| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
omiej Masoj
1
bniak1
omiej Gliniewicz2
bieta Z
owocka1
Posmyk3
ski1
1 International Hereditary Cancer Center, Department of Genetics and Pathology, Pomeranian Medical University, Szczecin, Poland; 2
Clinic of Urology, Pomeranian Academy of Medicine, Szczecin, Poland; 3
Regional Oncology Hospital, Bia
ystok, Poland; 4
Regional Oncology Hospital, Olsztyn, Poland; 5
Department of Obstetrics and Perinatology, Pomeranian Medical University, Szczecin, Poland; 6
Centre for Research on Womens Health, Toronto, Ontario, Canada
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CHEK2 [CHEK2, also known as "CHK2" (MIM 604373)] is located on chromosome 22q and encodes the human analog of yeast Cds1 and Rad53, which are checkpoint kinases (11 , 12) . Activation of these proteins in response to DNA damage prevents cellular entry into mitosis. CHEK2 is activated through phosphorylation by ataxia telangiectasia mutated (ATM) protein in response to DNA damage induced by ionizing radiation (12, 13, 14) . Activated CHEK2 phosphorylates BRCA1 and TP53 proteins, regulating tumor suppressor function of these proteins (15, 16, 17) . A founder variant in CHEK2, 1100delC was originally described in Li-Fraumeni families (18 , 19) and as a low penetrance breast cancer susceptibility allele (20, 21, 22) . Recently, CHEK2 mutations have also been identified in patients with prostate cancer (23 , 24) . In this study, we investigated whether CHEK2 plays an important role in the development of prostate cancer in the Polish population.
| Materials and Methods |
|---|
|
|
|---|
ystok), and 65 men with prostate cancer diagnosed in 2003 in southwest Poland (Opole). Ninety-eight patients (14.2%) had a first- or second-degree relative affected with prostate cancer (familial prostate cancer). They contained, on average, 2.2 cases of prostate cancer per pedigree (mean age of onset 67.1 years). The control population consisted of 500 consecutive newborns from the clinical hospitals of Szczecin, and 1421 controls selected at random from the computerized patient lists of five family practices in Szczecin, Bia
ystok, and Olsztyn (725 females and 696 males). DNA samples were obtained from peripheral blood of individuals or from umbilical cord blood of newborns. The entire coding region of CHEK2 gene was sequenced in 96 men with sporadic prostate cancer and in 44 additional familial prostate cancer cases, using primers and conditions described previously (23) . Exon 10 was screened with primers used in allele-specific PCR for the 1100delC as described below. Samples were sequenced with BigDye Terminator Ready Reaction kit and analyzed in ABI PRISM 377 DNA sequencer (Applied Biosystems).
Three detected sequence variants were then analyzed in a larger series of cases and controls. The 430T>C variant (Ile157Thr) was analyzed by restriction fragment length polymorphism PCR, using Ch157F (5'- ACCCATGTATCTAGGAGAGCTG) and Ch157R (5'-CCACTGTGATCTTCTATGTCTGCA) primers. The reverse primer introduced artificial restriction site for PstI enzyme. The PCR products were digested in mutation-positive cases. The IVS2 + 1G>A mutation was identified by RFLP-PCR using Hpy 188III (New England Biolabs) and primers Ch2/3f (5'-ATTTATGAGCAATTTTTAAACG) and Ch2/3r (5'-TCCAGTAACCATAAGATAATAATATTAC). PCR product was digested in cases with mutation. The 1100delC was analyzed using an allele-specific PCR assay using primers Chk2ex10f (5'-TTAATTTAAGCAAAATTAAATGTC), Chk2ex10r (5'-GGCATGGTGGTGTGCATC), and Chk2delC (5'-TGGAGTGCCCAAAATCATA). PCR products were separated in 23% agarose gels. In cases positive in RFLP-PCR and allele-specific oligonucleotide-PCR analyses, DNA sample was sequenced to confirm the presence of the mutation. Odds-ratios and confidence limits were generated using Mantel-Haenszel
2 test.
Loss of heterozygosity analysis was performed with primer pair corresponding to the CHEK2 intragenic microsatellite marker D22S275 in micro-dissected tumors of five mutation-positive men (one carrier of the 1100delC and four carriers of the IVS2 + 1G>A mutation) using methodology described in detail previously (10) .
| Results and Discussion |
|---|
|
|
|---|
|
The IVS2 + 1G>A and 1100delC truncating mutations are less common in Poland (0.5% of the general population) than the I157T missense change (4.8%), but the relative risk for prostate cancer associated with either of the two truncating mutations was higher (3.4 versus 1.7). We estimate that these mutations account for about 1% of prostate cancer cases in Poland, compared with 3% for the I157T missense variant. Our results support the hypothesis that the I157T allele confers increased susceptibility to prostate cancer. Combining data from the three studies (this study and Refs. 23 and 24 ), the I157T change was seen in 6.2% of 1627 cases versus 4.0% of controls (OR = 1.6; P = 0.005). It appears therefore that this missense variant is pathogenic for prostate cancer but confers lower penetrance than the truncating mutation. This variant does not appear to increase the risk of breast cancer (26 , 27) .
