Cancer Research Audrey Hepburn Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujimoto, A.
Right arrow Articles by Hoon, D. S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujimoto, A.
Right arrow Articles by Hoon, D. S. B.
[Cancer Research 64, 2245-2250, March 15, 2004]
© 2004 American Association for Cancer Research

Regular Articles

Allelic Imbalance of 12q22–23 Associated with APAF-1 Locus Correlates with Poor Disease Outcome in Cutaneous Melanoma

Akihide Fujimoto1, Hiroya Takeuchi1, Bret Taback1, Eddy C. Hsueh2, David Elashoff3, Donald L. Morton2 and Dave S. B. Hoon1

1 Department of Molecular Oncology, 2 Division of Surgical Oncology, John Wayne Cancer Institute, Saint John’s Health Center, Santa Monica, and 3 Department of Biomathematics, University of California Los Angeles, School of Medicine, Los Angeles, California


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cutaneous melanoma is a highly aggressive tumor that is relatively resistant to chemotherapy and radiotherapy. This resistance may be in part due to inhibition of apoptosis. Apoptotic protease activating factor-1(APAF-1), a candidate tumor suppressor gene, mediates p53-induced apoptosis, and its loss promotes oncogenic transformation. To determine whether loss of the APAF-1 locus influences tumor progression, we assessed loss of heterozygosity microsatellites on the APAF-1 locus (12q22–23) in 62 primary and 112 metastatic melanomas. We discovered that frequency of allelic imbalance was significantly higher in metastatic tumors (n = 36 of 98; 37%) than in primary melanomas (n = 10 of 54; 19%; P = 0.02). In metastatic melanomas, APAF-1 loss significantly correlated with a worse prognosis (P < 0.05) in the patients, and its loss during melanoma tumor progression suggests that APAF-1 is a tumor suppressor gene. Furthermore, loss of heterozygosity was frequent in the 12q22–23 chromosome region centromeric to the APAF-1 locus suggesting that other tumor-related genes may be present in the 12q22–23 region. In summary, the study demonstrates that allelic imbalance in the 12q22–23 region is a genomic surrogate of poor disease outcome for cutaneous melanoma patients.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Malignant cutaneous melanoma can be a highly aggressive neoplasm. Systemic metastasis is often unresponsive to chemotherapy or radiation therapy. The mechanism of this resistance is not clearly understood. However, studies have shown that p53 mutations can prevent chemotherapy-induced apoptosis of solid tumors. p53 mutation is of low frequency in cutaneous melanoma (1, 2, 3) . APAF-1, a key factor in the mitochondrial apoptotic pathway downstream of p53 (4) , may be associated with this melanoma chemoresistance. Activated p53 is a transcriptional transactivator of genes and targets APAF-1 by the following pathway: p53 controls the release of cytochrome c from mitochondria during apoptosis (4, 5, 6, 7) . In the presence of cytochrome c, APAF-1 can bind to procaspase 9 forming an apoptosome. Activation of caspase 9 in the apoptosome results in activation of downstream caspases such as 3, 6, and 7 (8) . Consequently, the loss of APAF-1 leads to defects in the execution of apoptotic cell death and may account for cellular resistance to chemo-, radio-, and immunotherapy.

APAF-1 was originally shown to be located at chromosome loci 12q22–23, and frequent loss of heterozygosity (LOH) in this region has been reported in male germ cell tumors (9, 10, 11) , and pancreatic, ovarian, and gastric carcinomas (12, 13, 14, 15, 16) . Soengas et al. (17) recently demonstrated LOH on the APAF-1 gene locus (12q22–23) of 10 of 24 (42%) metastatic melanomas; LOH was associated with loss of APAF-1 mRNA expression. Their conclusion was that APAF-1 was inactivated in metastatic melanomas. However, Soengas et al. (17) did not examine the inactivation of APAF-1 in primary melanomas or its potential role in tumor progression.

Since the time of publication of the study by Soengas et al. (17) , there has been a significant reassessment of the APAF-1 gene location. New data published in the National Center for Biotechnology Information database indicates that the APAF-1 gene is more distant (>0.3 Mb) to the centromere on chromosome 12q. This significant change must be considered in reviewing previous reports that have used a different location. Because of such findings APAF-1 gene status by LOH analysis of this region mandates reanalysis.

The role of APAF-1 in other cancers has not been well studied. In leukemia, APAF-1 status has been examined as a prognostic factor; no correlation was demonstrated between APAF-1 expression level and the response to chemotherapy in acute leukemia (18) . In pancreatic ductal adenocarcinoma, LOH at 12q24 near the APAF-1 locus has been associated with poor prognosis (14) . However, no major reports or detailed studies have examined allelic imbalance in the 12q22–23 region of primary and metastatic melanoma, and no correlative studies of APAF-1 status with the progression and prognosis of cutaneous melanoma exist. To examine the role of APAF-1 loss in melanoma, we assessed LOH of the APAF-1 locus as a surrogate marker of disease outcome in primary and metastatic melanomas.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Tumor DNA Collection and Preparation.
Primary (n = 62) and metastatic melanoma (n = 112) were collected from 164 patients including 10 cases, in which we collected paired primary and metastatic tumors. Institutional Review Board approval for study of human subjects from Saint John’s Health Center and John Wayne Cancer Institute joint committee were obtained before study initiation. Tumor tissues were reviewed by the pathologist to confirm histopathologic status. Melanoma tissue sections were cut at 5-µm thickness and stained with hematoxylin for microdissection. Tumor cells were collected using the PixCell II Laser Capture Microdissection System (Arcturus Engineering, Mountain View, CA) as described previously (19) . Captured cells were digested with proteinase K at 50°C overnight, followed by heat denaturation at 95°C for 10 min. Lysate was directly used for PCR as described previously (19 , 20) . Control (nontumor) DNA for each melanoma patient was obtained from their peripheral blood lymphocytes when available, or microdissected from tumor-adjacent normal tissue as described previously (20) .

Microsatellite Analysis.
LOH was assessed using four microsatellite markers (D12S1657, D12S393, D12S1706, and D12S346) encompassing the APAF-1 gene locus (12q22–23). For primary melanoma, microsatellite marker D9S157, one of the most frequent LOH markers in cutaneous melanoma, was also examined as a control marker. PCR primer sets for specific allele loci were obtained from Research Genetics, Inc. (Huntsville, AL). Forward primers were labeled with WellRed phosphoramidite-linked dye or active ester-labeled dye. The PCR amplification was performed in a 10-µl reaction volume with 1-µl template for 40 cycles of 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C, followed by a 7-min final extension at 72°C. PCR product separation was performed using capillary array electrophoresis (CAE CEQ 8000XL; Beckman Coulter, Inc., Fullerton, CA). Peak signal intensity and relative size were generated by fragment analysis system software (Beckman Coulter). Tumors were scored as exhibiting LOH when one allele showed >=50% reduction of peak intensity for tumor DNA as compared with the corresponding allele identified in the control DNA. The markers showing homozygosity, microsatellite instabilities, and insufficient PCR amplification were scored as noninformative. We considered a specimen to be APAF-1 LOH positive when LOH is found for any of four markers assessed, and considered specimens to be APAF-1 LOH negative if they demonstrated retention of allele closer to APAF-1 locus than the marker that is found LOH positive. Eight primary melanomas and 12 metastatic melanomas were excluded from APAF-1 LOH evaluation because less than two markers was informative. In cases of doubtful LOH interpretation, sample assays were repeated to verify and confirm the results.

Reverse Transcription-PCR Assay.
For APAF-1 mRNA expression analysis, one to five 5-µm-thick H&E-stained sections were prepared from 22 paraffin-embedded melanoma tumors (1 primary melanoma and 21 metastatic melanomas). Tumor tissues were microdissected using Laser Capture Microdissection. RNA was extracted using a modified protocol of the Paraffin Block RNA Isolation kit (Ambion, Austin, TX), and total RNA was quantified (21) . Reverse-transcriptase reactions were performed using Moloney murine leukemia virus reverse-transcriptase (Promega, Madison, WI) with oligo-dT and random hexamer primers, as described previously (22) . For all specimen analysis the PCR reaction mixture contained cDNA template from 250 ng of total RNA: 1 µM of APAF-1 F primer 5'-ACATTTC TCACGATGCTACC-3'; 1 µM of APAF-1 R primer 5'-CAATTCATGAAGTGGCAA-3'; and 0.3 µM FRET probe 5'FAM-TGCTGACAAGACTGCAAAGATCTG-BHQ-1 3'. Positive controls used in all of the assays were paraffin-embedded normal lymph nodes and melanoma cell line. Negative control was all of the PCR reagents with no template. The housekeeping gene GAPDH was used as an internal reference gene to determine the integrity of RNA, and the data collected was subsequentially used to normalize APAF-1 mRNA expression level. Quantitative reverse transcription-PCR assay was performed on the iCycer iQ RealTime thermocycler detection system (Bio-Rad Laboratories, Hercules, CA; Ref. 21 ). The standard curve was established for quantifying mRNA copy numbers by using nine known copy numbers of serial diluted (100-108 copies) plasmids containing respective APAF-1 and GAPDH cDNA. Copy numbers of APAF-1 and GAPDH mRNA were established by the respective standard curve. APAF-1 mRNA level was determined by APAF-1:GAPDH mRNA log ratio (21) .

APAF-1 Promoter Region Methylation Analysis.
Methylation of APAF-1 promoter region was assessed in 19 of 22 samples that we analyzed, APAF-1 mRNA expression and also an additional 30 metastatic melanomas. The assay involved sodium bisulfite modification followed by methylation-specific PCR to determine the methylation status of APAF-1 promoter region as described previously (23) . As a positive and negative control, SssI methylase-treated and untreated normal DNA was used, respectively. Sodium bisulfite modification was performed as reported previously (24) . Methylation-specific PCR was performed using fluorescent labeled methylation and unmethylation specific primers. Primers used for amplification were as follows, methylated APAF-1 F primer 5'GTCGTTGTTCGAGTTCGGTA3', R primer 5'GCGTAAAAATACCCGCCTAC3'; unmethylated APAF-1 F primer 5'GGGTGTGTTGTTGTTGTTTGA3' and R primer 5'AAATACCCACCTACCCCACA3'.

Detection of PCR products was analyzed by capillary array electrophoresis as described in microsatellite analysis.

Statistical Analysis.
The relation between APAF-1 LOH and other variables were assessed using Fisher’s exact test. To investigate the association between APAF-1 LOH and APAF-1 mRNA expression, Student’s t test was used. Survival was determined from the date of melanoma surgery to death or last follow-up. Survival curves were assessed by the Kaplan-Meier method, and differences between curves were analyzed using the log-rank test. Cox’s proportional hazard regression models were used for multivariate and univariate analyses and for calculation of the risk-ratio (25) . Stepwise variable selection was adopted with a selection rule of P < 0.1 for variables.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
LOH Frequency in Primary Melanomas.
In the analysis of 62 primary melanomas, the frequencies of LOH for each microsatellite marker in informative cases were 20%, 31%, 13%, 17%, and 47% at D12S1657, D12S393, D12S1706, D12S346, and D9S157, respectively (Table 1)Citation . D9S157, one of the most frequent microsatellite markers with LOH found in primary cutaneous melanomas, was used as a control marker for assay efficiency. Allelic imbalance of this control marker (D9S157) was detected in 3 of 10 (30%) thin (<=1.0 mm) primary melanomas. Representative results are shown in Fig. 1Citation . APAF-1 LOH was identified in 10 of 54 primary melanomas (17%; Table 2Citation ) by the defined criteria outlined in "Materials and Methods." When stratified according to the primary tumor Breslow thickness, the frequency of APAF-1 LOH in primary melanomas of <=1.0 mm, 1.01–2.0 mm, 2.01–4.0 mm, and >4.0 mm was 0% (0 of 8), 14% (2 of 14), 25% (4 of 16), and 21% (3 of 14), respectively. Breslow thickness data were not available in 2 patients. There was no significant pattern of APAF-1 LOH related to any particular Breslow thickness as additionally evidenced by the lack of significance in APAF-1 LOH frequency between <=1.0 mm and >1.0 mm melanomas or between <=2.0 mm and >2.0 mm melanomas. Age, sex, and site showed no significant correlation with APAF-1 LOH in primary melanomas.


View this table:
[in this window]
[in a new window]

  		Table 1 Frequency of LOHa of microsatellite markers at 12q22–23b

 


View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Representative electrophoregram analysis of primary and metastatic melanomas demonstrating loss of heterozygosity (LOH) at microsatellite markers D12S1657 and D12S393.

 

View this table:
[in this window]
[in a new window]

  		Table 2 Primary melanoma patients characteristics

 
LOH Frequency in Metastatic Melanomas.
In the analysis of 112 metastatic melanomas, the frequency of LOH for each microsatellite marker in informative cases was 23%, 35%, 17%, and 21% at D12S1657, D12S393, D12S1706, and D12S346, respectively (Table 1)Citation . APAF-1 LOH was found in 36 of 98 metastatic melanoma patients (37%) by the defined criteria in the "Material and Methods" (Table 3)Citation . The frequency of allelic imbalance was significantly higher in metastatic melanomas than in primary melanomas (P = 0.02), but there was no significant difference in the frequency of allelic imbalance associated with American Joint Committee on Cancer (AJCC) stage III (36%) versus stage IV (38%) melanoma patients. We then stratified the AJCC stage III patients into patients with regional lymph node metastasis (RLM; n = 44) or in-transit metastasis (ITM; n = 39) because of their known pathological and clinical outcome differences. Although both RLM and ITM are classified as AJCC stage III disease, their outcomes are vastly different; ITM have an unusual propensity to recur rapidly and frequently after excision of the lesions (20) . In our analysis, ITM demonstrated a trend toward more frequent APAF-1 LOH than RLM, although this difference was not significant (P = 0.09).


View this table:
[in this window]
[in a new window]

  		Table 3 Metastatic melanoma patients characteristics

 
Comparison between Paired Primary and Metastatic Tumors.
To additionally assess whether APAF-1 was associated with tumor progression, we assessed 10 paired primary and metastatic tumors. Frequency of allelic imbalance at the APAF-1 locus was 70% in metastatic lesions versus 20% in primary tumors (Fig. 2)Citation . Only 1 patient showed LOH in the primary tumor that was not detected in the paired metastatic lesion. This finding may be due in part to primary tumor heterogeneity or it may involve a different tumor clone from the primary lesion that produced the metastasis. Nevertheless, the finding of more prevalent loss of APAF-1 gene loci in metastases compared with primary tumors suggests a role in tumor progression.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Loss of heterozygosity (LOH) on APAF-1 locus (chromosome 12q22–23) between matched primary and metastatic melanoma tumors. P, primary melanoma; M, metastatic melanoma; R, retention of heterozygosity; L, loss of heterozygosity; and H, homozygous; and ND, not determined.

 
APAF-1 mRNA Expression.
Twenty-two melanomas (1 primary and 21 metastatic) were assessed for correlation of APAF-1 mRNA expression and LOH in chromosome 12q22–23. APAF-1 mRNA expression level was normalized with GAPDH mRNA. APAF-1 mRNA expression levels were significantly different between APAF-1 LOH positive and negative tumors (Student’s t test, P = 0.030). Seven of 10 (70%) tumors with APAF-1 LOH had decreased APAF-1 mRNA level (APAF-1:GAPDH log ratio <0.1), whereas 5 of 12 (42%) tumors that demonstrated APAF-1 gene retention decreased APAF-1 mRNA level (Fig. 3)Citation . Our work supports previous work (17) indicating that APAF-1 LOH decreased APAF-1 mRNA expression. This observation demonstrated a haploinsufficiency effect of LOH of APAF-1 locus. We assessed APAF-1 promoter methylation by methylation-specific PCR. No methylation of APAF-1 promoter region was found in all 49 of the tumor specimens assessed.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Correlation between APAF-1 loss of heterozygosity (LOH) and mRNA expression level in 22 melanoma tumors. APAF-1:GAPDH log ratio was used to determine the loss of APAF-1 mRNA level. R, retention of heterozygosity; L, loss of heterozygosity; and H, homozygous.

 
APAF-1 LOH Correlation with Survival.
To additionally determine whether the identification of APAF-1 loss in melanoma relates to tumor progression and affects disease outcome, APAF-1 locus imbalance in relation to disease outcome was analyzed. Fifty-two primary and 97 metastatic melanomas were assessed in patients with clinical follow-up data. In patients with primary melanoma, there was no correlation between APAF-1 status and overall survival at a mean follow-up of 39 months (log-rank test; P = 0.43; Fig. 4ACitation ). In contrast, in patients with AJCC stage III/IV melanoma, the presence of APAF-1 LOH in their metastatic tumor was significantly associated with a decreased overall survival at a mean follow-up of 27 months (log-rank test; P = 0.049; Fig. 4BCitation ). Interestingly, when we applied the APAF-1 LOH definition for the previously located APAF-1 locus between D12S1657 and D12S393, allelic imbalance in that region also significantly correlated with a decreased overall survival in AJCC stage III/IV patients (log-rank test; P = 0.05; Fig. 4CCitation ).



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Correlation between survival and: (A) APAF-1 LOH in primary melanoma; (B) APAF-1 LOH in AJCC stage III/IV metastatic melanoma; and (C) allelic imbalance between D12S1657 and D12S393 of AJCC stage III/IV metastatic melanoma. Both sets of Kaplan-Meier curves for AJCC stage III/IV melanoma (B and C) show a significant correlation between presence of the genetic aberration and decreased survival.

 
The difference in overall survival of patients with APAF-1 LOH in their metastatic melanoma was more apparent in AJCC stage III (Fig. 5A)Citation than stage IV melanoma (log-rank test; P = 0.03, P = 0.81, respectively). AJCC stage III melanomas were additionally categorized into RLM and ITM, because each type of regional metastasis has a distinct pathology and clinical outcome. APAF-1 LOH in RLM had a significantly worse survival outcome (log-rank test, P = 0.02) compared with APAF-1 LOH in ITM (log-rank test, P = 0.17; Fig. 5, B and CCitation ). Cox’s proportional hazards models for stage III metastatic tumors showed that APAF-1 LOH had a significant effect on overall survival (risk ratio 1.35; 95% confidence interval, 1.02–1.79; P = 0.04) in univariate analysis. For multivariate analysis, only the AJCC stage III metastatic pattern (RLM versus ITM) and APAF-1 LOH were chosen as variables by stepwise variable selection (RLM versus ITM, risk ratio 0.76; 95% confidence interval, 0.57–1.02; P = 0.07; and APAF-1 LOH, risk ratio 1.44; 95% confidence interval, 1.08–1.93; P = 0.01).



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Correlation between survival and APAF-1 loss of heterozygosity (LOH) in AJCC stage III melanoma (A), AJCC stage III melanoma with regional lymph node metastasis (B), and AJCC stage III melanoma with in-transit metastasis (C). Kaplan-Meier survival curves (A and B) demonstrated that APAF-1 LOH (+) group had a significantly poorer overall survival compared with the APAF-1 LOH (-) group.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We demonstrated a high frequency of LOH at 12q22–23 locus in primary and metastatic melanomas. For metastatic melanoma, the frequency was similar to that reported by Soengas et al. (17) . However, we demonstrated that the frequency of APAF-1 LOH was significantly lower in primary melanomas than in metastatic melanoma. Among 10 paired primary and metastatic tumors, LOH at the APAF-1 locus was more frequent in metastatic tumors than primary tumors. Furthermore, loss of APAF-1 was a more significant factor for progression than initiation of melanoma. The allelic imbalances at the APAF-1 locus, associated to disease progression, may be the result of genetic alterations accumulated through a prolonged period of chromosomal instability during melanoma progression.

Previous LOH studies in melanoma have shown allelic imbalances on chromosome loci 1p, 3p, 6q, 10q, and 11q, with the most frequent events occurring at 9p21 ranging from approximately 30–50% (26, 27, 28, 29) . Chromosome 12q22–23 should now be considered to have a significant allelic imbalance and is comparable to the frequency of other allelic chromosomal imbalances reported for cutaneous melanoma. Clinicopathological correlations have shown that LOH on 9p and 10q are early events during melanoma progression, followed by LOH on 1p, 6q, and 11q (30 , 31) . LOH on 10q in primary melanoma has been correlated to poor prognosis, and LOH on 6q has been correlated with metastasis (27 , 32 , 33) . These studies need additional validation by larger sample sizes. Although allelic imbalance is frequent on various chromosome regions in melanoma, specific genes for many regions have yet to be identified. Most of the analysis of allelic imbalance in cutaneous melanomas have been performed on metastatic tumors. Very limited studies on large sample sizes have been reported in primary melanomas of different thickness. Our analysis is one of the largest studies for any individual microsatellite region marker in primary melanomas

The reduction of mRNA in tumors with LOH of APAF-1 locus demonstrated haploinsufficiency. We do not know what is the critical level of APAF-1 mRNA that relates to its functional activity at this time. We found that some cases expressed APAF-1 mRNA at lower level despite the absence of APAF-1 LOH. There may be other inactivating mechanisms of APAF-1. One possible mechanism is methylation of APAF-1. We also analyzed APAF-1 promoter region hypermethylation by sodium bisulfite modification-based methylation-specific PCR assay and did not detect APAF-1 promotor region hypermethylation. Soengas et al. (17) also examined hypermethylation on CpG islands in the APAF-1 5' untranslated region, but no extensive methylation was found in this region. Interestingly, they showed reactivation of APAF-1 by treating cultured melanoma cells with the methylation inhibitor (5-aza-2'-deoxycytidine) or histone deacetylase inhibitor (trichostatin A). This indicates that APAF-1 mRNA expression may be controlled by a promoter region further upstream or by a transcription regulating factor(s).

In a previous study, APAF-1 gene was thought to be located between D12S1657 and D12S393 (17) , but the current genome update of the National Center for Biotechnology Information database indicates that APAF-1 gene is located between D12S1706 and D12S346, which is more distal to the centromere on chromosome 12q. This designation change of >0.3 Mb indicates that the 42% rate of APAF-1 LOH reported by Soengas et al. (17) would decrease to 33%. In our study the frequency of LOH for each marker was relatively higher in D12S1657 and D12S393 than in D12S1706 and D12S346. Survival curve analysis showed a significant difference if APAF-1 LOH was defined to be between D12S1657 and D12S393. The studies strongly suggest the likelihood of another tumor suppressor gene or tumor-related gene in the vicinity of microsatellite markers D12S1657 and D12S393. Additional detailed analysis is needed to identify any potential gene(s) in this region that may influence melanoma progression.

One problem in analyzing LOH is homozygous deletion of the locus of interest. It is difficult to detect homozygous deletion in clinical samples using microsatellite markers, because samples may show retention of an allele due to PCR product amplification from normal cell contamination. According to our definition of APAF-1 LOH, it was considered negative when D12S1706, the nearest marker among markers upstream of APAF-1, showed retention, even if additional marker D12S1657 or D12S393 showed LOH. In such cases, there may be homozygous deletion at D12S1706 locus. This may explain why more frequent LOH was found at D12S1657 and D12S393 than D12S1706 and D12S346.

The ability to escape from apoptosis is a critical factor for melanoma cells to survive under selective pressures such as host immune responses and physiological factors. Although melanoma cells are known to be highly immunogenic compared with other types of cancers they can be highly resistant to host immune attacks. T cells have been demonstrated to kill melanoma cells by granzyme-B-induced apoptosis and tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis. Both apoptotic mechanisms involve the mitochondrial pathway (34) . Loss of APAF-1 gene may play a key role in evasion from immunosurveillance and subsequently influence the response to immunotherapy. This may develop into more of an "antiapoptosis genotype" as metastasis progress. The allelic imbalance of 12q22–23 including the loss of APAF-1 gene appears to be a major facilitator of metastasis.

It is well known that in AJCC stage III/IV melanoma the optimal treatment is surgery. Chemo-, immuno-, and radiotherapy to date have not consistently or significantly improved survival by any substantial levels over the last decade. In our study the significant association between APAF-1 LOH and the survival of patients with stage III and stage IV melanoma supports loss of APAF-1 as an important factor for establishment of metastasis. Of note, there was no correlation between APAF-1 loss or 12q22–23 allelic imbalance and Breslow thickness of the primary tumor. Clinically, increasing Breslow thickness of the primary tumor is significantly associated with worse disease outcomes. This suggests that APAF-1 is not a key factor in vertical growth phase progression in melanomas. More importantly, this suggests that 12q22–23 allelic imbalance or APAF-1 loss are linked to the progression of metastasis rather than the initiation of melanoma.

We have demonstrated the subsequent progressive loss of APAF-1 during different defined stages of melanoma development from primary tumor to systemic metastasis. Our results suggest that APAF-1 gene loss is important for the progression of cutaneous melanoma and becomes a dominant functional genotypic aberration with advancing stage of disease. This was clearly demonstrated in the comparison of primary and metastatic melanomas. If metastatic melanomas are more likely to survive through inactivation of the APAF-1 intrinsic apoptotic pathway, development of therapeutics to supplement APAF-1 function in this pathway might improve treatment efficiency (35) . This APAF-1 gene loss may be used as a potential prognostic marker of metastatic melanoma, and it may indicate likelihood of response to various therapies. Future studies on prospective frozen melanoma tissues may allow validation of the role of this gene loss in melanoma patient disease outcome.

We conclude that LOH at the 12q22–23 region is a significant genetic alteration in melanoma, which may harbor more than one tumor-related gene. The study strongly suggests that APAF-1 gene loss is a clinicopathological factor facilitating melanoma progression. Additional studies are needed to determine whether this regional allelic imbalance contributes to resistance to therapy. If patients with metastatic tumors having 12q22–23 allelic imbalance are unlikely to respond to chemo- or immunotherapy, this observation may be useful as a stratification factor in future therapy protocols. We are entering an era of molecular targeted therapies that are better tailored to specific tumor subsets. Concomitant to this progress, we must have in place reliable determination of in vivo tumor susceptibility to the therapy with the appropriate targeted killing mechanism(s) such as the apoptosis pathway(s) function.


   FOOTNOTES
 
Grant support: PO CA 12528 and PO CA29605 from the National Cancer Institute, NIH and the Roy E. Coates Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Dave Hoon, Department of Molecular Oncology, John Wayne Cancer Institute, 2200 Santa Monica Boulevard, Santa Monica, CA 90404. Phone: (310) 449-5267; Fax: (310) 449-5282; E-mail: hoon{at}jwci.org

Received 9/16/03. Revised 12/24/03. Accepted 1/13/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Albino AP, Vidal MJ, McNutt NS, et al Mutation and expression of the p53 gene in human malignant melanoma. Melanoma Res, 4: 35-45, 1994.[Medline]
  2. Sparrow LE, Soong R, Dawkins HJ, Iacopetta BJ, Heenan PJ. p53 gene mutation and expression in naevi and melanomas. Melanoma Res, 5: 93-100, 1995.[Medline]
  3. Hartmann A, Blaszyk H, Cunningham JS, et al Overexpression and mutations of p53 in metastatic malignant melanomas. Int J Cancer, 67: 313-7, 1996.[CrossRef][Medline]
  4. Robles AI, Bemmels NA, Foraker AB, Harris CC. APAF-1 is a transcriptional target of p53 in DNA damage-induced apoptosis. Cancer Res, 61: 6660-4, 2001.[Abstract/Free Full Text]
  5. Mihara M, Erster S, Zaika A, et al p53 has a direct apoptogenic role at the mitochondria. Mol Cell, 11: 577-90, 2003.[CrossRef][Medline]
  6. Fortin A, Cregan SP, MacLaurin JG, et al APAF1 is a key transcriptional target for p53 in the regulation of neuronal cell death. J Cell Biol, 155: 207-16, 2001.[Abstract/Free Full Text]
  7. Moroni MC, Hickman ES, Denchi EL, et al Apaf-1 is a transcriptional target for E2F and p53. Nat Cell Biol, 3: 552-8, 2001.[CrossRef][Medline]
  8. Li P, Nijhawan D, Budihardjo I, et al Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell, 91: 479-89, 1997.[CrossRef][Medline]
  9. Murty VV, Renault B, Falk CT, Bosl GJ, Kucherlapati R, Chaganti RS. Physical mapping of a commonly deleted region, the site of a candidate tumor suppressor gene, at 12q22 in human male germ cell tumors. Genomics, 35: 562-70, 1996.[CrossRef][Medline]
  10. Murty VV, Chaganti RS. A genetic perspective of male germ cell tumors. Semin Oncol, 25: 133-44, 1998.[Medline]
  11. Murty VV, Montgomery K, Dutta S, et al A 3-Mb high-resolution BAC/PAC contig of 12q22 encompassing the 830-kb consensus minimal deletion in male germ cell tumors. Genome Res, 9: 662-71, 1999.[Abstract/Free Full Text]
  12. Kimura M, Abe T, Sunamura M, Matsuno S, Horii A. Detailed deletion mapping on chromosome arm 12q in human pancreatic adenocarcinoma: identification of a I-cM region of common allelic loss. Genes Chromosomes Cancer, 17: 88-93, 1996.[CrossRef][Medline]
  13. Kimura M, Furukawa T, Abe T, et al Identification of two common regions of allelic loss in chromosome arm 12q in human pancreatic cancer. Cancer Res, 58: 2456-60, 1998.[Abstract/Free Full Text]
  14. Yatsuoka T, Sunamura M, Furukawa T, et al Association of poor prognosis with loss of 12q, 17p, and 18q, and concordant loss of 6q/17p and 12q/18q in human pancreatic ductal adenocarcinoma. Am J Gastroenterol, 95: 2080-5, 2000.[CrossRef][Medline]
  15. Hatta Y, Takeuchi S, Yokota J, Koeffler HP Ovarian cancer has frequent loss of heterozygosity at chromosome 12p12.3–13.1 (region of TEL and Kip1 loci) and chromosome 12q23-ter: evidence for two new tumour-suppressor genes. Br J Cancer, 75: 1256-62, 1997.[Medline]
  16. Schneider BG, Rha SY, Chung HC, et al Regions of allelic imbalance in the distal portion of chromosome 12q in gastric cancer. Mol Pathol, 56: 141-9, 2003.[Abstract/Free Full Text]
  17. Soengas MS, Capodieci P, Polsky D, et al Inactivation of the apoptosis effector Apaf-1 in malignant melanoma. Nature (Lond), 409: 207-11, 2001.[CrossRef][Medline]
  18. Svingen PA, Karp JE, Krajewski S, et al Evaluation of Apaf-1 and procaspases-2, -3, -7, -8, and -9 as potential prognostic markers in acute leukemia. Blood, 96: 3922-31, 2000.[Abstract/Free Full Text]
  19. Hoon DS, Fujimoto A, Shu S, Taback B. Assessment of genetic heterogeneity in tumors using laser capture microdissection. Methods Enzymol, 356: 302-9, 2002.[CrossRef][Medline]
  20. Nakayama T, Taback B, Turner R, Morton DL, Hoon DS. Molecular clonality of in-transit melanoma metastasis. Am J Pathol, 158: 1371-8, 2001.[Abstract/Free Full Text]
  21. Takeuchi H, Kuo C, Morton DL, Wang HJ, Hoon DS. Expression of differentiation melanoma-associated antigen genes is associated with favorable disease outcome in advanced-stage melanomas. Cancer Res, 63: 441-8, 2003.[Abstract/Free Full Text]
  22. Bostick PJ, Morton DL, Turner RR, et al Prognostic significance of occult metastases detected by sentinel lymphadenectomy and reverse transcriptase-polymerase chain reaction in early-stage melanoma patients. J Clin Oncol, 17: 3238-44, 1999.[Abstract/Free Full Text]
  23. Spugnardi M, Tommasi S, Dammann R, Pfeifer GP, Hoon DS. Epigenetic inactivation of RAS association domain family protein 1 (RASSF1A) in malignant cutaneous melanoma. Cancer Res, 63: 1639-43, 2003.[Abstract/Free Full Text]
  24. Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res, 24: 5064-6, 1996.[Abstract/Free Full Text]
  25. Hoon DS, Bostick P, Kuo C, et al Molecular markers in blood as surrogate prognostic indicators of melanoma recurrence. Cancer Res, 60: 2253-7, 2000.[Abstract/Free Full Text]
  26. Healy E, Rehman I, Angus B, Rees JL. Loss of heterozygosity in sporadic primary cutaneous melanoma. Genes Chromosomes Cancer, 12: 152-6, 1995.[Medline]
  27. Healy E, Belgaid C, Takata M, et al Prognostic significance of allelic losses in primary melanoma. Oncogene, 16: 2213-8, 1998.[CrossRef][Medline]
  28. Walker GJ, Palmer JM, Walters MK, Nancarrow DJ, Parsons PG, Hayward NK. Simple tandem repeat allelic deletions confirm the preferential loss of distal chromosome 6q in melanoma. Int J Cancer, 58: 203-6, 1994.[Medline]
  29. Fujimoto A, Morita R, Hatta N, Takehara K, Takata M. p16INK4a inactivation is not frequent in uncultured sporadic primary cutaneous melanoma. Oncogene, 18: 2527-32, 1999.[CrossRef][Medline]
  30. Morita R, Fujimoto A, Hatta N, Takehara K, Takata M. Comparison of genetic profiles between primary melanomas and their metastases reveals genetic alterations and clonal evolution during progression. J Investig Dermatol, 111: 919-24, 1998.[CrossRef][Medline]
  31. Takata M, Morita R, Takehara K. Clonal heterogeneity in sporadic melanomas as revealed by loss-of- heterozygosity analysis. Int J Cancer, 85: 492-7, 2000.[CrossRef][Medline]
  32. Millikin D, Meese E, Vogelstein B, Witkowski C, Trent J. Loss of heterozygosity for loci on the long arm of chromosome 6 in human malignant melanoma. Cancer Res, 51: 5449-53, 1991.[Abstract/Free Full Text]
  33. Shirasaki F, Takata M, Hatta N, Takehara K. Loss of expression of the metastasis suppressor gene KiSS1 during melanoma progression and its association with LOH of chromosome 6q16.3- q23. Cancer Res, 61: 7422-5, 2001.[Abstract/Free Full Text]
  34. Hersey P, Zhang XD. How melanoma cells evade trail-induced apoptosis. Nat Rev Cancer, 1: 142-50, 2001.[CrossRef][Medline]
  35. Satyamoorthy K, Bogenrieder T, Herlyn M. No longer a molecular black box–new clues to apoptosis and drug resistance in melanoma. Trends Mol Med, 7: 191-4, 2001.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
E. C. Ledgerwood and I. M. Morison
Targeting the Apoptosome for Cancer Therapy
Clin. Cancer Res., January 15, 2009; 15(2): 420 - 424.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S. R. Moore, D. L. Persons, J. A. Sosman, D. Bobadilla, V. Bedell, D. D. Smith, S. R. Wolman, R. J. Tuthill, J. Moon, V. K. Sondak, et al.
Detection of Copy Number Alterations in Metastatic Melanoma by a DNA Fluorescence In situ Hybridization Probe Panel and Array Comparative Genomic Hybridization: A Southwest Oncology Group Study (S9431)
Clin. Cancer Res., May 15, 2008; 14(10): 2927 - 2935.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Verhaegen, J. A. Bauer, C. Martin de la Vega, G. Wang, K. G. Wolter, J. C. Brenner, Z. Nikolovska-Coleska, A. Bengtson, R. Nair, J. T. Elder, et al.
A Novel BH3 Mimetic Reveals a Mitogen-Activated Protein Kinase-Dependent Mechanism of Melanoma Cell Death Controlled by p53 and Reactive Oxygen Species
Cancer Res., December 1, 2006; 66(23): 11348 - 11359.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
J Kim, H A Reber, S M Dry, D Elashoff, S L Chen, N Umetani, M Kitago, O J Hines, K K Kazanjian, S Hiramatsu, et al.
Unfavourable prognosis associated with K-ras gene mutation in pancreatic cancer surgical margins
Gut, November 1, 2006; 55(11): 1598 - 1605.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
B. Zhivotovsky and S. Orrenius
Carcinogenesis and apoptosis: paradigms and paradoxes
Carcinogenesis, October 1, 2006; 27(10): 1939 - 1945.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Sawai, Y. Okada, K. Kazanjian, J. Kim, S. Hasan, O. J. Hines, H. A. Reber, D. S.B. Hoon, and G. Eibl
The G691S RET Polymorphism Increases Glial Cell Line-Derived Neurotrophic Factor-Induced Pancreatic Cancer Cell Invasion by Amplifying Mitogen-Activated Protein Kinase Signaling
Cancer Res., December 15, 2005; 65(24): 11536 - 11544.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
Y. Furukawa, K. Sutheesophon, T. Wada, M. Nishimura, Y. Saito, H. Ishii, and Y. Furukawa
Methylation Silencing of the Apaf-1 Gene in Acute Leukemia
Mol. Cancer Res., June 1, 2005; 3(6): 325 - 334.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fujimoto, A.
Right arrow Articles by Hoon, D. S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujimoto, A.
Right arrow Articles by Hoon, D. S. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online