| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Department of Veterinary Biosciences, 2 Division of Human Cancer Genetics, 3 College of Medicine and Public Health, 4 Division of Hematology-Oncology, Comprehensive Cancer Center and The Ohio State University, Columbus, Ohio, and 5 Division of Hematology/Oncology, Department of Medicine, University of California, San Diego, California
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
DNA cytosine methylation is a normal process in development, X chromosome inactivation, parent-of-origin allele-specific imprinting, and tissue-specific gene regulation, and is also observed in some tissues as a function of aging (reviewed in Costello and Plass; Ref. 8 ). DNA methyltransferase enzymes catalyze the addition of a methyl group to the number 5 carbon of a cytosine that is immediately 5' to a guanine (CG dinucleotide). There is a strong association between DNA promoter methylation and transcriptional inactivation, which results in the functional equivalence of a genomic deletion or inactivating mutation (9) . Therefore, it is apparent that aberrant DNA methylation plays an important role in tumor progression. These aberrations include both genome-wide hypomethylation and promoter CpG island hypermethylation. Promoter methylation has been shown to occur to some extent in most tumor types that have been investigated (10, 11, 12) .
CpG island methylation can be assessed on previously identified candidate genes by various techniques (13) . However, this gene-by-gene approach can lead to an underestimation of the overall methylation level in a tumor genome and does not identify novel methylation targets. To address this, our group has used a genome-wide methylation scanning method called Restriction Landmark Genomic Scanning (RLGS; Ref. 14 ). We reported previously hypermethylation in both solid tumors and acute myeloid leukemia (10 , 15) . We found a marked variation in the amount of aberrant methylation in acute myeloid leukemia blasts compared with normal bone marrow, and these methylation events occurred in a nonrandom distribution (16) .
Studies of aberrant methylation in CLL have mostly demonstrated hypomethylation events (reviewed in Refs. 16 , 17 ). Specific hypo-methylated genes include BCL2 (18) , ornithine decarboxylase and Erb-A1 (19) , and TCL1 (20) . Stach et al. (21) , using high-throughput capillary electrophoresis, studied overall genomic hypomethylation in CLL patients recently and found a high degree of interindividual variation between total genomic 5-methylcytosine levels. There are few reports of hypermethylation in CLL, although a recent study by Melki et al. (22) showed methylation of multiple CpG islands in CLL cells when 8 candidate genes were examined by bisulfite sequencing (23 , 24) . To our knowledge, no genome-wide analysis of CpG island methylation has been reported. Here we present the results of using RLGS to interrogate the promoter methylation status in 10 primary CLL samples using two methylation-sensitive restriction enzymes, with direct comparison to normal B lymphocytes. We determined that CLL is characterized by substantial CpG island methylation relative to normal B lymphocytes. In addition, we identified a panel of 193 genes or sequences that are novel targets for methylation in CLL and warrant future investigation in larger studies designed to assess patient impact.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
GGCCGC), and the restriction sites were filled in with [
-32P]dCTP and [
-32P]dGTP. Methylated NotI sites are resistant to digestion and will not be radioactively labeled. After the NotI digest, the DNA was additionally fragmented with EcoRV, electrophoresed overnight in a 0.8% agarose gel, digested in situ with HinfI, and electrophoresed overnight on a 5% nondenaturing acrylamide slab gel. The gel was dried and exposed to X-Omat film (Kodak, Rochester, NY) for 27 days before autoradiography. The procedure for the AscI-EcoRV-HinfI enzyme combination is essentially the same except that DNA is first digested with EcoRV followed by the methylation-sensitive enzyme AscI (recognition site GG
CGCGCC; Ref. 28
).
RLGS Profile Analysis and Spot Cloning.
Paired RLGS profiles from CLL cells and normal tissue (either neutrophils from the same CLL patient or normal donor CD19+ cells) were overlaid, and differences between the two profiles were detected by visual inspection and independently validated by two investigators. In the past we have shown that a decrease of 30% in the relative RLGS fragment intensity is reliably detectable as a methylation event (10)
. The presence of a locus on the profile from normal tissue coupled with the absence of the same locus on the tumor profile is highly suggestive of methylation due to failure of the methylation-sensitive enzyme to cut the DNA and subsequent lack of labeling with radioactive nucleotides. The neutrophils available from 4 patients were useful in ruling out that some differences on the RLGS profiles between CLL cells and normal B cells were not due to polymorphisms. For example, if a spot was present in both of the normal B-cell profiles but absent in the CLL cells from a particular patient, the presence of the spot in the matching normal neutrophils would aid in establishing that spot loss was not due to polymorphism in the CLL patient. For patients without matched neutrophils, our criterion was that the locus in question must be present in both of the normal B cell profiles and absent in the CLL profile to be called a methylation event. Each locus on the normal RLGS profile has a unique identifier as described previously (10)
. Loci of interest were cloned using NotI-EcoRV or AscI-EcoRV arrayed plasmid libraries as described previously, and candidate plasmid clones were confirmed in RLGS mixing gels (29)
.
Sequence Analysis of Cloned Loci.
Once the candidate plasmid was confirmed on a mixing gel (29)
and sequenced from the NotI or AscI end, the sequence was submitted to the BLAT search6
July 2003 freeze to determine chromosomal location and presence or absence of a CpG island. The genomic sequence extending from 2.5 kb upstream and 2.5 kb downstream of the NotI or AscI site was used to determine homology to a gene, mRNA, or expressed sequence tag. A CpG island was classified as 5' if it spanned the region upstream of the transcription start site and/or exon 1, 3' if it occurred in the last exon only, and body if it spanned internal exons but did not include the first or last exon.
Southern Hybridization Analysis.
DNA was either single-digested with 40 units of EcoRV (New England Biolabs, Beverly, MA) for 4 h or double-digested with 40 units of EcoRV for 4 h followed by 20 units of AscI (New England Biolabs) for 4 h. Three and a half µg of each DNA sample were electrophoresed on a 0.8% agarose gel for 16 h at 35 V and transferred by vacuum to a nylon membrane (Zeta Probe; Bio-Rad, Hercules, CA). Probes were prepared by purifying restriction fragments from the AscI-EcoRV plasmid clones, random primed with Prime-It II kit (Stratagene, La Jolla, CA) according to the manufacturers instructions, hybridized overnight, and exposed for 24 h on a Storm PhosphorImager (Molecular Dynamics, Amersham Biosciences, Piscataway, NJ).
Sodium Bisulfite Genomic Sequencing.
One µg of genomic DNA from CLL samples and normal controls was treated with sodium bisulfite according to published protocols (30)
with the minor modification that the DNA purification steps were done with the Gel Extraction kit (Qiagen, Chatsworth, CA). Primers were designed so that they did not contain CG dinucleotides but did contain several non-CpG cytosines that were converted to thymine, thus making them specific for bisulfite-treated DNA only. The GRM7 forward primer was 5'-GGAAAGTTTAGGGGTTTTTGTAGG-3'and the reverse primer was 5'-ATCCCTACCCTCTCCCCAAT-3'. PCR was carried out in a 50-µl reaction using 1 µl of sodium bisulfite-treated DNA, 60 pM of each primer, 1.25 mM of each deoxynucleoside triphosphate, 2.5 units of Platinum Taq polymerase (Invitrogen), and 5 µl PCR buffer. Reaction conditions were 95°C x 10 min, 35 cycles of 96°C x 30 s, 60°C x 30 s, 72°C x 30 s, and final extension of 72°C x 10 min. Ten µl of the PCR products were visualized on an 8% polyacrylamide gel. The remaining 40 µl were purified from a 1.5% agarose gel using the Qiagen Gel Extraction kit according to manufacturers protocol. Purified PCR products were cloned using the TOPO TA-Cloning kit (Invitrogen), and 810 clones were randomly chosen for sequencing. Complete bisulfite conversion was assured by having <0.01% of the cytosines in non-CG dinucleotides unconverted in the final sequence.
Reverse Transcription-PCR (RT-PCR).
RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturers directions and converted to cDNA with SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Semiquantitative SYBR Green hot start PCR was performed with the LC FastStart DNA Master SYBR Green 1 kit (Roche Diagnostics, Indianapolis, IN) in a Bio-Rad iCycler. The 20-µl reaction contained 1x LC FastStart DNA Master SYBR Green, 1.2 mM MgCl2, 10 µM each primer, and 1 µl template. GRM7 forward primer was 5'-CCTGGGCGTTATGACATCTT-3' and the reverse primer 5'-CAATGGGCGTGTCATTGTAG-3'. Reaction conditions were 95°C x 10 min, 35 cycles of 96°C x 20 s, 58°C x 20 s, 72°C x 20 s, and a final extension at 70°C x 10 min. Regular RT-PCR reactions for additional genes were: IPF1: forward primer CCTTTCCCATGGATGAAGTC, reverse primer TTCAACATGACAGCCAGCTC, 95°C x 10 min, 35 cycles of 96°C x 30 s, 59°C x 20 s, 72°C x 20 s, and final extension 70°C x 5 min. DLX5: forward primer CTCTCCTACCTCGGCTTCCT, reverse primer TTTGCCATTCACCATTCTCA, 95°C x 10 min, 35 cycles of 96°C x 30 s, 62°C x 20 s, 72°C x 30 s, and final extension 70°C x 10 min. TBX18: forward primer GGGTTTGGAAGCCTTGGTGG, reverse primer GGCAGAATAGTCAGCAGGGG, 94°C x 10 min, 35 cycles of 96°C x 30 s, 60°C x 30 s, 72°C x 30 s, and final extension 70°C x 7 min. TBR1: forward primer ACTCAGTTCATCGCCGTCAC, reverse primer AAGTCCAGCCGGTTGTTG, 95°C x 10 min, 35 cycles of 96°C x 30 s, 60°C x 30 s, 72°C x 30 s, and final extension 70°C x 10 min. The housekeeping gene GPI was used as a control for RNA integrity in the RT-PCR reactions: forward primer GACCCCCAGTTCCAGAAGCTGC, reverse primer GCATCACGTCCTCCGTCACC, 95°C x 10 min, 35 cycles of 96°C x 15 s, 60°C x 15 s, 72°C x 60 s, and final extension 72°C x 10 min. Universal Human Reference RNA (Stratagene) was used as a positive control.
VH Gene Analyses.
Analysis for VH gene somatic mutation was performed by the CLL Research Consortium Tissue Bank as described previously (31)
. Sequences were compared with those deposited in the V BASE and GenBank databases. Somatic mutations were identified by comparison with the most homologous germ-line VH gene. Sequences with <98% homology to germ line were considered mutated (32)
.
SDS-PAGE/Immunoblotting.
Whole cellular lysates were prepared as described previously (33)
. For a limited number of experiments, lysates were made as described previously (33)
with the addition of 0.1% SDS or 450 mM NaCl to either increase nuclear membrane lysis or diminish protein-protein interactions, respectively. Additionally, aggressive sonication to break up noncovalent protein DNA bonds was performed. Total protein in each sample was quantified, and samples were separated along with molecular weight markers (Bio-Rad) by SDS-PAGE and transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH). Blots were incubated with antibodies to DNA Methyltransferase 1 (DNMT1; New England Biolabs) and with Glyceraldehyde 3-Phosphate Dehydrogenase (Chemicon, Temecula, CA) to verify gel loading equivalence. Blots were developed with Super-Signal chemiluminescent substrate (Pierce, Rockford, IL) and autoradiography was performed with X-OMAT film (Kodak). Protein bands were digitally quantified using a Bio-Rad ChemiDoc instrument, and DNMT1 levels were calculated relative to Glyceraldehyde 3-Phosphate Dehydrogenase in each lane.
Fluorescence in Situ Hybridization.
Cells from 10 CLL patients were thawed rapidly, washed twice in PBS, diluted to 1 x 106
cells/ml, and treated with 0.075 M KCl for 15 min at 37°C. The cells were fixed in 3:1 methanol:acetic acid. Hybridization with probes for del (17; p13.1), del (13; q14.3), del (11; q22.3), del (6; q21), del (6; q16), and centromere 12 (Vysis, Inc., Downers Grove, IL) was done according to the manufacturers specifications and as described (34)
.
Loss of Heterozygosity (LOH) Analysis.