In our study, each of four familial prostate cancer families with the truncating mutation included two men with prostate cancer. Recently, variants in CHEK2 gene (1100delC and I157T) were shown to associate with familial prostate cancer in Finland and similarly, a few men with prostate cancer were observed in mutation-positive Finish familial prostate cancer families (24) . It is interesting that Dong et al. (23) reported an association with CHEK2 mutations (18 different mutations pooled together) and sporadic prostate cancer but not familial prostate cancer. The failure to detect a significant association between CHEK2 variants and familial cases could be attributable to the fact that the families in the United States study included a relatively high number of affected men (at least three affected in at minimum two generations).
We identified one of three different CHEK2 alterations in 20 of 98 (20.4%) patients with familial prostate cancer. Seppala et al. (24) found one of three variants (1100delC, I157T, D438Y) in 17 of 120 (14.2%) familial prostate cases from Finland. In a study of 400 men with sporadic cancer and 298 men with familial prostate cancer from the United States, 18 different CHEK2 mutations were found, mostly in single patients (23) . In our study, only three pathogenic CHEK2 variants were detected in 140 men who were fully sequenced. This reduced level of genetic variation is likely the result of the relative ethnic homogeneity in Poland.
| ACKNOWLEDGMENTS |
|---|
ystok) for support in collection of DNA samples from patients in northeastern Poland | FOOTNOTES |
|---|
Requests for reprints: Cezary Cybulski, International Hereditary Cancer Center, Department of Genetics and Pathology, Pomeranian Medical University, ul. Po
abska 4, 70-115 Szczecin, Poland. Phone: 00-48-91-466-1532; Fax: 00-48-91-466-1533; E-mail: cezarycy{at}sci.pam.szczecin.pl
Received 2/ 3/04. Revised 2/25/04. Accepted 2/25/04.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Cybulski, B. Gliniewicz, A. Sikorski, J. Kladny, T. Huzarski, J. Gronwald, T. Byrski, T. Debniak, B. Gorski, A. Jakubowska, et al. Epistatic Relationship between the Cancer Susceptibility Genes CHEK2 and p27 Cancer Epidemiol. Biomarkers Prev., March 1, 2007; 16(3): 572 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Weischer, S. E. Bojesen, A. Tybjaerg-Hansen, C. K. Axelsson, and B. G. Nordestgaard Increased Risk of Breast Cancer Associated With CHEK2*1100delC J. Clin. Oncol., January 1, 2007; 25(1): 57 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Thompson, S. Seal, M. Schutte, L. McGuffog, R. Barfoot, A. Renwick, R. Eeles, N. Sodha, R. Houlston, S. Shanley, et al. A Multicenter Study of Cancer Incidence in CHEK2 1100delC Mutation Carriers Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2542 - 2545. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, F. Wang, K. Taniguchi, R. S. Seelan, L. Wang, K. E. Zarfas, S. K. McDonnell, C. Qian, K. Pan, Y. Lu, et al. Truncating Variants in p53AIP1 Disrupting DNA Damage-Induced Apoptosis Are Associated with Prostate Cancer Risk Cancer Res., November 1, 2006; 66(21): 10302 - 10307. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Cybulski, D Wokolorczyk, T Huzarski, T Byrski, J Gronwald, B Gorski, T Debniak, B Masojc, A Jakubowska, B Gliniewicz, et al. A large germline deletion in the Chek2 kinase gene is associated with an increased risk of prostate cancer J. Med. Genet., November 1, 2006; 43(11): 863 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cybulski, B. Gorski, T. Huzarski, T. Byrski, J. Gronwald, T. Debniak, D. Wokolorczyk, A. Jakubowska, E. Kowalska, O. Oszurek, et al. CHEK2-Positive Breast Cancers in Young Polish Women. Clin. Cancer Res., August 15, 2006; 12(16): 4832 - 4835. [Abstract] [Full Text] [PDF] |
||||
![]() |
O Kilpivaara, P Alhopuro, P Vahteristo, L A Aaltonen, and H Nevanlinna CHEK2 I157T associates with familial and sporadic colorectal cancer. J. Med. Genet., July 1, 2006; 43(7): e34 - e34. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Walsh, S. Casadei, K. H. Coats, E. Swisher, S. M. Stray, J. Higgins, K. C. Roach, J. Mandell, M. K. Lee, S. Ciernikova, et al. Spectrum of Mutations in BRCA1, BRCA2, CHEK2, and TP53 in Families at High Risk of Breast Cancer JAMA, March 22, 2006; 295(12): 1379 - 1388. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Kwak, S. Kim, J. Zhang, R. D. Cardiff, E. V. Schmidt, and D. A. Haber Mammary Tumorigenesis following Transgenic Expression of a Dominant Negative CHK2 Mutant Cancer Res., February 15, 2006; 66(4): 1923 - 1928. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Hughes, A Murphy, C Martin, O Sheils, and J O'Leary Molecular pathology of prostate cancer J. Clin. Pathol., July 1, 2005; 58(7): 673 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Debniak, R. J. Scott, T. Huzarski, T. Byrski, A. Rozmiarek, B. Debniak, E. Zaluga, R. Maleszka, J. Kladny, B. Gorski, et al. CDKN2A Common Variants and Their Association with Melanoma Risk: A Population-Based Study Cancer Res., February 1, 2005; 65(3): 835 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kammerer, R. B. Roth, R. Reneland, G. Marnellos, C. R. Hoyal, N. J. Markward, F. Ebner, M. Kiechle, U. Schwarz-Boeger, L. R. Griffiths, et al. Large-Scale Association Study Identifies ICAM Gene Region as Breast and Prostate Cancer Susceptibility Locus Cancer Res., December 15, 2004; 64(24): 8906 - 8910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |