| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Departments of 1 Cancer Biology, 2 Genitourinary Medical Oncology, and 3 Urology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
on tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression and apoptosis in a panel of 20 human bladder cancer cell lines. Six (30%) displayed significant DNA fragmentation in response to increasing concentrations of IFN (10–100,000 units/mL). In these lines IFN induced early activation of caspase-8, and DNA fragmentation was blocked by a caspase-8-selective inhibitor (IETDfmk), consistent with the involvement of death receptor(s) in cell death. IFN stimulated marked increases in TRAIL mRNA and protein in the majority of IFN-sensitive and IFN-resistant cell lines. A blocking anti-TRAIL antibody significantly inhibited IFN-induced DNA fragmentation in four of six IFN-sensitive cell lines, confirming that TRAIL played a direct role in cell death. Bortezomib (PS-341, Velcade), a potent TRAIL-sensitizing agent, increased sensitivity to IFN in two of the IFN-resistant cell lines that produced large amounts of TRAIL in response to IFN treatment. Our data show that IFN-induced apoptosis in bladder cancer cells frequently involves autocrine TRAIL production. Combination therapy strategies aimed at overcoming TRAIL resistance may be very effective in restoring IFN sensitivity in a subset of human bladder tumors. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(2
, 3)
, IFNs (4
, 5)
, and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a death receptor ligand that triggers tumor cell apoptosis after binding its surface receptors (DR4, DR5; ref. 6
). Recent work indicates that IFNs also display promising activity in TCC (7)
and that they can augment the effects of local BCG (8)
. Importantly, unlike BCG, IFN can be delivered systemically, allowing it to be used in patients with disseminated cancer. Preclinical studies have shown that IFNs prevent the growth of orthotopic human bladder tumors in nude mice by inhibiting angiogenesis (9, 10, 11)
. However, the possibility that IFNs can also directly induce apoptosis in human bladder cancer cells has not been systematically addressed. We therefore undertook the present study to characterize the effects of IFN on apoptosis within a panel of common TCC cell lines and identify the molecular mechanisms underlying cell death. |
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Interferon--2A (Roferon, Roche Applied Science, Indianapolis, IN) was purchased from the University of Texas M. D. Anderson Cancer Center Pharmacy. Recombinant TRAIL, the antihuman TRAIL neutralizing monoclonal antibody, and the TRAIL ELISA kit were purchased from R&D Systems (Minneapolis, MN). Other antibodies were obtained from the following commercial sources: IFN regulatory factor-1 (IRF-1, Santa Cruz Biotechnology, Santa Cruz, CA), phosphorylated STAT1 (Cell Signaling, Beverly, MA), caspase-8 (BD Pharmigen, San Diego, CA), Bortezomib (Velcade, PS-341) was provided by Millennium Pharmaceuticals, Inc (Cambridge, MA). Caspase-8-selective inhibitor (IETDfmk) and synthetic substrate (IETD-AFC) were obtained from Enzyme Systems Products, Inc. (Dublin, CA).
Quantification of Apoptosis by Propidium Iodide Staining and Fluorescence-Activated Cell Sorter Analysis.
DNA fragmentation was measured by propidium iodide staining and fluorescence-activated cell sorter (PI/FACS) as described previously (13
, 14)
. Cells were stored for at least 1 at 4°C in PI solution before analysis by flow cytometry. Cells that contain a subdiploid DNA content are considered apoptotic (14)
.
Measurement of STAT-1 Phosphorylation and IRF-1 Protein Accumulation.
Cells were incubated with 10,000 unit/mL IFN for the times indicated and lysed for 4 hours at 4°C in lysis buffer [1% Triton X-100, 150 mmol/L NaCl, 25 mmol/L Tris (pH 7.5), 1 mmol/L glycerol phosphate, 1 mmol/L sodium orthovanadate, 1 mmol/L sodium fluoride and a protease inhibitor mixture (Complete Mini tablet, Roche Applied Science)]. Postnuclear extracts were obtained by centrifuging the lysates for 15 minutes at 14,000 rpm (4°C). Protein concentrations were determined by the Bradford method (Bio-Rad, Inc., Hercules, CA). Total lysates (20 µg of protein) were resolved on 12% SDS-PAGE gels and transferred to nitrocellulose membranes as described previously (14)
. Blots were probed for 16 hours at 4°C with relevant primary antibodies diluted 1:1,000 in blocking buffer and developed with species-specific secondary antibodies (sheep antimouse horseradish peroxidase, donkey antirabbit horseradish peroxidase, 1:2,000, diluted in blocking buffer, obtained from Amersham, Arlington Heights, IL) for 2 hours at 4°C. Blots were developed by enhanced chemiluminescence (Renaissance, NEN, Boston, MA).
Electrophoretic Mobility Shift Assays.
Cells were incubated with 10,000 units/mL IFN in MEM containing 1% serum, harvested by trypsinization, resuspended in 0.5 mL buffer A [10 mmol/L HEPES (pH 7.9), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 1.0 mmol/L EDTA and 3% glycerol], lysed by addition of 0.5 mL buffer B (buffer A containing 10% NP40) and gently layered onto a cushion of 3 mL buffer C (containing 10 mmol/L Tris (pH 7.4), 1.5 mmol/L MgCl2, 25% glycerol). Nuclei were collected by centrifugation for 5 minutes at 3,000 rpm. The pellets were washed with 1 mL cold PBS, and nuclear protein was extracted by resuspending the nuclei and rotating them in a buffer containing 20 mmol/L HEPES (pH 7.9), 400 mmol/L NaCl, 1.0 mmol/L EDTA, 1 mmol/L DTT and 1 mmol/L phenylmethylsulfonyl fluoride at 4°C for 30 minutes. Insoluble material was collected by centrifugation at 12,000 x g for 15 minutes at 4°C, and supernatants were snap-frozen and stored at –80°C. Protein concentrations were determined by the Bradford method.
The cis-inducible element oligonucleotide (GTGCATTTGCCGTAAATCTTGTCTACA) containing a consensus binding site for Stat1 (15)
was obtained from Santa Cruz Biotechnology. An aliquot of nuclear extract (10 µg of protein) in 19 µL of binding reaction mixture was incubated at room temperature for 20 minutes with 5X binding buffer (5 mmol/L MgCl2, 2.5 mmol/L EDTA, 250 mmol/L KCl, 50 mmol/L Tris (pH 7.5), and 20% glycerol) and 1 µg of poly(dI·dC). The [
-32P]ATP-labeled cis-inducible element oligonucleotide (50,000 cpm) was incubated with the above binding reaction for 20 minutes at room temperature. For competition experiments, a 150-fold excess of specific unlabeled double-stranded oligonucleotide was added to the binding reaction. The identity of shifted complexes was confirmed by including an anti-Stat-1 E-23X (Santa Cruz Biotechnology) antibody (2 µg) in the reaction mixture ("supershift" analysis). Protein-DNA complexes were resolved by electrophoresis for 3.5 hours at 150V on 5% polyacrylamide gels, and protein-DNA complexes were detected by autoradiography.
Quantification of Caspase-8-Like Protease Activity.
Cells were then treated with 10,000 units/mL IFN with or without 50 µmol/L IETDfmk for 48 hours. In control experiments, cells were treated with 50 ng/mL recombinant human TRAIL (R&D Systems) with or without 50 µmol/L IETDfmk for 3 hours. Caspase-8 activity was measured in cytosolic extracts as described for caspase-3 previously (16)
. Liberated AFC fluorescence was determined at 400 nm excitation and 505 nm emission on a Shimadzu 1500 spectrofluorometer (Shimadzu, Kyoto, Japan).
RNase Protection Assays.
Cells were preincubated overnight in MEM medium containing 1% serum and then exposed to 10,000 units/mL IFN for 8 hours. We isolated total RNA from cultured cells using an RNeasy kit (Qiagen, Valencia, CA), and RNase protection assay was done using a RiboQuant Multi-Probe kit and the Apo-3D probe set (BD Biosciences, San Diego, CA) according to the manufacturers’ instructions.
Quantification TRAIL Protein Expression.
Cells were incubated with 10,000 units/mL IFN for 48 hours. The Centricon filtration system (10,000 kDa cutoff, Amicon, Bedford, MA) was used to concentrate conditioned media, and cell pellets were lysed for 30 minutes in a buffer supplied by the manufacturer. The concentrated conditioned media and cellular extracts were assayed for TRAIL content by ELISA according to the manufacturer’s instructions. TRAIL standard curves were generated for each experiment and were used to calculate sample TRAIL content by linear regression analysis. Surface TRAIL expression was measured by immunofluorescence staining and flow cytometry as described previously (17)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
on Apoptosis. (Roferon) and measured apoptosis-associated DNA fragmentation 48 hours later by PI staining and FACS analysis. Six of the cell lines displayed statistically significant (P < 0.05) increases in apoptosis (Fig. 1
; Table 1
). Further analyses with representative IFN-sensitive and IFN-resistant cell lines revealed that resistance was not caused by major defects in IFN receptor-mediated signal transduction. Specifically, although the levels of IFN-induced STAT-1 phosphorylation (Fig. 2A)
and IRF-1 protein accumulation (Fig. 2B)
seemed to be somewhat lower in IFN-resistant cells, IFN stimulated comparable increases in STAT-1 DNA binding activity in all of the lines examined (Fig. 2C)
.
|
|
|
caspase-8 activation, which is an early event associated with death receptor ligation. Consistent with the hypothesis, IFN induced time-dependent (data not shown) caspase-8-like protease activation in both of the IFN-sensitive cell lines examined (Fig. 3A)
. The levels of caspase-8 activation were similar to those observed in cells treated with recombinant human TRAIL, and caspase-8 activation was blocked by the peptide caspase-8 inhibitor, IETDfmk (ref. 30
; Fig. 3A
and data not shown). Immunoblotting confirmed that IFN promoted the conversion of procaspase-8 into the processed/active form of the protease (Fig. 3B)
. IETDfmk also reduced the levels of IFN-induced DNA fragmentation to background in all of the cell lines tested (Fig. 3C)
.
|
on the expression of death receptor pathway components using multiprobe RNase protection assays. IFN increased TRAIL mRNA levels in all of the IFN-sensitive lines (Fig. 4A)
and in most of the IFN-resistant lines (Fig. 4B)
. The TRAIL receptor, DR4, was also up-regulated by IFN in most of the cell lines (Fig. 4)
. Some of the cell lines also displayed increases in Fas expression (Fig. 4A and B)
, but these changes were less dramatic and were not observed in the majority of IFN-sensitive cells (Fig. 4A)
. A small subset of IFN-resistant cells (n = 3) failed to display any increase in TRAIL mRNA levels in response to IFN treatment (Fig. 4C)
. IFN also increased TRAIL protein production in most of the cell lines (15 of 20) as measured by ELISA (Table 1)
. Surface staining and FACS analysis confirmed that IFN increased surface TRAIL expression in IFN-sensitive (RT-4) as well as IFN-resistant (UM-UC5, UM-UC7, UM-UC11) bladder cancer cells (Fig. 4D)
.
|
and data not shown). The antibody also consistently reduced levels of IFN-induced DNA fragmentation in the UM-UC6 cells, but the differences observed did not reach statistical significance, and it had no effect in UM-UC-10 cells (data not shown), presumably because they do not express TRAIL (Table 1)
. In other experiments neither a blocking anti-Fas antibody nor an isotype-matched control antibody had any effect on IFN-induced DNA fragmentation (data not shown).
|
, we wondered whether TRAIL resistance could account for IFN resistance. To address this possibility, we incubated the 20 bladder cancer cell lines in our panel for 24 hours in the absence or presence of 50 ng/mL recombinant human TRAIL and quantified the levels of DNA fragmentation by PI/FACS. Most of the cell lines (16 of 20) displayed significant increases in DNA fragmentation, but the magnitudes of the responses were heterogeneous (Table 1)
.
Effects of Bortezomib on IFN-Induced Apoptosis.
Some of the most impressive IFN-induced increases in TRAIL production were observed in cell lines that were resistant to TRAIL-induced apoptosis (i.e., UM-UC-7, Table 1
). We therefore wondered whether an agent that is capable of enhancing TRAIL sensitivity would also sensitize cells to IFN. The proteasome inhibitor, bortezomib, functions as an extremely potent TRAIL sensitizing agent in TRAIL-resistant bladder cancer cells (Fig. 6A
4
). Furthermore, bortezomib synergized with IFN to promote apoptosis in cells that were completely resistant to IFN alone (Fig. 6A)
. The blocking anti-TRAIL antibody partially inhibited these effects and also reduced the levels of DNA fragmentation observed in the UM-UC5 cells treated with bortezomib alone (Fig. 6B)
, presumably because direct cytotoxic effects of bortezomib involved the TRAIL that was produced by the cells at baseline (Fig. 4D)
. These results strongly suggest that modulation of TRAIL sensitivity can enhance IFN-induced apoptosis.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
is a strong inhibitor of bladder cancer growth in vitro and in vivo. The antiangiogenic effects of IFN have been linked to its ability to down-regulate tumor angiogenesis by inhibiting angiogenic factor production and stimulating the expression of antiangiogenic proteins (9, 10, 11
, 31)
. Here we investigated effects of IFN on apoptosis within a diverse panel of 20 human bladder cancer cell lines. Thirty percent of the lines displayed statistically significant, IFN-induced increases in DNA fragmentation. Analysis of the molecular mechanisms involved revealed a central role for autocrine TRAIL production in the responses observed, consistent with observations made in other model systems (25
, 26 , 29
, 32
, 33)
. The failure of IFN to stimulate apoptosis in the other 14 lines was not caused by global defect(s) in IFN signal transduction or TRAIL expression. Assuming that this panel of cell lines reflects the spectrum of tumors found in patients, our results suggest that IFN-induced apoptosis will contribute to tumor growth inhibition in a subset of cases and that specific strategies to reverse baseline IFN resistance will have a major impact on its clinical activity.
Although TRAIL expression was important for IFN-mediated apoptosis, other mechanisms also contributed to cell death. The most obvious example of this was found in the UM-UC-10 cells, which were among the most IFN-sensitive lines in the panel but did not express TRAIL in response to IFN treatment (Fig. 1
, Table 1
). Previous studies have implicated the transcription factor IRF-1 and the protein kinase regulated by RNA (PKR) in IFN-induced apoptosis in other model systems (28)
, making them attractive candidate mediators of this TRAIL-independent cell death.
Most of the cell lines that produced the largest amounts of TRAIL (UC5, UC7, UC11, and UC17) were among the least sensitive to IFN, and some of them were cross-resistant to exogenous TRAIL. We found that these cells could be sensitized to IFN by treating them with the proteasome inhibitor, bortezomib, a potent TRAIL-sensitizing agent (Fig. 6A
; ref. 34, 35, 36
). The apoptosis induced by IFN plus bortezomib was inhibited by a neutralizing anti-TRAIL antibody (Fig. 6B)
, which suggests that cell death was at least partially TRAIL-dependent. Thus, other TRAIL sensitizers (flavopiridol, histone deacetylase inhibitors; ref. 37, 38, 39, 40
) may also synergize with IFN to promote the killing of this subset of cells.
IFN and other immunomodulators are considered among the most active bladder cancer therapies, but it has been impossible to predict which patients will benefit from them. A very recent study found that urine TRAIL levels correlated with response in patients treated with BCG for superficial TCC (6)
, and IFNs are among the cytokines implicated in the effects of this agent. In ongoing studies, we are using quantitative immunofluorescence-based methods to measure TRAIL expression and apoptosis in biopsies obtained from patients enrolled in a clinical trial designed to measure the biological effects of IFN in patients with TCC in a neoadjuvant setting. It is possible that by monitoring TRAIL expression and apoptosis, we will be able to identify those patients who are benefiting from systemic IFN at an early point in the course of therapy.
