Cancer Research AACR Membership  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
[Cancer Research 64, 2692-2698, April 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Promoter Methylation Inhibits APC Gene Expression by Causing Changes in Chromatin Conformation and Interfering with the Binding of Transcription Factor CCAAT-Binding Factor

Guoren Deng, Geun-Am Song, Erik Pong, Marvin Sleisenger and Young S. Kim

Gastrointestinal Research Laboratory, Veteran Affairs Medical Center and Department of Medicine, University of California San Francisco, San Francisco, California


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As an important regulator in Wnt-signaling pathway, the APC gene is involved in apoptosis and cell cycle arrest. The loss of APC function is observed in most familial adenomatous polyposis-associated and sporadic colorectal cancer. APC gene is frequently inactivated by DNA mutations. However, hypermethylation in APC gene promoter was also observed in different cancers. In this study, by analyzing the methylation status of APC promoter in 22 colorectal cancer cell lines with different APC expression levels, we identified Regions A and B in the promoter, where the methylation of CpG sites was invariably correlated with the loss of gene expression. By nuclease accessibility assay, we also observed a correlation between the closed chromatin conformation in APC promoter and loss of gene expression. When the nonexpressing cell lines were treated with a DNA methyltransferase inhibitor, 5-Aza-2'-Deoxycytidine, the APC expression in these cells was induced, CpG sites were demethylated, and closed chromatin conformation was opened. However, when these cell lines were treated with a histone deacetylase inhibitor, Trichostatin A, no significant changes in APC expression, methylation status, and chromatin conformation were observed. Using transient transfection assay, a CCAAT box located in Region B was identified, which was involved in up-regulation of APC expression. Methylation of CpG sites around the CCAAT box resulted in a significant inhibition in the gene expression. The specific binding of a transcription factor CCAAT-binding factor (CBF) to the CCAAT box was determined by electrophoretic mobility shift analysis. The binding was inhibited after CpG sites close to the CCAAT box were methylated, indicating that DNA methylation can silence gene expression through interfering with the binding of transcription factors to the promoter. The biological function of CBF in APC gene regulation was further indicated by the decrease of luciferase activities in cells cotransfected with a plasmid carrying APC promoter/luciferase gene and a plasmid expressing dominant negative CBF mutant. In summary, methylation of CpG sites around CCAAT box in APC promoter inhibits the gene expression by changing the chromatin conformation and interfering with the binding of transcription factor CBF to CCAAT box.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The APC gene is involved in apoptosis and cell cycle arrest (1, 2, 3) . The product of APC gene, a homodimeric protein, is located in the cytoplasm and nucleus of the cells. The wild-type APC protein acts as an important regulator in Wnt-signaling pathway (4) . The loss of APC function is observed in most familial adenomatous polyposis-associated and sporadic colorectal cancer (4 , 5) . The inactivation of APC gene is caused frequently by DNA mutations. Recently, the methylation of CpG sites in the promoter region of APC gene has been reported in different types of cancers, including colorectal cancer (6, 7, 8, 9, 10, 11, 12) . However, the correlation of APC gene methylation with the gene silencing and its mechanisms have not yet been fully studied. Thus, we investigated the inactivation of APC gene in colorectal cancer cell lines. We found that in addition to the mutations in APC and ß-catenin genes, methylation in APC gene promoter is present in 5 of 22 colorectal cancer cell lines, and the presence of APC methylation is correlated with loss of APC gene expression. This observation, together with other studies demonstrating the correlation between the methylation and silencing of hMLH1 (13 , 14) , p16INK4a (15) , and retinoblastoma (16) genes, indicate that DNA methylation is a potent silencer of gene expression. To further elucidate the epigenetic mechanisms involved in the silence of APC gene, we first studied the biological function of different regions of the promoter in driving gene expression by transient transfection assay. By analyzing the luciferase activities and binding of the promoter sequence with the nuclear proteins in electrophoretic mobility shift analysis (EMSA), we further determined that the methylation of CpG island in APCpromoter silenced gene expression by changing the chromatin conformation and interfering with the binding of transcription factor CCAAT-binding factor (CBF).


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
Colorectal cancer cell lines Caco2, Colo201, Colo320, H498, HCT8, HRT18, HT29, Lovo, LS174T, SW1116, and SW1463 were obtained from American Type Culture Collection (Manassas, VA). Cell lines RW2982 and RW7213 were from Dr. Lance M. Tibbetts. Cell lines VACO5, VACO6, VACO10P, VACO411, VACO432, VACO457, and VACO481 were kindly provided by Dr. Sanford D. Markowitz. Cell lines RKO and C were from Dr. Michael Brattain. Cells were grown in DMEM supplemented with 10% fetal bovine serum at 37°C with CO2 atmosphere.

5-Aza-2'-Deoxycytidine (5-Aza-dC) and Trichostatin A (TSA) Treatment.
Cells were treated with 0.1, 0.5, 1, 5, and 10 µM 5-Aza-dC (Sigma, St. Louis, MO) for 24 h or with 300 nM TSA (Sigma) for 24 h, as described (14 , 17) .

Methylation Analysis of APC Gene Promoter.
Methylation status of CpG sites in APC promoter was determined by NaHSO3-sequencing method as described (18) . DNA was treated with NaHSO3 and amplified by PCR with the following primer sets separately: (a) APC-M1F, 5' AGTTATTATTTTGATAATTTAGTGAT, APC-M1R, 5' AATAACAATTAACAC(G/A)CATAATAAAA; (b) APC-M2F, 5' GGTGTTTTGTGTTAATTTTTTTGTT, APC-M2R, 5' CTAAC(G/A)AACTACACCAATACAA; and (c) APC-M3F, 5' GG(C/T)GTA(C/T)GTGAT(C/T)GATATGTGGT, APC-M3R, 5' TATACCAAAAAAAAACCATC(G/A)ATTTAAA. These three overlapping PCR products, which cover APC promoter region from –446 to +158 (–1 indicates the major transcription start site; Ref. 19 ), were separated by electrophoresis on a 1.5% agarose gel and eluted using QIAquick gel extract kit (Qiagen, Valencia, CA). The eluted DNA was sequenced on an ABI sequencer with dye terminators (Applied Biosystem, Foster City, CA). The quotient of C over C+T at each CpG site indicates the percentage of methylation.

Determination of APC mRNA Expression.
Total RNA was reverse transcribed and amplified by PCR as described previously (14) . PCR was performed using two primer sets together. The first primer set was for amplifying a 170-bp fragment spanning Exon 1A to Exon 2 of APC gene (APC-RTF, 5' GAGACAGAATGGAGGTGCTGC, APC-RTR, 5' GTAAGATGATTGGAATTATCTTCT). The second primer set was for a ß-actin gene fragment with the size of 242 bp as an internal control (Act-F, 5' TCACCAACTGGGACGACATG, Act-R, 5' ACCGGAGTCCATCACGATG). The reverse transcription-PCR products were analyzed by electrophoresis on a 2% agarose gel stained with ethidium bromide.

Luciferase Assay.
The plasmids carrying APC promoter and luciferase reporter were constructed by the method as described previously (20) . Genomic DNA was amplified by PCR with various primer sets. The forward primers in these primer sets are sequences from –168 to –150 (APC-F1, 5' TGCGGTTGGGCGGGGCCCT), –55 to –35 (APC-F2, 5' AGCCCGCCGATTGGCTGGGTG), and –18 to +2 (APC-F3, 5' ACATGTGGCTGTATTGGTGC). The reverse primers in these primer sets are sequences from +131 to +149 (APC-R, 5' GAAAGGCCATCGGTTTAAG). To yield restriction ends for ligation, sequences 5' GCGGTACC and 5' GCAGATCT were added to the 5' ends of the forward and reverse primers, respectively. The PCR products were digested with restriction enzymes KpnI and BglII (New England Biolabs, Beverly, MA) and ligated to the KpnI- and BglII-digested plasmid pGL3-Basic (Promega, Madison, WI), which carries the firefly luciferase gene. The plasmid constructs were named as pGL3APC1, pGL3APC2, and pGL3APC3, respectively (Fig. 4A)Citation . A plasmid that carries mutations in the CCAAT box (in pGL3APC2) was constructed similarly, except that a forward primer APC-F2m (5' AGCCCGCCGGCCAACTGGGTG) was used in PCR. This construct was named as pGL3APC2m. Colorectal cancer cell lines RKO, LS174T, HT29, and SW1463 were seeded at 2 x 105 cells/well in a 24-well plate and grown in DMEM supplemented with 10% fetal bovine serum. After 24 h, cells were transfected with the plasmid constructs using transfection reagent Tfx-50 (Promega) according to the protocol recommended by the manufacturers. A plasmid pRL that carries Renilla luciferase gene was cotransfected in all these assays mentioned above. Two days after the transfection, cells were lysed, and the luciferase activities were assayed by Dual-Luciferase Reporter Assay System (Promega) and measured with Luminometer (Monolight 2010; Analytical Luminescence Lab, San Diego, CA). The luciferase level was shown by the ratio of firefly luciferase reading over the Renilla luciferase reading. The plasmid pcCBF-Bmut, which expresses a dominant negative mutant of CBF-B mutated at 304th and 311th codons, was constructed from plasmid pcDNA3.1 (20) . pcCBF-Bmut and pcDNA3.1 were used separately to cotransfect RKO cells with pGL3APC1, pGL3APC2, or pGL3APC3. The luciferase activities were the average from at least three separate transfection assays in all of the experiments.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Characterization of APC promoter activities by transient transfection assay. A, structures of the plasmid constructs used in the assay. Long line, APC promoter sequence. Arrows above and below line, the forward and reverse primers used for constructing the plasmids, respectively. B, luciferase activities in the transfectants of RKO, LS174T, HT29, and SW1463 cells, transfected with pGL3APC1, pGL3APC2, pGL3APC2m, and pGL3APC3.

 
In Vitro Methylation of APC Promoter.
Plasmids pGL3APC2 and pGL3APC3 were in vitro methylated by HhaI, HpaII, and Sss I methylases (New England Biolabs) according to the procedures recommended by the manufacturers. The completeness of methylation was checked by measuring the extent of protection from digestion by the restriction enzymes HhaI, HpaII, and BstUI (New England Biolabs), respectively. A 32P-labeled probe of APCpromoter (see below) was also in vitro methylated by Sss I methylase with the same procedure. For the unmethylated control (mock), pGL3APC2, pGL3APC3, and the 32P-labeled probe were mixed with all components required for in vitro methylation except methylases

