeng, and W. Huang
Minicircle-IFN{gamma} Induces Antiproliferative and Antitumoral Effects in Human Nasopharyngeal Carcinoma
Clin. Cancer Res., August 1, 2006; 12(15): 4702 - 4713.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Kemp, A. T. Ludwig, J. K. Earel, J. M. Moore, R. L. VanOosten, B. Moses, K. Leidal, W. M. Nauseef, and T. S. Griffith
Neutrophil stimulation with Mycobacterium bovis bacillus Calmette-Guerin (BCG) results in the release of functional soluble TRAIL/Apo-2L
Blood, November 15, 2005; 106(10): 3474 - 3482.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Minami, M. Adachi, R. Kawamura, Y. Zhang, Y. Shinomura, and K. Imai
Sulindac Enhances the Proteasome Inhibitor Bortezomib-Mediated Oxidative Stress and Anticancer Activity
Clin. Cancer Res., July 15, 2005; 11(14): 5248 - 5256.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Papageorgiou, A.
Right arrow Articles by McConkey, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Papageorgiou, A.
Right arrow Articles by McConkey, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online