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: David McConkey, Department of Cancer Biology -173, University of Texas M. D. Anderson Cancer Center 1515 Holcombe Boulevard, Houston, Texas 77030. Phone 713-792-8591; Fax: 713-792-8747; E-mail: dmcconke{at}mdanderson.org
4 L.M. Lashinger, S.A. Williams, M. Schrader, C.P.N. Dinney, and D.J. McConkey, manuscript submitted. 
Received 5/31/04. Revised 9/ 2/04. Accepted 10/12/04.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  B. A. Hadaschik, K. Zhang, A. I. So, L. Fazli, W. Jia, J. C. Bell, M. E. Gleave, and P. S. Rennie Oncolytic Vesicular Stomatitis Viruses Are Potent Agents for Intravesical Treatment of High-Risk Bladder Cancer Cancer Res., June 15, 2008; 68(12): 4506 - 4510. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yoshimoto, N. Morishima, I. Mizoguchi, M. Shimizu, H. Nagai, S. Oniki, M. Oka, C. Nishigori, and J. Mizuguchi Antiproliferative Activity of IL-27 on Melanoma J. Immunol., May 15, 2008; 180(10): 6527 - 6535. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Lechner, N. Malloth, T. Seppi, B. Beer, P. Jennings, and W. Pfaller IFN-{alpha} induces barrier destabilization and apoptosis in renal proximal tubular epithelium Am J Physiol Cell Physiol, January 1, 2008; 294(1): C153 - C160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. O'Brien, M. A. Richardson, S. F. Mehrbod, D. T. Berg, B. Gerlitz, A. Gupta, and B. W. Grinnell Activated Protein C Decreases Tumor Necrosis Factor Related Apoptosis-Inducing Ligand by an EPCR- Independent Mechanism Involving Egr-1/Erk-1/2 Activation Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2634 - 2641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Kamat, G. Sethi, and B. B. Aggarwal Curcumin potentiates the apoptotic effects of chemotherapeutic agents and cytokines through down-regulation of nuclear factor-{kappa}B and nuclear factor-{kappa}B-regulated gene products in IFN-{alpha}-sensitive and IFN-{alpha}-resistant human bladder cancer cells Mol. Cancer Ther., March 1, 2007; 6(3): 1022 - 1030. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Papageorgiou, A. Kamat, W. F. Benedict, C. Dinney, and D. J. McConkey Combination therapy with IFN-{alpha} plus bortezomib induces apoptosis and inhibits angiogenesis in human bladder cancer cells Mol. Cancer Ther., December 1, 2006; 5(12): 3032 - 3041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Khanbolooki, S. T. Nawrocki, T. Arumugam, R. Andtbacka, M. S. Pino, R. Kurzrock, C. D. Logsdon, J. L. Abbruzzese, and D. J. McConkey Nuclear factor-{kappa}B maintains TRAIL resistance in human pancreatic cancer cells. Mol. Cancer Ther., September 1, 2006; 5(9): 2251 - 2260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wu, X. Xiao, P. Zhao, G. Xue, Y. Zhu, X. Zhu, L. Zheng, Y. Zeng, and W. Huang Minicircle-IFN{gamma} Induces Antiproliferative and Antitumoral Effects in Human Nasopharyngeal Carcinoma Clin. Cancer Res., August 1, 2006; 12(15): 4702 - 4713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Kemp, A. T. Ludwig, J. K. Earel, J. M. Moore, R. L. VanOosten, B. Moses, K. Leidal, W. M. Nauseef, and T. S. Griffith Neutrophil stimulation with Mycobacterium bovis bacillus Calmette-Guerin (BCG) results in the release of functional soluble TRAIL/Apo-2L Blood, November 15, 2005; 106(10): 3474 - 3482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minami, M. Adachi, R. Kawamura, Y. Zhang, Y. Shinomura, and K. Imai Sulindac Enhances the Proteasome Inhibitor Bortezomib-Mediated Oxidative Stress and Anticancer Activity Clin. Cancer Res., July 15, 2005; 11(14): 5248 - 5256. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, UM-UC-5; 
, UM-UC-7.