Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cybulski, C.
Right arrow Articles by Lubinski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cybulski, C.
Right arrow Articles by Lubinski, J.
[Cancer Research 64, 2677-2679, April 15, 2004]
© 2004 American Association for Cancer Research

Advances in Brief

A Novel Founder CHEK2 Mutation is Associated with Increased Prostate Cancer Risk

Cezary Cybulski1, Tomasz Huzarski1, Bohdan Górski1, Bartlomiej Masojc1, Marek Mierzejewski1, Tadeusz Debniak1, Bartlomiej Gliniewicz2, Joanna Matyjasik1, Elzbieta Zlowocka1, Grzegorz Kurzawski1, Andrzej Sikorski2, Michal Posmyk3, Marek Szwiec4, Ryszard Czajka5, Steven A. Narod6 and Jan Lubinski1

1 International Hereditary Cancer Center, Department of Genetics and Pathology, Pomeranian Medical University, Szczecin, Poland; 2 Clinic of Urology, Pomeranian Academy of Medicine, Szczecin, Poland; 3 Regional Oncology Hospital, Bialystok, Poland; 4 Regional Oncology Hospital, Olsztyn, Poland; 5 Department of Obstetrics and Perinatology, Pomeranian Medical University, Szczecin, Poland; 6 Centre for Research on Women’s Health, Toronto, Ontario, Canada


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Variants in the CHEK2 have been found to be associated with prostate cancer risk in the United States and Finland. We sequenced CHEK2 gene in 140 Polish patients with prostate cancer and then genotyped the three detected variants in a larger series of prostate cancer cases and controls. CHEK2 truncating mutations (IVS2 + 1G>A or 1100delC) were identified in 9 of 1921 controls (0.5%) and in 11 of 690 (1.6%) unselected patients with prostate cancer [odds ratio (OR) = 3.4; P = 0.004]. These mutations were found in 4 of 98 familial prostate cases (OR = 9.0; P = 0.0002). The missense variant I157T was also more frequent in men with prostate cancer (7.8%) than in controls (4.8%), but the relative risk was more modest (OR = 1.7; P = 0.03). I157T was identified in 16% of men with familial prostate cancer (OR = 3.8; P = 0.00002). Loss of the wild-type CHEK2 allele was not observed in any of prostate cancers from five men who carried CHEK2-truncating mutations. Our results provide evidence that the two truncating mutations of CHEK2 confer a moderate risk of prostate cancer in Polish men and that the missense change appears to confer a modest risk.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results and Discussion
 REFERENCES
 
The genetic basis of prostate cancer is complex and appears to involve multiple genes. Three candidate susceptibility genes have been identified through linkage analysis (HPC1, HPC2/ELAC2, and MSR1), but a clear role for any of these genes in hereditary prostate cancer has not been established (1, 2, 3, 4, 5, 6) . Additionally, mutations in BRCA2 and NBS1 also predispose to prostate cancer (7, 8, 9, 10) , but the contribution of these genes to prostate cancer is relatively small.

CHEK2 [CHEK2, also known as "CHK2" (MIM 604373)] is located on chromosome 22q and encodes the human analog of yeast Cds1 and Rad53, which are checkpoint kinases (11 , 12) . Activation of these proteins in response to DNA damage prevents cellular entry into mitosis. CHEK2 is activated through phosphorylation by ataxia telangiectasia mutated (ATM) protein in response to DNA damage induced by ionizing radiation (12, 13, 14) . Activated CHEK2 phosphorylates BRCA1 and TP53 proteins, regulating tumor suppressor function of these proteins (15, 16, 17) . A founder variant in CHEK2, 1100delC was originally described in Li-Fraumeni families (18 , 19) and as a low penetrance breast cancer susceptibility allele (20, 21, 22) . Recently, CHEK2 mutations have also been identified in patients with prostate cancer (23 , 24) . In this study, we investigated whether CHEK2 plays an important role in the development of prostate cancer in the Polish population.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results and Discussion
 REFERENCES
 
The case group consisted of 690 prostate cancer patients (mean age at onset, 67.6), including 377 consecutive patients with prostate cancer diagnosed in northwestern Poland between 1999 and 2003 (Szczecin), 248 unselected men with prostate cancer diagnosed between June 2002 to October 2003 in northeastern Poland (Olsztyn and Bialystok), and 65 men with prostate cancer diagnosed in 2003 in southwest Poland (Opole). Ninety-eight patients (14.2%) had a first- or second-degree relative affected with prostate cancer (familial prostate cancer). They contained, on average, 2.2 cases of prostate cancer per pedigree (mean age of onset 67.1 years). The control population consisted of 500 consecutive newborns from the clinical hospitals of Szczecin, and 1421 controls selected at random from the computerized patient lists of five family practices in Szczecin, Bialystok, and Olsztyn (725 females and 696 males).

DNA samples were obtained from peripheral blood of individuals or from umbilical cord blood of newborns. The entire coding region of CHEK2 gene was sequenced in 96 men with sporadic prostate cancer and in 44 additional familial prostate cancer cases, using primers and conditions described previously (23) . Exon 10 was screened with primers used in allele-specific PCR for the 1100delC as described below. Samples were sequenced with BigDye Terminator Ready Reaction kit and analyzed in ABI PRISM 377 DNA sequencer (Applied Biosystems).

Three detected sequence variants were then analyzed in a larger series of cases and controls. The 430T>C variant (Ile157Thr) was analyzed by restriction fragment length polymorphism PCR, using Ch157F (5'- ACCCATGTATCTAGGAGAGCTG) and Ch157R (5'-CCACTGTGATCTTCTATGTCTGCA) primers. The reverse primer introduced artificial restriction site for PstI enzyme. The PCR products were digested in mutation-positive cases. The IVS2 + 1G>A mutation was identified by RFLP-PCR using Hpy 188III (New England Biolabs) and primers Ch2/3f (5'-ATTTATGAGCAATTTTTAAACG) and Ch2/3r (5'-TCCAGTAACCATAAGATAATAATATTAC). PCR product was digested in cases with mutation. The 1100delC was analyzed using an allele-specific PCR assay using primers Chk2ex10f (5'-TTAATTTAAGCAAAATTAAATGTC), Chk2ex10r (5'-GGCATGGTGGTGTGCATC), and Chk2delC (5'-TGGAGTGCCCAAAATCATA). PCR products were separated in 2–3% agarose gels. In cases positive in RFLP-PCR and allele-specific oligonucleotide-PCR analyses, DNA sample was sequenced to confirm the presence of the mutation. Odds-ratios and confidence limits were generated using Mantel-Haenszel {chi}2 test.

Loss of heterozygosity analysis was performed with primer pair corresponding to the CHEK2 intragenic microsatellite marker D22S275 in micro-dissected tumors of five mutation-positive men (one carrier of the 1100delC and four carriers of the IVS2 + 1G>A mutation) using methodology described in detail previously (10) .


   Results and Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
REFERENCES
 
The frequencies of the three detected variants are presented in Table 1Citation . One of the two truncating mutations (IVS2 + 1G>A and 1100delC) was detected in 11 of 690 (1.6%) unselected patients compared with 9 of 1921 (0.5%) controls (OR = 3.4; P = 0.004). A mutation was identified in 4 of 98 (4.1%) familial cases (OR = 9.0; P = 0.0001). The missense variant I157T was also more frequent in men with prostate cancer (7.8%) than in controls (4.8%; OR = 1.7; P = 0.03). It was identified in 16% of men with familial prostate cancer (OR = 3.8; P = 0.00002).


View this table:
[in this window]
[in a new window]
  		Table 1 Association of the IVS2+1G>A, 1100delC, and 1157T variants of CHEK2 gene with prostate cancer risk

 
In contrast to the situation in North America and Western Europe, the IVS2 + 1G>A is the dominant CHEK2-truncating mutation in Poland occurring with frequency of 0.3% in the general population compared with 0.2% for the 1100delC (which is the common mutation in western Europe). Haplotype analysis confirmed that this is a founder mutation (data not shown). The IVS2 + 1G>A variant has been reported previously in a single family with prostate cancer in the United States. The mutation creates a 4-bp insertion attributable to abnormal splicing, creates premature protein termination codon in exon 3, and leads to the disruption of protein expression (24) . However, it is not clear if the IVS2 + 1G>A is a founder mutation particular to the Polish population or if it has been missed by other investigators who might have used less sensitive screening techniques (primarily conformation-sensitive gel electrophoresis; Refs. 24, 25, 26, 27 ). We have identified the IVS2 + 1G>A allele in single cancer patients from Latvia and Belarus (unpublished data), suggesting that this allele is present in other Slavic populations. The other two CHEK2 variants (1100delC and I157T) reported in our population were also reported among individuals from other ethnic groups (20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35) .

The IVS2 + 1G>A and 1100delC truncating mutations are less common in Poland (0.5% of the general population) than the I157T missense change (4.8%), but the relative risk for prostate cancer associated with either of the two truncating mutations was higher (3.4 versus 1.7). We estimate that these mutations account for about 1% of prostate cancer cases in Poland, compared with 3% for the I157T missense variant. Our results support the hypothesis that the I157T allele confers increased susceptibility to prostate cancer. Combining data from the three studies (this study and Refs. 23 and 24 ), the I157T change was seen in 6.2% of 1627 cases versus 4.0% of controls (OR = 1.6; P = 0.005). It appears therefore that this missense variant is pathogenic for prostate cancer but confers lower penetrance than the truncating mutation. This variant does not appear to increase the risk of breast cancer (26 , 27) .

In our study, each of four familial prostate cancer families with the truncating mutation included two men with prostate cancer. Recently, variants in CHEK2 gene (1100delC and I157T) were shown to associate with familial prostate cancer in Finland and similarly, a few men with prostate cancer were observed in mutation-positive Finish familial prostate cancer families (24) . It is interesting that Dong et al. (23) reported an association with CHEK2 mutations (18 different mutations pooled together) and sporadic prostate cancer but not familial prostate cancer. The failure to detect a significant association between CHEK2 variants and familial cases could be attributable to the fact that the families in the United States study included a relatively high number of affected men (at least three affected in at minimum two generations).

We identified one of three different CHEK2 alterations in 20 of 98 (20.4%) patients with familial prostate cancer. Seppala et al. (24) found one of three variants (1100delC, I157T, D438Y) in 17 of 120 (14.2%) familial prostate cases from Finland. In a study of 400 men with sporadic cancer and 298 men with familial prostate cancer from the United States, 18 different CHEK2 mutations were found, mostly in single patients (23) . In our study, only three pathogenic CHEK2 variants were detected in 140 men who were fully sequenced. This reduced level of genetic variation is likely the result of the relative ethnic homogeneity in Poland.


   ACKNOWLEDGMENTS
 
We thank Dr. Stanislaw Niepsuj (Regional Oncology Hospital in Olsztyn) and Dr. Lech Zaremba (Regional Oncology Center in Bialystok) for support in collection of DNA samples from patients in northeastern Poland


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Cezary Cybulski, International Hereditary Cancer Center, Department of Genetics and Pathology, Pomeranian Medical University, ul. Polabska 4, 70-115 Szczecin, Poland. Phone: 00-48-91-466-1532; Fax: 00-48-91-466-1533; E-mail: cezarycy{at}sci.pam.szczecin.pl

Received 2/ 3/04. Revised 2/25/04. Accepted 2/25/04.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Tavtigian SV, Simard J, Teng DH, et al A candidate prostate cancer susceptibility gene at chromosome 17p. Nat Genet, 27: 172-80, 2001.[CrossRef][Medline]
  2. Carpten J, Nupponen N, Isaacs S, et al Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet, 30: 181-4, 2002.[CrossRef][Medline]
  3. Wang L, McDonnell SK, Elkins DA, et al Role of HPC2/ELAC2 in hereditary prostate cancer. Cancer Res, 61: 6494-9, 2001.[Abstract/Free Full Text]
  4. Xu J, Zheng SL, Carpten JD, et al Evaluation of linkage and association of HPC2/ELAC2 in patients with familial or sporadic prostate cancer. Am J Hum Genet, 68: 901-11, 2001.[CrossRef][Medline]
  5. Rebbeck TR, Walker AH, Zeigler-Johnson C, et al Association of HPC2/ELAC2 genotypes and prostate cancer. Am J Hum Genet, 67: 1014-9, 2000.[CrossRef][Medline]
  6. Xu J, Zheng SL, Komiya A, et al Germline mutations and sequence variants of the macrophage scavenger receptor 1 gene are associated with prostate cancer risk. Nat Genet, 32: 321-5, 2002.[CrossRef][Medline]
  7. Gayther SA, de Foy KA, Harrington P, et al The frequency of germ-line mutations in the breast cancer predisposition genes BRCA1 and BRCA2 in familial prostate cancer. The Cancer Research Campaign/British Prostate Group United Kingdom Familial Prostate Cancer Study Collaborators. Cancer Res, 60: 4513-8, 2000.[Abstract/Free Full Text]
  8. Edwards SM, Kote-Jarai Z, Meitz J, et al Two percent of men with early-onset prostate cancer harbor germline mutations in the BRCA2 gene. Am J Hum Genet, 72: 1-12, 2003.[CrossRef][Medline]
  9. The Breast Cancer Linkage Consortium. Cancer Risk in BRCA2 mutation carriers. J Natl Cancer Inst (Bethesda), 91: 1310-6, 1999.[Abstract/Free Full Text]
  10. Cybulski C, Górski B, Debniak T, et al NBS1 is a prostate cancer susceptibility gene. Cancer Res, 64: 1215-9, 2004.[Abstract/Free Full Text]
  11. Matsuoka S, Rotman G, Ogawa A, Shiloh Y, Tamai K, Elledge SJ. Ataxia telangiectasia–mutated phosphorylates Chk2 in vivo and in vitro. Proc Natl Acad Sci USA, 97: 10389-94, 2000.[Abstract/Free Full Text]
  12. Chaturvedi P, Eng WK, Zhu Y, et al Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway. Oncogene, 18: 4047-54, 1999.[CrossRef][Medline]
  13. Ahn JY, Schwarz JK, Piwnica-Worms H, Canman CE. Threonine 68 phosphorylation by ataxia telangiectasia mutated is required for efficient activation of Chk2 in response to ionizing radiation. Cancer Res, 60: 5934-6, 2000.[Abstract/Free Full Text]
  14. Falck J, Mailand N, Syljuasen RG, Bartek J, Lukas J. The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature (Lond), 410: 842-7, 2001.[CrossRef][Medline]
  15. Chehab NH, Malikzay A, Appel M, Halazonetis TD. Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53. Genes Dev, 14: 278-88, 2000.[Abstract/Free Full Text]
  16. Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev, 14: 289-300, 2000.[Abstract/Free Full Text]
  17. Lee JS, Collins KM, Brown AL, Lee CH, Chung JH. hCds1-mediated phosphorylation of BRCA1 regulates the DNA damage response. Nature (Lond), 404: 201-4, 2000.[CrossRef][Medline]
  18. Bell DW, Varley JM, Szydlo TE, et al Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science (Wash D C), 286: 2528-31, 1999.
  19. Vahteristo P, Tamminen A, Karvinen P, et al p53, CHK2, and CHK1 genes in Finnish families with Li-Fraumeni syndrome: further evidence of CHK2 in inherited cancer predisposition. Cancer Res, 61: 5718-22, 2001.[Abstract/Free Full Text]
  20. Meijers-Heijboer H, van den Ouweland A, Klijn J, et al Low-penetrance susceptibility to breast cancer due to CHEK2*1100delC in noncarriers of BRCA1 or BRCA2 mutations. Nat Genet, 31: 55-9, 2002.[CrossRef][Medline]
  21. Oldenburg RA, Kroeze-Jansema K, Kraan J, et al The CHEK2*1100delC variant acts as a breast cancer risk modifier in non-BRCA1/BRCA2 multiple-case families. Cancer Res, 63: 8153-7, 2003.[Abstract/Free Full Text]
  22. Vahteristo P, Bartkova J, Eerola H, et al A CHEK2 genetic variant contributing to a substantial fraction of familial breast cancer. Am J Hum Genet, 71: 432-8, 2002.[CrossRef][Medline]
  23. Dong X, Wang L, Taniguchi K, et al Mutations in CHEK2 associated with prostate cancer risk. Am J Hum Genet, 72: 270-80, 2003.[CrossRef][Medline]
  24. Seppala EH, Ikonen T, Mononen N, et al CHEK2 variants associate with hereditary prostate cancer. Br J Cancer, 89: 1966-70, 2003.[CrossRef][Medline]
  25. Sodha N, Bullock S, Taylor R, et al CHEK2 variants in susceptibility to breast cancer and evidence of retention of the wild type allele in tumours. Br J Cancer, 87: 1445-8, 2002.[CrossRef][Medline]
  26. Allinen M, Huusko P, Mantyniemi S, Launonen V, Winqvist R. Mutation analysis of the CHK2 gene in families with hereditary breast cancer. Br J Cancer, 85: 209-12, 2001.[CrossRef][Medline]
  27. Schutte M, Seal S, Barfoot R, et al Variants in CHEK2 other than 1100delC do not make a major contribution to breast cancer susceptibility. Am J Hum Genet, 72: 1023-8, 2003.[CrossRef][Medline]
  28. Syrjakoski K, Kuukasjarvi T, Auvinen A, Kallioniemi OP. CHEK2 1100delC is not a risk factor for male breast cancer population. Int J Cancer, 108: 475-6, 2004.[Medline]
  29. Ohayon T, Gal I, Baruch RG, Szabo C, Friedman E. CHEK2*1100delC and male breast cancer risk in Israel. Int J Cancer, 108: 479-80, 2004.[CrossRef][Medline]
  30. Neuhausen S, Dunning A, Steele L, et al Role of CHEK2*1100delC in unselected series of non-BRCA1/2 male breast cancers. Int J Cancer, 108: 477-8, 2004.[CrossRef][Medline]
  31. Osorio A, Rodriguez-Lopez R, Diez O, et al The breast cancer low-penetrance allele 1100delC in the CHEK2 gene is not present in Spanish familial breast cancer population. Int J Cancer, 108: 54-6, 2004.[CrossRef][Medline]
  32. Kilpivaara O, Laiho P, Aaltonen LA, Nevanlinna H. CHEK2 1100delC and colorectal cancer. J Med Genet, 40: e110 2003.[Free Full Text]
  33. Lipton L, Fleischmann C, Sieber OM, et al Contribution of the CHEK2 1100delC variant to risk of multiple colorectal adenoma and carcinoma. Cancer Lett, 200: 149-52, 2003.[CrossRef][Medline]
  34. Meijers-Heijboer H, Wijnen J, Vasen H, et al The CHEK2 1100delC mutation identifies families with a hereditary breast and colorectal cancer phenotype. Am J Hum Genet, 72: 1308-14, 2003.[CrossRef][Medline]
  35. Offit K, Pierce H, Kirchhoff T, et al Frequency of CHEK2*1100delC in New York breast cancer cases and controls. BMC Med Genet, 4: 1 2003.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
C. Cybulski, B. Gliniewicz, A. Sikorski, J. Kladny, T. Huzarski, J. Gronwald, T. Byrski, T. Debniak, B. Gorski, A. Jakubowska, et al.
Epistatic Relationship between the Cancer Susceptibility Genes CHEK2 and p27
Cancer Epidemiol. Biomarkers Prev., March 1, 2007; 16(3): 572 - 576.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
M. Weischer, S. E. Bojesen, A. Tybjaerg-Hansen, C. K. Axelsson, and B. G. Nordestgaard
Increased Risk of Breast Cancer Associated With CHEK2*1100delC
J. Clin. Oncol., January 1, 2007; 25(1): 57 - 63.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
D. Thompson, S. Seal, M. Schutte, L. McGuffog, R. Barfoot, A. Renwick, R. Eeles, N. Sodha, R. Houlston, S. Shanley, et al.
A Multicenter Study of Cancer Incidence in CHEK2 1100delC Mutation Carriers
Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2542 - 2545.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
X. Wang, F. Wang, K. Taniguchi, R. S. Seelan, L. Wang, K. E. Zarfas, S. K. McDonnell, C. Qian, K. Pan, Y. Lu, et al.
Truncating Variants in p53AIP1 Disrupting DNA Damage-Induced Apoptosis Are Associated with Prostate Cancer Risk
Cancer Res., November 1, 2006; 66(21): 10302 - 10307.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
C Cybulski, D Wokolorczyk, T Huzarski, T Byrski, J Gronwald, B Gorski, T Debniak, B Masojc, A Jakubowska, B Gliniewicz, et al.
A large germline deletion in the Chek2 kinase gene is associated with an increased risk of prostate cancer
J. Med. Genet., November 1, 2006; 43(11): 863 - 866.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
C. Cybulski, B. Gorski, T. Huzarski, T. Byrski, J. Gronwald, T. Debniak, D. Wokolorczyk, A. Jakubowska, E. Kowalska, O. Oszurek, et al.
CHEK2-Positive Breast Cancers in Young Polish Women.
Clin. Cancer Res., August 15, 2006; 12(16): 4832 - 4835.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
O Kilpivaara, P Alhopuro, P Vahteristo, L A Aaltonen, and H Nevanlinna
CHEK2 I157T associates with familial and sporadic colorectal cancer.
J. Med. Genet., July 1, 2006; 43(7): e34 - e34.
[Abstract] [Full Text] [PDF]

Home page
 JAMAHome page
T. Walsh, S. Casadei, K. H. Coats, E. Swisher, S. M. Stray, J. Higgins, K. C. Roach, J. Mandell, M. K. Lee, S. Ciernikova, et al.
Spectrum of Mutations in BRCA1, BRCA2, CHEK2, and TP53 in Families at High Risk of Breast Cancer
JAMA, March 22, 2006; 295(12): 1379 - 1388.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
E. L. Kwak, S. Kim, J. Zhang, R. D. Cardiff, E. V. Schmidt, and D. A. Haber
Mammary Tumorigenesis following Transgenic Expression of a Dominant Negative CHK2 Mutant
Cancer Res., February 15, 2006; 66(4): 1923 - 1928.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Pathol.Home page
C Hughes, A Murphy, C Martin, O Sheils, and J O'Leary
Molecular pathology of prostate cancer
J. Clin. Pathol., July 1, 2005; 58(7): 673 - 684.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Debniak, R. J. Scott, T. Huzarski, T. Byrski, A. Rozmiarek, B. Debniak, E. Zaluga, R. Maleszka, J. Kladny, B. Gorski, et al.
CDKN2A Common Variants and Their Association with Melanoma Risk: A Population-Based Study
Cancer Res., February 1, 2005; 65(3): 835 - 839.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Kammerer, R. B. Roth, R. Reneland, G. Marnellos, C. R. Hoyal, N. J. Markward, F. Ebner, M. Kiechle, U. Schwarz-Boeger, L. R. Griffiths, et al.
Large-Scale Association Study Identifies ICAM Gene Region as Breast and Prostate Cancer Susceptibility Locus
Cancer Res., December 15, 2004; 64(24): 8906 - 8910.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cybulski, C.
Right arrow Articles by Lubinski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cybulski, C.
Right arrow Articles by Lubinski, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online