DNAs from the four matched pairs of CLL cells and non-neoplastic neutrophils (patients 710) were amplified with fluorescently labeled microsatellite markers from ABI Prism Linkage Mapping Set Version 2 (Applied Biosystems, Foster City, CA) according to the manufacturers protocol. Sixteen markers on 2q (D2S160, D2S347, D2S112, D2S151, D2S142, D2S2330, D2S335, D2S364, D2S117, D2S325, D2S2382, D2S126, D2S396, D2S206, D2S338, and D2S125), 1 on 3p26.1 (D3S1304), 4 on 8p2223.2 (D8S549, D8S550, D8S277, and D8S264), and 2 on 22q11 (D22S420 and D22S539) were examined in each of the four pairs of matched samples. PCR products were loaded on an ABI 3700 DNA Analyzer. Fluorescence intensity and allele size were determined with the Genescan and Genotyper software (Applied Biosystems). The ratio of the two alleles (when both were present) was determined for each CLL and neutrophil sample. Because of the high purity (>95%) of both the tumor and control tissues, samples were scored as having LOH if the ratio of the tumor alleles divided by the ratio of the neutrophil alleles was >2.0 or <0.5.
| RESULTS |
|---|
|
|
|---|
|
Some loci were methylated in multiple patients. However, this is not evidence that these loci are preferentially methylated because it is possible this could occur merely by chance. Therefore, using a set of 1204 NotI-EcoRV loci that were determined previously to be nonpolymorphic (10) , we tested this hypothesis with a standard goodness-of-fit test and accompanying simulation-based methods. The results were highly significant (P < 0.0001), indicating that the aberrant patterns of methylation are not random.
RLGS Spot Cloning and Sequence Analysis.
One of the advantages of using RLGS for methylation analysis is the ability to clone loci of interest using our arrayed plasmid libraries. Loci were chosen for cloning based on frequency of methylation in CLL and availability in the plasmid libraries. Our libraries provide
75% coverage of the RLGS profiles, so not every locus can be readily cloned. Thus, we also used a direct cloning approach described recently (35)
. Additionally, some loci cloned previously from other studies were also included in this analysis (10
, 11
, 15
, 36)
.
After confirmation by RLGS mixing gels that a plasmid corresponds to the correct RLGS locus, the plasmid sequences were analyzed for gene or expressed sequence tag homology, chromosomal location, and CpG island characteristics. The data for each of the 193 cloned loci are shown in Table 2
. For sequences with homology to known genes and CpG island characteristics, the location of the CpG island within the gene is noted. Importantly, the majority (93%) of the clones have CpG island characteristics (>200 bp long,
50% GC content, observed/expected CG >0.6), confirming our previous observations that RLGS is strongly biased toward identification of CpG island regions (10)
.
|
|
|
Confirmation of Methylation of Selected Loci.
We have determined previously that loss of an RLGS locus is due to methylation in >95% of the loci analyzed by alternative methods (10)
. However, the possibility that a locus is absent or has reduced intensity due to homozygous or hemizygous deletion cannot be ruled out. Therefore, we analyzed loci by Southern hybridization to rule out deletion as a cause of the reduced intensity. Genomic DNA from CLL cells, CD19+ normal controls, and normal donor peripheral blood was digested with EcoRV alone and in combination with AscI, and used for preparation of Southern blots. The membrane was hybridized with a suitable probe from RLGS loci A-5G07 (GRM7). In all of the cases methylation of the AscI site was confirmed, and there was no evidence of homozygous or hemizygous deletion of the genomic region under investigation. Fig. 2
shows a representative Southern blot using a probe from RLGS locus A-5G07. The presence of the higher molecular weight band in the double-digested CLL DNA demonstrates resistance to digestion by the methylation-sensitive AscI restriction enzyme.
|
Bisulfite Genomic Sequencing of GRM7.
RLGS yields information about the methylation status of only the landmark enzyme restriction site (NotI or AscI). To obtain a more extensive assessment we selected GRM7 and examined promoter methylation with bisulfite genomic sequencing. This gene was chosen based on: (a) the presence of a CpG island spanning the 5' regulatory region; and (b) the fact that GRM7 has been linked to inhibition of cyclic AMP (cAMP) signaling (38)
. Treatment of DNA with sodium bisulfite results in the selective conversion of unmethylated cytosines to uracil although leaving methylated cytosines unchanged. During subsequent PCR the uracil is converted to thymine, and sequencing the PCR product allows determination of the original methylation status in the native DNA. Primer pairs located 5' to the transcription start site did not contain any CG dinucleotides, which gives an amplification product regardless of the original methylation status (39)
.