EMSA.
The wild-type probe of APC promoter (from –64 to –23) was made by annealing two complementary oligonucleotides (5' CCCGTCGGGAGCCCGCCGATTGGCTGGGTGT and 5' CACGTGCGCCCACACCCAGCCAATCGGCGGG, the core sequence of the CCAAT box is underlined) and filling the 3' recessive ends by repair synthesis with dATP, dTTP, dGTP, [{alpha}-32P] dCTP, and Klenow fragment of DNA polymerase I (New England Biolabs). The mutated probe of APCpromoter was made by the same procedure, except that two oligonucleotides with mutations (underlined) in the core sequence of the CCAAT box were used (5' CCCGTCGGGAGCCCGCCGGCCAACTGGGTGT and 5' CACGTGCGCCCACACCCAGTTGGCCGGCGGG). The 32P-labeled probe (1.5 ng) was mixed with 2 µg of nuclear proteins prepared from RKO cells (21) in 10 µl containing 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 5 mM MgCl2, 0.5 mM DTT, 10% glycerol, 0.05% NP40, and 0.5 µg of poly (dI-dC). After incubation at room temperature for 20 min, the nuclear protein-bound probe and free probe were separated on a 4% polyacrylamide gel. For the competition experiment, 50 or 150 ng of unlabeled competitors (wild-type APC promoter sequence from –64 to –23) were added before mixing the probe with nuclear proteins. For super shift assay, after the binding of probe with nuclear proteins, 1 µl each of anti-CBF-A, CBF-B, E2F-1, Sp1, and NF-1 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added and incubated at room temperature for 30 min. The mutated and in vitro methylated probes were also incubated with nuclear proteins and analyzed as described above.

Nuclease Accessibility Assay.
The nuclei of RKO, HT29, SW1463, and VACO6 cells were prepared as described (22) and digested with restriction enzymes Hha I or AluI (New England Biolabs). DNA was then extracted from the digested nuclei with proteinase K/phenol procedure (17) . DNA from HhaI-digested nuclei was amplified by PCR with primers APC-F2 and APC-R2 (5' CTCCAGCACCTACCCCATT) and electrophorized on a 2% agarose gel (Fig. 3A)Citation . The absence or presence of a 127-bp fragment indicates that HhaI is or is not accessible to the chromatin in the region of APC promoter, respectively. To assess the input of chromatin, another upstream primer, APCF3, was also mixed in the PCR (Fig. 3A)Citation . The amount of HhaI-digested chromatin was represented by the ratio 127:90 bp. Similarly, DNA from AluI-digested nuclei was also amplified by PCR with primers APC-F1, APC-F2, and APC-R2. The absence or presence of a 240-bp product (comparing with a control of 127 bp) indicates that AluI is or is not accessible to the chromatin, respectively.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Chromatin conformation of APC promoter determined by nuclease accessibility assay. A, strategy of nuclease accessibility assay. Nuclei were digested with restriction enzymes HhaI or AluI. DNA was extracted from the nuclei and amplified by PCR with primer sets APC-F2/APC-F3/APC-R2 or APC-F1/APCF2/APC-R2, respectively. The decrease of the ratio 127:90 bp after HhaI digestion indicates that the chromatin is accessible to HhaI. Similarly, the decrease of the ratio 240:127 bp after AluI digestion also indicates that chromatin is accessible to AluI. B, chromatin conformation in RKO, HT29, SW1463, and VACO6 cells determined by nuclease accessibility assay. C, chromatin conformation in SW1463 cells treated with TSA and 5-Aza-2'-Deoxycytidine determined by nuclease accessibility assay.

 

    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Methylation of CpG Sites in APC Promoter Correlates with Loss of mRNA Expression with a Region-Specific Manner.
The expression of mRNA in 22 colorectal cancer cell lines was measured by reverse transcription-PCR with actin gene as an internal control. High-level expression of APC gene was observed in HCT8, Lovo, SW1116, VACO5, VACO411, VACO432, VACO481, C, HT29, LS174T, Colo201, Colo320, HRT18, RW2982, RW7213, Caco2, and RKO cells. Low-level expression was seen in VACO10P, VACO457, and H498 cells. In VACO6 and SW1463 cells, there was no detectable expression. The methylation in APC promoter region (from –446 to +158) was analyzed by NaHSO3 sequencing (Fig. 1)Citation . In all 17 cell lines with high levels of APC expression, no methylation was found in two regions, Regions A (–216 to –126) and B (–62 to –26). In regions upstream of A, downstream of B, and between A and B, methylation was observed in several cell lines (Fig. 1A)Citation , suggesting that methylation outside of Regions A and B does not inhibit the APC gene expression. In 3 cell lines with low levels of APC expression, partial methylation was detected in Regions A and B (Fig. 1B)Citation . In the nonexpressing cell lines VACO6 and SW1463, almost complete methylation was seen in Region B. However, partial methylation was seen in Region A in VACO6 (Fig. 1C)Citation . Thus, by the comparison of APCexpression levels with methylation status in different regions of the promoter, we concluded that methylation of CpG sites in Regions A and B, especially Region B, closely correlates with the expression of the gene.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Methylation status of APC promoter between bases –348 and +122 in 22 colorectal cancer cell lines. The percentage of methylation at each CpG site was plotted against its position in the promoter. A, methylation status in high-level expressing cell lines HCT8, Lovo, SW1116, VACO5, VACO411, VACO432, VACO481, C, HT29, LS174T, Colo201, Colo320, HRT18, RW2982, RW7213, Caco2, and RKO. B, methylation status in low-level expressing cell lines VACO10P, VACO457, and H498. C, methylation status in nonexpressing cell lines VACO6 and SW1463. D–F, comparison of methylation status between 5-Aza-2'-Deoxycytidine-treated SW1463 (D), VACO6 (E), and H498 (F) cells and untreated cells.

 
5-Aza-dC Treatment Induces the APC Expression.
To confirm the role of methylation in Regions A and B in silencing gene expression, two nonexpressing cell lines SW1463 and VACO6, one cell line with low expression level, H498, and one cell line with high expression level, RKO, were treated with DNA methyltransferase inhibitor 5-Aza-dC (1 µM). APC expression was induced in SW1463 and VACO6 after 24 h of exposure to the reagent. The expression in H498 was also increased, whereas the expression in RKO was not changed (Fig. 2A)Citation . The extent of APC induction was dosage dependent. When SW1463 was treated with increasing amounts of 5-Aza-dC (from 0.1 to 10 µM), the APCexpression increased to a top level at the concentration of 1 µM and did not change thereafter (Fig. 2B)Citation . The methylation status in SW1463, VACO6, and H498 after 5-Aza-dC treatment was determined by NaHSO3 sequencing and shown in Fig. 1, D–FCitation . The methylation was significantly decreased in Regions A and B in SW1463 and VACO6 cells, whereas a minor reduction in methylation level was observed in these regions in H498. The nonexpressing cell lines SW1463 and VACO6 were also treated with 300 nM TSA, a histone deacetylase inhibitor. No significant induction of APC expression was detected by reverse transcription-PCR (data not shown).



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Induction of APC expression by the treatment of 5-Aza-2'-Deoxycytidine. RNA from 5-Aza-2'-Deoxycytidine-treated SW1463, VACO6, H498, and RKO cells was reverse transcribed and amplified by PCR and compared with RNA from untreated cells. A, the comparison of APC expression between 5-Aza-2'-Deoxycytidine-treated (1 µM) and untreated SW1463, VACO6, H498, and RKO cells. B, APC expression in SW1463 cells treated with 0, 0.1, 0.5, 1, 5, and 10 µM 5-Aza-2'-Deoxycytidine.

 
5-Aza-dC Treatment Changes Chromatin Conformation around APC Promoter.
Chromatin conformation near APC promoter was studied by nuclease accessibility assay. The nuclei from two expressing cell lines RKO and HT29 and two nonexpressing cell lines SW1463 and VACO6 were digested with the restriction enzyme HhaI. DNA extracted from the nuclei was amplified by PCR and analyzed by electrophoresis. The ratio 127:90 bp represents the amount of undigested chromatin at Hha I site (–30) in APC promoter (Fig. 3A)Citation . The ratio was significantly decreased in RKO and HT29 compared with the DNA from undigested nuclei, indicating that the HhaI enzyme is accessible to the HhaI sequence in the chromatin, and the chromatin is open in these two cell lines. The ratio 127:90 bp was not changed after HhaI digestion in SW1463 and VACO6, suggesting that the chromatin is closed (Fig. 3B)Citation . After SW1463 was treated with 300 nM TSA or 1 µM 5-Aza-dC, the nuclease accessibility assay was performed. HhaI was accessible to the chromatin after 5-Aza-dC treatment. However, TSA treatment did not show obvious change in the HhaI accessibility (Fig. 3C)Citation . Restriction enzyme AluI was also used to analyze its accessibility at position –105 in 5-Aza-dC and TSA-treated SW1463 cells. A similar result was observed (data not shown).

Luciferase Assay Shows that CCAAT Box Is Involved in Up-Regulation of the APC Transcription.
Cell lines RKO, LS174T, HT29, and SW1463 were transfected with plasmid constructs carrying APC promoter sequence and luciferase gene. The luciferase activities were determined from different transfectants (Fig. 4B)Citation . The pGL3APC2 transfectants expressed the highest levels of luciferase activities compared with the longer plasmid pGL3APC1, or the shorter plasmid pGL3APC3, indicating that the sequence between –55 and –34 might contain some important element which up-regulates APC expression. Because luciferase activities were lower in pGL3APC1 transfectants than pGL3APC2, the region between –168 and –55 might carry down-regulation elements. A reverse CCAAT box (–46 to –42) was identified with MatInspector V2.2 (transfac.gbf.de/cgi-bin/matSearch). Thus, we also included a plasmid containing mutations in the CCAAT box (pGL3APC2m) in the transfection assay. The luciferase activities with pGL3APC2m transfectants were tremendously reduced compared with pGL3APC2. This comparison suggests that the CCAAT box plays an important role in up-regulating APC expression. We expected the luciferase activities in nonexpressing SW1463 cells to be much lower than the other three expressing cell lines. However, the luciferase activities in SW1463 were not significantly reduced. This indicates that the regulation machinery (including CCAAT binding protein) is intact in this nonexpressing cell line, and some other mechanisms might be involved in the gene silencing.

Methylation of CpG Sites Adjacent to the CCAAT Box Inhibits the Promoter Activities.
RKO cells were transfected with in vitro methylated pGL3APC2 and pGL3APC3. The luciferase activities of these transfectants were compared with those from the unmethylated pGL3APC2 and pGL3APC3 transfectants (Fig. 5)Citation . The luciferase activity in HhaI-methylated pGL3APC3 reduced to 52.5%. Because there is no methylated HhaI site in APC promoter in pGL3APC3 (see Plasmid constructs in Fig. 5Citation ), the reduction of luciferase activity might be attributable to the methylated HhaI sites in the luciferase gene. The luciferase activity in HhaI-methylated pGL3APC2 transfectant reduced further to 28.1% compared with the unmethylated pGL3APC2 transfectant. This suggests that methylation at a CpG site close to the CCAAT box (at –30) contributes to the repression of promoter activity. The luciferase activities of the HpaII-methylated pGL3APC3 and pGL3APC2 transfectants decreased to 35.4 and 34.4% compared with their unmethylated counterparts. In the APC promoter of pGL3APC2, there are no more methylation sites compared with pGL3APC3 (see Plasmid constructs in Fig. 5Citation ). This might explain why the decreases of luciferase activities in methylated pGL3APC3 and pGL3APC2 are similar. For Sss I-methylated transfectants, the methylated pGL3APC3 transfectant showed reduction to 13%. This can be explained by the fact that all CpG sites in pGL3APC3 are methylated. The luciferase activity of the methylated pGL3APC2 transfectant decreased to 4%, suggesting that methylation of five more CpG sites around the CCAAT box inhibits the promoter activity further (see Plasmid constructs in Fig. 5Citation ). The above assays indicate that the reduction of APCpromoter activity is dependent on the density of methylation around the CCAAT box.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Comparison of luciferase activities between RKO cells transfected with in vitro methylated pGL3APC3 and pGL3APC2 and RKO cells transfected with unmethylated plasmids. Plasmids pGL3APC3 and pGL3APC2 were in vitro methylated with HhaI, HpaII, and Sss I methylases separately. RKO cells were transfected with the methylated pGL3APC3 and pGL3APC2. The luciferase activities of these transfectants were compared with those transfected with the unmethylated counterparts. Plasmid constructs were shown on the left. {circ} and {bullet}, the unmethylated and methylated CpG sites, respectively. Luciferase activities of the transfectants were shown on the right.

 
Methylation of CpG Sites around the CCAAT Box Interferes with the Binding between the CCAAT Box and CBF-B.
A probe (32P labeled; –64 to –23) was mixed with nuclear proteins from RKO cells in EMSA (Fig. 6A)Citation , and a shifted band was observed (Lane 2). The band was competed off when excess amount of unlabeled competitor was added before the binding of nuclear proteins (Lane 3), indicating the binding is specific. When anti-CBF-A, CBF-B, E2F-1, Sp1, and NF-1 antibodies were mixed after the binding of nuclear proteins, only the sample mixed with CBF-B antibody showed a significantly shifted band compared with the sample without antibody (Lanes 4–8). This suggests that the probe binds specifically to the subunit B of CBF. A mutated probe (at the CCAAT box) was used in EMSA to compare with the wild-type probe in the binding of CBF-B (Fig. 6B)Citation . The nuclear proteins did not bind to the mutant probe (Lane 2), showing that the core sequence of the CCAAT box is specific for the binding of CBF-B. When the wild-type probe was in vitro methylated at all CpG sites (–62, –59, –51, –48, –30, and –26), and mixed with the nuclear proteins, the shifted band was five times weaker than the unmethylated probe (Fig. 6C)Citation . This comparison suggests that methylation of CpG sites around the CCAAT box interferes with the binding of CBF-B.



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. The binding of CCAAT-binding factor (CBF)-B to CCAAT box determined by electrophoretic mobility shift analysis. In A, wild-type probe containing CCAAT box was mixed with nuclear proteins from RKO cells and separated on a 4% polyacrylamide gel. Lane 1, free probe; Lanes 2–8, probe was mixed with nuclear proteins; Lane 3, 150 ng of the unlabeled competitor were added before mixing the nuclear proteins; Lanes 4–8, 1 µl each of the anti-CBF-A, CBF-B, E2F-1, Sp1, and NF-1 antibodies was added after mixing the nuclear proteins. In B, probe with mutations in CCAAT box (Lanes 1–4) and wild-type probe (Lanes 5–8) were mixed with nuclear proteins (Lanes 2–4 and Lanes 6–8). Fifty nanograms (Lanes 3 and 7) or 150 ng (Lanes 4 and 8) of unlabeled competitor were added before mixing the nuclear proteins. C, wild-type probe (Lanes 1–3) and in vitro methylated probe (Lanes 4–6) were mixed with the nuclear proteins. Fifty nanograms (Lanes 2 and 5) or 150 ng (Lanes 3 and 6) of unlabeled competitor were added before mixing the nuclear proteins.

 
Decrease in Luciferase Activity in the Cells Cotransfected with Dominant Negative CBF-B Mutant and APC Promoter/Luciferase Construct.
To further investigate the biological function of CBF in up-regulation of APC expression in vivo, a plasmid expressing dominant negative mutant of CBF-B, pcCBF-Bmut (20) , was used to cotransfect RKO cells with pGL3APC1, pGL3APC2, or pGL3APC3 (Fig. 7)Citation . The luciferase activity in cells cotransfected with pcCBF-Bmut and pGL3APC1 decreased to 0.5 compared with the cells cotransfected with a blank plasmid pcDNA3.1 and pGL3APC1. The luciferase activity of the pcCBF-Bmut/pGL3APC2 transfectant was three times lower than that of the pcDNA3.1/pGL3APC2 transfectant. The plasmid pcCBFBmut expressed mutant CBF-B subunit, and the latter acted as a dominant repressor to the complex formed by the endogenous wild-type CBF-B and CCAAT box, leading to the inhibition of luciferase gene expression. This experiment suggests that the binding of CBF-B to the CCAAT box in APCpromoter is one of the key events in driving APC expression. The luciferase activities were similar between the transfectants of pcCBFBmut/pGL3APC3 and pcDNA3.1/pGL3APC3. This is because of the fact that pGL3APC3 does not contain the CCAAT box (Fig. 4A)Citation ; thus, the repressor effect of pcCBF-Bmut could not be demonstrated.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Inhibition of luciferase activities in transfectants transfected with dominant negative CCAAT-binding factor-B mutant. RKO cells were cotransfected with plasmid carrying APC promoter/luciferase gene (pGL3APC1, pGL3APC2, and pGL3APC3) and a plasmid expressing dominant negative CCAAT-binding factor-B mutant, pcCBF-Bmut. The luciferase activities were compared with those cotransfected with the same APC promoter/luciferase gene plasmid and a blank plasmid pcDNA3.1.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As an important component of Wnt-signaling pathway, APC gene is frequently inactivated by mutation in colorectal cancer. However, hypermethylation in APC promoter was also observed in 18% of colorectal cancer (23) . In this study, we used 22 colorectal cancer cell lines as a model to investigate the mechanisms of APC regulation. We showed that methylation in two regions of APC promoter (Region A, –216 to –126; Region B, –62 to –26) invariably correlated with the absence of RNA expression. The silencing of APC gene by promoter methylation was indicated by the induction of RNA expression in the cells with methylated APC promoter after the treatment of a DNA methyltransferase inhibitor, 5-Aza-dC. To identify the cis-elements involved in up-regulation of APC expression, a series of APCpromoters with different lengths were linked to the luciferase gene, and these constructs were used to transfect colorectal cancer cell lines. We observed that a CCAAT box near the transcription start site (–46 to –42) showed a strong ability to drive luciferasae expression in the cells with high levels of APC expression, as well as in the cells with no detectable APC expression. This observation suggests that the loss of APC expression is not caused by the absence of transcription factors, which bind to the CCAAT box, but probably caused by other mechanisms, such as inhibition of the binding of transcription factors to CCAAT box by methylation. The involvement of methylation in APC gene silencing was further supported by the study that showed a decrease of luciferase activities of the cells transfected by the methylated constructs. The extent of the decrease in luciferase activity was dependent on the density of methylation around the CCAAT box. Because the CCAAT box is located in Region B, where methylation closely correlates with gene silencing, we used a CCAAT-containing probe in EMSA to identify the transcription factors that bind to it and also determine the sequence specificity for the binding. Super shift assay showed that the CCAAT box bound to the subunit B of CBF. The probe with mutations in the core sequence of the CCAAT box could not bind to CBF-B. When the wild-type probe was methylated at CpG sites around the CCAAT box, the binding to CBF-B significantly decreased. This suggests that methylation around the CCAAT box in APC promoter might silence the gene expression by interfering with the binding of CBF to the CCAAT box. To further investigate the biological function of CBF in regulating APC gene, we used a plasmid expressing dominant negative CBF-B in a transient transfection assay. The 2–3-fold decrease in luciferase activities suggested that the binding of CBF-B to the CCAAT box is one of the key events in APC regulation.

Recently, CBF has been indicated to regulate the transcription in a wide variety of genes involving cell cycle, differentiation, aging, and DNA repair, such as ferritin (24) , myeloperoxidase (25) , ABO (26) , {alpha}2 collagen (27) , {alpha}1 (I) collagen (28) , {alpha}1 (XI) collagen (29) , retinal dehydrogenase type 1 (30) , MHC class II (31) , hMLH1 (20) , and others. The biological function of the binding of CBF to CCAAT box in gene regulation was shown by the inhibition of gene expression using dominant negative CBF mutant in transient or stable transfection assay.

In this study, we observed that the methylation status in APCpromoter generally correlated with the chromatin conformation in this region. In APC-expressing cell lines RKO and HT29, in which CpG sites are not methylated, the chromatin is opened and accessible to restriction enzymes, whereas in APC-nonexpressing cell lines SW1463 and VACO6, the chromatin is closed and therefore not accessible to the restriction enzymes. The aberration of the chromatin conformation might inhibit its binding to CBF, leading to the repress of the gene expression. However, the chromatin conformation does not always correlate with the methylation of the corresponding CpG sites adjacent to it, e.g., in RKO cells, although almost all CpG sites are not methylated, a 50% methylation was present at CpG site –119 (Fig. 1A)Citation . The methylation at this single CpG site did not close the chromatin at position –105, measured by nuclease accessibility assay with restriction enzyme AluI.

Loss of APC gene expression and promoter methylation have been observed in a variety of cancers and precancerouse lesions (6, 7, 8, 9, 10, 11, 12 , 23) . Previous studies have shown that the phenotype of cells expressing a mutated APC allele can be reverted by increased expression of the remaining wild-type APC allele, and the overexpression of the APC wild-type allele alone can suppress tumorigenicity (32 , 33) . Therefore, further understanding of the mechanisms of APC gene regulation and silencing may lead to the development of the prevention and treatment strategies of cancer. DNA methylation and histone modification appear to work together to silence the expression of a number of genes in cancer, such as APC and hMLH1. The methylated DNA binds to methyl CpG-binding protein, which recruits histone deacetylase and DNA methyltransferase, and causes changes in histone modification and chromatin conformation. In this study, by treating the APC nonexpressing cells with a DNA methyltransferase inhibitor, 5-Aza-dC, we showed that the induction of APC expression correlated with the decrease in methylation (Fig. 1, D–F)Citation , as well as a change in chromatin conformation (Fig. 3C)Citation . However, we did not observe significant changes in APC expression levels, methylation status, or chromatin conformation after the cells were treated with a histone deacetylase inhibitor, TSA. This observation is consistent with the recent reports in studying the regulation of the hypermethylated genes, such as hMLH1, CDKN2B (p15INK4B), CDKN2A (p16INK4), and others. In these studies, the treatment of 5- Aza-dC induced the expression of these hypermethylated genes and reversed the histone modification, whereas TSA treatment did not show these changes (17 , 34) . Clearly, further investigation of the relationship between DNA methylation and histone modification in gene regulation and the demethylation of DNA will yield important information that may provide new strategies for the prevention and therapy of cancer.


    FOOTNOTES
 
Grant support: Theodora Betz Foundation Fund and the Department of Veteran Affairs Medical Research Service.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Guoren Deng, Gastrointestinal Research Laboratory, 151M2, Veteran Affairs Medical Center and University of California San Francisco, 4150 Clement Street, San Francisco, CA 94121. Phone: (415) 221-4810, extension 3401; Fax: (415) 750-6972.

Received 10/ 9/03. Revised 12/23/03. Accepted 2/18/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bowne SJ, Williams AC, Hague A, Butt AJ, Paraskeva C. Loss of APC protein expressed by human colonic epithelial cells and the appearance of a specific low-molecular-weight form is associated with apoptosis in vitro. Int J Cancer, 59: 56-64, 1994.[Medline]
  2. Morin PJ, Vogelstein B, Kinzler KW. Apoptosis and APC in colorectal tumorigenesis. Proc Natl Acad Sci USA, 93: 7950-4, 1996.[Abstract/Free Full Text]
  3. Baeg GH, Matsumine A, Kuroda T, et al The tumor suppressor gene product APC blocks cell cycle progression from G0/G1 to S phase. EMBO J, 14: 5618-25, 1995.[Medline]
  4. Ilyas M, Staub J, Tomlinson IP, Bodmer WF. Genetic pathways in colorectal and other cancers. Eur J Cancer, 35: 1986-2002, 1999.
  5. Powell SM, Zilz N, Beazer-Barclay Y, et al APC mutations occur early during colorectal tumorigenesis. Nature (Lond.), 359: 235-7, 1992.[CrossRef][Medline]
  6. Hiltunen MO, Alhonen L, Koistinaho J, et al Hypermethylation of APC (adenomatous polyposis coli) gene promoter region in human colorectal carcinoma. Int J Cancer, 70: 644-8, 1997.[CrossRef][Medline]
  7. Esteller M, Sparks A, Toyota M, et al Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res, 60: 4366-71, 2000.[Abstract/Free Full Text]
  8. Sakomato Y, Kitazawa R, Maeda S, Kitazawa S. Methylation of CpG loci in 5'-flanking region alters steady-state expression of adenomatous polyposis coli gene in colon cancer cell lines. J Cell Biochem, 80: 415-23, 2001.[CrossRef][Medline]
  9. Tsuchiya T, Tamura G, Sato K, et al Distinct methylation patterns of two APC gene promoters in normal and cancerous gastric epithelia. Oncogene, 19: 3642-6, 2000.[CrossRef][Medline]
  10. Eads CA, Lord RV, Kurumboor SK, et al Fields of aberrant CpG island hypermethylation in Barrett’s esophagus and associated adenocarcinoma. Cancer Res, 60: 5021-6, 2000.[Abstract/Free Full Text]
  11. Jin Z, Tamura G, Tsuchiya T, et al Adenomatous polyposis colo (APC) gene promoter hypermethylation in primary breast cancers. Br J Cancer, 85: 69-73, 2001.[CrossRef][Medline]
  12. Brabender J, Usadel H, Danenberg KD, et al Adenomatous polyposis coli gene promoter hypermethylation in non-small cell lung cancer is associated with survival. Oncogene, 20: 3528-32, 2001.[CrossRef][Medline]
  13. Kane MF, Loda M, Gaida GM, et al Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res, 57: 808-11, 1997.[Abstract/Free Full Text]
  14. Deng G, Chen A, Hong J, Chae HS, Kim YS. Methylation of CpG in a small region of the hMLH1 promoter invariably correlates with the absence of gene expression. Cancer Res, 59: 2029-33, 1999.[Abstract/Free Full Text]
  15. Herman JG, Merlo A, Mao L, et al Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res, 55: 4525-30, 1995.[Abstract/Free Full Text]
  16. Stirzaker C, Millar DS, Paul CL, et al Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors. Cancer Res, 57: 2229-37, 1997.[Abstract/Free Full Text]
  17. Cameron EE, Bachman KE, Myohanen S, Herman JG, Baylin SB. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet, 21: 103-7, 1999.[CrossRef][Medline]
  18. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res, 22: 2990-2, 1994.[Abstract/Free Full Text]
  19. Horii A, Nakatsuru S, Ichii S, Nagase H, Nakamura Y. Multiple forms of APC gene transcripts and their tissue-specific expression. Hum Mol Genet, 2: 283-7, 1993.[Abstract/Free Full Text]
  20. Deng G, Chen A, Pong E, Kim YS. Methylation in hMLH1 promoter interferes with its binding to transcription factor CBF and inhibits gene expression. Oncogene, 20: 7120-7, 2001.[CrossRef][Medline]
  21. Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res, 19: 2499 1991.[Free Full Text]
  22. Osada H, Tatematsu Y, Masuda A, et al Heterogeneous transforming growth factor (TGF)-ß unresponsiveness and loss of TGF-ß receptor type II expression caused by histone deacetylation in lung cancer cell lines. Cancer Res, 61: 8331-9, 2001.[Abstract/Free Full Text]
  23. Esteller M, Corn PG, Baylin SB, Herman JG. A gene hypermethylation profile of human cancer. Cancer Res, 61: 3225-9, 2001.[Abstract/Free Full Text]
  24. Marziali G, Perrotti E, Ilari R, Testa U, Caccia EM, Battistini A. Transcription regulation of the ferritin heavy-chain gene: the activation of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte to macrophage differentiation. Mol Cell Biol, 17: 1387-95, 1997.[Abstract]
  25. Orita T, Shimozake K, Murakami H, Nagata S. Binding of NF-Y transcription factor to one of the cis-elements in the myeloperoxidase gene promoter that responds to granulocyte colony-stimulating factor. J Biol Chem, 272: 23216-23, 1997.[Abstract/Free Full Text]
  26. Kominato Y, Tsuchiya T, Hata N, Takizawa H, Yamamoto F. Transcription of human ABO histo-blood group genes is dependent upon binding of transcription factor CBF/NF-Y to minisatellite sequence. J Biol Chem, 272: 25890-8, 1997.[Abstract/Free Full Text]
  27. Hu Q, Maity SN. Stable expression of a dominant negative mutant of CCAAT binding factor/NF-Y in mouse fibroblast cells resulting in retardation of cell growth and inhibition of transcription of various cellular genes. J Biol Chem, 275: 4435-44, 2000.[Abstract/Free Full Text]
  28. Lindahl GE, Chambers RC, Papakrivopoulou J, et al Activation of fibroblast procollagen {alpha} 1 (I) transcription by mechanical strain is transforming growth factor-ß-dependent and involves increased binding of CCAAT-binding factor (CBF/NF-Y) at the proximal promoter. J Biol Chem, 277: 6153-61, 2002.[Abstract/Free Full Text]
  29. Matsuo N, Yu-Hua W, Sumiyoshi H, et al The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in human {alpha} 1 (XI) collagen gene (COL11A1). J Biol Chem, 278: 32763-70, 2003.[Abstract/Free Full Text]
  30. Guimond J, Devost D, Brodeur H, Mader S, Bhat PV. Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity. Biochim Biophys Acta, 1579: 81-91, 2002.[Medline]
  31. Marziali G, Perrotti E, Ilari R, et al The activity of the CCAAT-box binding factor NF-Y is modulated through the regulated expression of its A subunit during monocyte to macrophage differentiation: regulation of tissue-specific genes through a ubiquitous transcription factor. Blood, 93: 519-26, 1999.[Abstract/Free Full Text]
  32. Goyette MC, Cho C, Fasching CL, et al Progression of colorectal cancer is associated with multiple tumor suppressor gene defects but inhibition of tumorigenicity is accomplished by correction of any single defect via chromosome transfer. Mol Cell Biol, 12: 1387-95, 1992.[Abstract/Free Full Text]
  33. Groden J, Joslyn G, Samowitz W, et al Response of colon cancer cell lines to the introduction of APC, a colon-specific tumor suppressor gene. Cancer Res, 55: 1531-9, 1995.[Abstract/Free Full Text]
  34. Fahrner JA, Eguchi S, Herman JG, Baylin SB. Dependence of histone modifications and gene expression on DNA hypermethylation in cancer. Cancer Res, 62: 7213-8, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
R. Humeniuk, P. J. Mishra, J. R. Bertino, and D. Banerjee
Epigenetic reversal of acquired resistance to 5-fluorouracil treatment
Mol. Cancer Ther., May 1, 2009; 8(5): 1045 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Bernal, F. Aguayo, C. Villarroel, M. Vargas, I. Diaz, F. J. Ossandon, E. Santibanez, M. Palma, E. Aravena, C. Barrientos, et al.
Reprimo as a Potential Biomarker for Early Detection in Gastric Cancer
Clin. Cancer Res., October 1, 2008; 14(19): 6264 - 6269.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
B. Novakovic, V. Rakyan, H.K. Ng, U. Manuelpillai, C. Dewi, N.C. Wong, R. Morley, T. Down, S. Beck, J.M. Craig, et al.
Specific tumour-associated methylation in normal human term placenta and first-trimester cytotrophoblasts
Mol. Hum. Reprod., September 1, 2008; 14(9): 547 - 554.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Li, L. Da, H. Tang, T. Li, and M. Zhao
CpG methylation plays a vital role in determining tissue- and cell-specific expression of the human cell-death-inducing DFF45-like effector A gene through the regulation of Sp1/Sp3 binding
Nucleic Acids Res., January 17, 2008; 36(1): 330 - 341.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Honda, M. J. Pazin, H. Ji, R. P. Wernyj, and P. J. Morin
Crucial Roles of Sp1 and Epigenetic Modifications in the Regulation of the CLDN4 Promoter in Ovarian Cancer Cells
J. Biol. Chem., July 28, 2006; 281(30): 21433 - 21444.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. van Doorn, W. H. Zoutman, R. Dijkman, R. X. de Menezes, S. Commandeur, A. A. Mulder, P. A. van der Velden, M. H. Vermeer, R. Willemze, P. S. Yan, et al.
Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor Suppressor Genes Including BCL7a, PTPRG, and p73
J. Clin. Oncol., June 10, 2005; 23(17): 3886 - 3896.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online