The results of the GRM7 bisulfite sequencing are shown in Fig. 3
. The AscI landmark site encompasses CGs 13 and 14. We detected an additional CG dinucleotide (position 15 in Fig. 3
) in all of our samples that was not present in the published sequence. Three patients with decreased RLGS spot intensity (patients 7, 8, and 10) showed extensive methylation of the GRM7 5' region, although patients 4 and 9 who did not have reduced spot intensity showed much less methylation. There appear to be certain CGs in the region that are more susceptible to methylation. For example, CGs 25 seem relatively resistant to methylation, although CGs 719 have moderate to marked methylation density in those patients with RLGS spot loss. Patients 4 and 9 also show a similar pattern, although to a much lesser degree. Both of the CD19+ controls show a low level of methylation in a mosaic pattern. The bisulfite sequencing data from GRM7 confirm that reduced or absent RLGS spot intensity can be considered a reliable surrogate for more extensive methylation within the CpG island.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
CLL is characterized by numerous genetic alterations including frequent deletions of chromosomal segments 13q14, 11q22-q23, 6q21, 17p13, and trisomy of chromosome 12 (2) . It is intriguing to speculate that hypermethylation and chromosomal instability are somehow correlated; however evidence from the literature linking these two events is rare. More convincing at this time is the finding of hypomethylation of centromeric and satellite repeat sequences, a phenomenon leading to chromatin decondensation and chromosomal fragility (8 , 41) . The methylation events that we have identified occur throughout the genome without preferential clustering and in line with a previous report on brain tumors demonstrating that aberrant methylation and genetic alterations do not coincide (35) . It is important, however, to note that some of the methylation events that we identified are within or close to chromosomal segments that show frequent genetic alterations (e.g., N-3C57 on 13q14.11 or N-5E14 on 11q22) possibly targeting candidate CLL genes. This seems to be a rare event because it was shown previously that down-regulation of candidate tumor suppressor genes at 13q14 does not involve promoter methylation (42) .
The ability to clone methylated loci is one of the strengths of RLGS and accordingly, we identified 193 sequences, 173 (90%) of which have homology to known genes or expressed sequence tags. A number of these genes are transcription factors (DERMO1, FOXE1, TBX3, and IPF1). TBX3 was shown recently to be differentially expressed between high-risk and standard-risk childhood acute lymphocytic leukemia by gene expression profiling (43) . Other loci (TBR1, GLRB, and PAK5) are associated with genes known to play a role in the nervous system, and any role they may have in CLL is unclear.
CpG islands in somatic cells are usually considered to be maintained in an unmethylated state. However, bisulfite sequencing of the GRM7 5' region revealed that CD19+ cells from normal donors have a considerable amount of methylation. These cells showed equivalent levels of methylation between the two donors (10.511% of the total 190 CGs examined), as well as similar mosaic patterns. The significance of this degree of methylation is uncertain; however, regional DNA methylation can be influenced by Alu (44) or cis-acting sequences (45) . Once de novo methylation has been "seeded," spreading of methylation may be possible (46) .
Here we have demonstrated by RLGS, bisulfite sequencing, and Southern hybridization that GRM7 is methylated in the majority of CLL patients examined. Treatment of a CLL cell line with 5-aza-2'-deoxycytidine resulted in up-regulated expression of several genes, including GRM7, suggesting that these loci are regulated to some extent by promoter methylation. GRM7 can inhibit cAMP signaling in the induction of apoptosis (47) . Investigators have shown that in B-CLL, cAMP phosphodiesterases catabolize cAMP to 5' AMP, thus inhibiting apoptosis (48) , and this inhibition can be reversed by inactivation of phosphodiesterases (49) . Thus, GRM7 is an interesting candidate gene, and its potential role in the pathogenesis of CLL is under investigation.
Some of the methylation events that we found occurred in regions that were discovered recently to have LOH or allelic imbalance in CLL (37) . However, we found only one LOH event out of the 23 markers that we examined in 4 patients. These data, combined with the fluorescence in situ hybridization analysis of markers known to be involved in CLL, showed that methylation occurred independently of LOH in the vast majority of instances. This confirms recent data by Zardo et al. (35) who performed a similar integrated analysis in gliomas. It is also in accordance with the absence of concurrent methylation of the micro-RNA genes miR15 and miR16 in the minimally deleted region of 13q14 in CLL (50) , and the absence of methylation differences between CLL cells and normal B cells in several other down-regulated genes at 13q14.3. Thus, simultaneous methylation and deletion appear to be rare events in CLL. An alternative explanation for clusters of methylated loci is that they represent repressive heterochromatin domains, as demonstrated recently by Nguyen et al. (51) . Additional investigation is needed to determine the relative contribution of histone alterations to the methylation events at these loci.
In summary, we have performed the first dual-enzyme genome scan for methylation in CLL. Before this study, there was little known about the extent of promoter methylation in this disease. We have identified many aberrantly methylated genes and demonstrated that CLL exhibits widespread and nonrandom epigenetic lesions that are attractive targets for additional analysis. It is unlikely that all of these methylation events have pathological significance in the development of CLL. Instead, we suggest that a portion of these events confer a selective advantage to the malignant cell, although others may reflect global deregulation of methyltransferase activity and/or other epigenetic processes, such as histone deacetylase activity. Analysis of a larger sample set may identify methylation patterns with prognostic or therapeutic significance, as well as provide insight into the pathogenesis of this disease. The current use of demethylating agents such as decitabine, and histone deacetylase inhibitors, such as depsipeptide, in clinical trials (52) provides a potential mechanism to alter this disordered gene expression in CLL. The promising preclinical activity of these drugs makes it imperative that we continue to investigate the contribution of epigenetic alterations in this disease.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Christoph Plass, Room 464A TMRF.420 W 12th Avenue, Division of Human Cancer Genetics, The Ohio State University, Columbus, Ohio 43210. Phone: (614) 292-6505; Fax: (614) 688-4761; E-mail: plass-1{at}medctr.osu.edu
6 Internet address: http://genome.ucsc.edu/cgi-bin/hgBlat?command=start. ![]()
Received 9/10/03. Revised 1/21/04. Accepted 1/23/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. P. Pallasch, M. Patz, Y. J. Park, S. Hagist, D. Eggle, R. Claus, S. Debey-Pascher, A. Schulz, L. P. Frenzel, J. Claasen, et al. miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia Blood, October 8, 2009; 114(15): 3255 - 3264. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Chen, A. Raval, A. J. Johnson, E. Hertlein, T.-H. Liu, V. X. Jin, M. H. Sherman, S.-J. Liu, D. W. Dawson, K. E. Williams, et al. Epigenetic changes during disease progression in a murine model of human chronic lymphocytic leukemia PNAS, August 11, 2009; 106(32): 13433 - 13438. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Dubovsky, D. G. McNeel, J. J. Powers, J. Gordon, E. M. Sotomayor, and J. A. Pinilla-Ibarz Treatment of Chronic Lymphocytic Leukemia with a Hypomethylating Agent Induces Expression of NXF2, an Immunogenic Cancer Testis Antigen Clin. Cancer Res., May 15, 2009; 15(10): 3406 - 3415. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, S. Liu, Z. Xie, R. E. Pavlovicz, J. Wu, P. Chen, J. Aimiuwu, J. Pang, D. Bhasin, P. Neviani, et al. Modulation of DNA Methylation by a Sesquiterpene Lactone Parthenolide J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 505 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Frank, D. W. Dawson, S. J. Bensinger, J. S. Hong, W. M. Knosp, L. Xu, C. E. Balatoni, E. L. Allen, R. R. Shen, D. Bar-Sagi, et al. Expression of sprouty2 inhibits B-cell proliferation and is epigenetically silenced in mouse and human B-cell lymphomas Blood, March 12, 2009; 113(11): 2478 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F.L. Tsui, M. P. Rosin, L. Zhang, R. T. Ng, and W. L. Lam Multiple Aberrations of Chromosome 3p Detected in Oral Premalignant Lesions Cancer Prevention Research, November 1, 2008; 1(6): 424 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garaud, C. Le Dantec, C. Berthou, P. M. Lydyard, P. Youinou, and Y. Renaudineau Selection of the Alternative Exon 1 from the cd5 Gene Down-Regulates Membrane Level of the Protein in B Lymphocytes J. Immunol., August 1, 2008; 181(3): 2010 - 2018. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kim, K. Yamashita, Y. K. Chae, Y. Tokumaru, X. Chang, M. Zahurak, M. Osada, H. L. Park, A. Chuang, J. A. Califano, et al. A Promoter Methylation Pattern in the N-Methyl-D-Aspartate Receptor 2B Gene Predicts Poor Prognosis in Esophageal Squamous Cell Carcinoma Clin. Cancer Res., November 15, 2007; 13(22): 6658 - 6665. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Motiwala, S. Majumder, H. Kutay, D. S. Smith, D. S. Neuberg, D. M. Lucas, J. C. Byrd, M. Grever, and S. T. Jacob Methylation and Silencing of Protein Tyrosine Phosphatase Receptor Type O in Chronic Lymphocytic Leukemia Clin. Cancer Res., June 1, 2007; 13(11): 3174 - 3181. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Allegrucci, Y.-Z. Wu, A. Thurston, C. N. Denning, H. Priddle, C. L. Mummery, D. Ward-van Oostwaard, P. W. Andrews, M. Stojkovic, N. Smith, et al. Restriction landmark genome scanning identifies culture-induced DNA methylation instability in the human embryonic stem cell epigenome Hum. Mol. Genet., May 15, 2007; 16(10): 1253 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
C S Chim, T K Fung, K F Wong, J S Lau, M Law, and R Liang Methylation of INK4 and CIP/KIP families of cyclin-dependent kinase inhibitor in chronic lymphocytic leukaemia in Chinese patients J. Clin. Pathol., September 1, 2006; 59(9): 921 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, H. Y. Wang, A. Woetmann, P. N. Raghunath, N. Odum, and M. A. Wasik STAT3 induces transcription of the DNA methyltransferase 1 gene (DNMT1) in malignant T lymphocytes Blood, August 1, 2006; 108(3): 1058 - 1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kim, K. Yamashita, J. H. Baek, H. L. Park, A. L. Carvalho, M. Osada, M. O. Hoque, S. Upadhyay, M. Mori, C. Moon, et al. N-methyl-D-aspartate receptor type 2B is epigenetically inactivated and exhibits tumor-suppressive activity in human esophageal cancer. Cancer Res., April 1, 2006; 66(7): 3409 - 3418. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Yuan, F. Haghighi, S. White, R. Costa, J. McMinn, K. Chun, M. Minden, and B. Tycko A single nucleotide polymorphism chip-based method for combined genetic and epigenetic profiling: validation in decitabine therapy and tumor/normal comparisons. Cancer Res., April 1, 2006; 66(7): 3443 - 3451. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-H. Liu, A. Raval, S.-S. Chen, J. J. Matkovic, J. C. Byrd, and C. Plass CpG Island Methylation and Expression of the Secreted Frizzled-Related Protein Gene Family in Chronic Lymphocytic Leukemia Cancer Res., January 15, 2006; 66(2): 653 - 658. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nishiyama, L. Qi, M. Lacey, and M. Ehrlich Both Hypomethylation and Hypermethylation in a 0.2-kb Region of a DNA Repeat in Cancer Mol. Cancer Res., November 1, 2005; 3(11): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raval, D. M. Lucas, J. J. Matkovic, K. L. Bennett, S. Liyanarachchi, D. C. Young, L. Rassenti, T. J. Kipps, M. R. Grever, J. C. Byrd, et al. TWIST2 Demonstrates Differential Methylation in Immunoglobulin Variable Heavy Chain Mutated and Unmutated Chronic Lymphocytic Leukemia J. Clin. Oncol., June 10, 2005; 23(17): 3877 - 3885. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liu, T. Shen, L. Huynh, M. I. Klisovic, L. J. Rush, J. L. Ford, J. Yu, B. Becknell, Y. Li, C. Liu, et al. Interplay of RUNX1/MTG8 and DNA Methyltransferase 1 in Acute Myeloid Leukemia Cancer Res., February 15, 2005; 65(4): 1277 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Weber, M. A. Aldred, C. D. Morrison, C. Plass, A. Frilling, C. E. Broelsch, K. A. Waite, and C. Eng Silencing of the Maternally Imprinted Tumor Suppressor ARHI Contributes to Follicular Thyroid Carcinogenesis J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1149 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Byrd, G. Marcucci, M. R. Parthun, J. J. Xiao, R. B. Klisovic, M. Moran, T. S. Lin, S. Liu, A. R. Sklenar, M. E. Davis, et al. A phase 1 and pharmacodynamic study of depsipeptide (FK228) in chronic lymphocytic leukemia and acute myeloid leukemia Blood, February 1, 2005; 105(3): 959 - 967. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |