Cancer Research Landon Prizes for Basic and Translational Cancer Research Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brellier, F.
Right arrow Articles by Magnaldo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brellier, F.
Right arrow Articles by Magnaldo, T.
[Cancer Research 64, 2699-2704, April 15, 2004]
© 2004 American Association for Cancer Research

Regular Articles

Ultraviolet Irradiation Represses PATCHED Gene Transcription in Human Epidermal Keratinocytes through an Activator Protein-1-Dependent Process

Florence Brellier1, Claire Marionnet2, Odile Chevallier-Lagente1, Rune Toftgard3, Alain Mauviel4, Alain Sarasin1 and Thierry Magnaldo1

1 Laboratory of Genetic Instability and Cancer, Centre National de la Recherche Scientifique UPR2169, Institut Gustave Roussy, Villejuif Cedex, France; 2 L’OREAL, Life Sciences Advanced Research, Centre C. Zviak, Clichy, France; 3 Department of Biosciences, Karolinska Institutet, Huddinge, Sweden; and 4 INSERM U532, Hôpital Saint Louis, Paris, France


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Basal cell carcinoma (BCC) is one of the major types of skin cancer arising from keratinocytes. The SONIC HEDGEHOG pathway is deregulated in 100% of sporadic BCCs, as indicated by the overexpression of PATCHED, whose product encodes the receptor of SONIC HEDGEHOG, in 100% of analyzed BCCs. Reverse transcription-PCR analysis revealed that exposure to UVB irradiation, which is a risk factor known to contribute to BCC development, induces a strong and sharp decrease of PATCHED mRNA level both in vitro and ex vivo. Transcription of a reporter gene driven by the 4.4-kb 5'-regulatory region of the human PATCHED gene was shown to be down-regulated after UVB irradiation. Furthermore, overexpression of c-JUN, a member of the activator protein (AP)-1 family, induced repression of the PATCHED promoter. The role of AP-1 in UVB-induced PATCHED repression was confirmed in mouse embryonic fibroblasts knocked out for c-JUN NH2-terminal protein kinase. This study thus provides the first evidence of UV-induced down-regulation at the transcriptional level of the BCC-associated tumor suppressor PATCHED relying on activation of the AP-1 oncogenic pathway.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nonmelanoma skin cancers are the most frequent neoplastic affliction in human beings, with increased prevalence in the white population. The two major types of nonmelanoma skin cancer known are basal cell carcinoma (BCC) and squamous cell carcinoma, which both develop from the main epidermal cell type, keratinocytes. BCC and squamous cell carcinoma can be distinguished clinically by their frequency and metastatic and differentiation potentials. In the general population, the frequency of both nonmelanoma skin cancers increases dramatically with sun exposure and age. Strikingly, BCC occurrence (but not squamous cell carcinoma) is exacerbated in the nevoid BCC syndrome [NBCCS (also called Gorlin’s syndrome)], which results from germ-line mutations in one of the PATCHED alleles (1 , 2) . PATCHED is a segment polarity gene originally discovered in Drosophila (3 , 4) . It encodes a protein with 12 putative transmembrane domains that was identified as the receptor of the diffusible protein SONIC HEDGEHOG [SHH (5 , 6) ]. The SHH signaling pathway is required for accurate regulation of proliferation in PATCHED-expressing cells. Studies in Drosophila and laboratory mice have described the essential function of the SHH regulatory pathway in developmental patterning of various organs and tissues such as the neural tube, limbs, and skin and its appendages. PATCHED plays a major role in this pathway by regulating posttranslational modifications and hence activity and subcellular distribution of the SMOOTHENED transmembrane protein (7) . In the absence of SHH, PATCHED acts as a constitutive repressor of SMO activity. In contrast, the presence of SHH abrogates PATCHED-mediated SMO inhibition and results in transcriptional activation of SHH target genes, leading to cell proliferation via GLI transcriptional factors. Most notably, SHH-induced SMO activation increases the transcription of PATCHED itself, suggesting a retro regulation loop. The detection of PATCHED transcript accumulation in 100% of BCCs analyzed (8) suggests a deregulation in the SHH pathway and hence a mutation in one of the protagonists of this pathway in every BCC. Also, experimental deregulations of the SHH pathway in transgenic animals overexpressing SHH (9) and in PATCHED heterozygote knockout mice (10 , 11) have led to a significantly increased proneness toward spontaneous and induced BCC-like tumors, respectively.

In this study, we took into account that about 50% of the detected PATCHED mutations in sporadic BCC are C to T transversion or CC to TT tandem mutations (i.e., resulting from UV-induced DNA lesions; Ref. 12 ) and that BCCs from xeroderma pigmentosum patients, who have impaired DNA repair capacity, exhibit a high level (about 75%) of PATCHED mutations, of which about 80% also result from UV-induced DNA lesions (13) .

These data have suggested to us that UV light, as seen for the prototype tumor suppressor P53 gene product (14) , could modulate expression of the PATCHED gene in epidermal cells.

In this study, we show that the PATCHED mRNA level decreases dramatically after exposure of human epidermis ex vivo and cultured epidermal keratinocytes to a moderate dose of UV (UVB; 305–320 nm) irradiation. Furthermore, we prove that this abrogation results from the repression of PATCHED promoter activity and demonstrate that this mechanism relies specifically on activation of the activator protein (AP)-1 pathway.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Skin Sample Culture.
Volunteers 1–3 were 3, 24, and 28 years old, respectively. Pieces of human skin were irradiated as described below and maintained in culture at the air-liquid interface for a maximum of 48 h (15) .

Cell Culture.
Normal keratinocytes were obtained from abdominal surgery on a 3-year-old child and cultured as described by Rheinwald and Green (16) on a feeder layer of X-ray (60 Gy)-irradiated Swiss 3T3 fibroblasts. All experiments were performed using keratinocytes at passages 3–6.

The c-JUN NH2-terminal kinase (JNK) 1/2–/– and JNK1/2+/+ murine embryonic fibroblasts (MEFs) are generous gifts from Erwin F. Wagner (Research Institute of Molecular Pathology, Vienna, Austria; Ref. 17 ), and NEMO–/– and NEMO+/+ MEFs are generous gifts from Manolis Pasparakis (European Molecular Biology Laboratory, Monterotondo, Italy; Ref. 18 ). Cells were cultured at 37°C in a 10% CO2 atmosphere.

Cell and Skin UV Irradiation.
For mRNA preparation, irradiations were performed on postconfluent cultures of keratinocytes (i.e., 6 or 7 days after confluence). UVB irradiations were performed as described previously and using the same materials (19) . Briefly, cells were rinsed twice with PBS prewarmed to 37°C and irradiated. To avoid interference between the effects of irradiation and those resulting from new serum supplementation, cells were fed with the same medium that covered them before irradiation. Freshly isolated normal human skin was cut into 1-cm2 pieces; rinsed for 10 min in PBS containing fungizone, penicillin, and streptomycin; rinsed with PBS prewarmed to 37°C; and exposed to 1000 J/m2 UVB.

Chemicals.
SP600125 (anthrapyrazolone 1,9-pyrazoloanthrone), a selective inhibitor of JNK, was purchased from Sigma Chemical Co. (St. Louis, MO). Concentrated stock solutions of SP600125 (20 mM) in DMSO were diluted into the culture medium. DMSO alone was used as control.

RNA Preparation and Reverse Transcription (RT)-PCR.
Skin pieces were laid flat and frozen with liquid nitrogen. Horizontal 60-µm cryostat cuts permitted recovery of whole epidermis with minimal dermis contamination. Total RNA from epidermis cuts was obtained according to the manufacturer’s instructions using the RNeasy mini-kit (Qiagen).

Total RNA was extracted from cultured cells according to the method of Chomczynski and Sacchi (20) . Reverse transcription was performed using oligo(dT) (15) with GIBCO Superscript II reverse transcriptase, according to the manufacturer’s protocol. cDNA was amplified with 2 units of Taq DNA polymerase (Roche). Primers used for PATCHED amplification are PATCHED5651F (5'-GATAAGAGCTCCGGGGGATTC-3') and PATCHED6033R (5'-CACAGTAGCTTAGGCTTCAGCCC-3'). Primers used for GAPDH amplification are hGAPDH701F (CCAAGGCTGTGGGCAAGGTCAT) and hGAPDH1236R (TGACAAGGTGCGGCTCCCTAGG). PATCHED and GAPDH cDNA fragments were amplified in separate tubes under semiquantitative conditions.

All GAPDH and PATCHED RT-PCR products were analyzed in the same experiment by 2% agarose gel electrophoresis followed by SYBR staining and scanning (STORM; Molecular Dynamics, Sunnyvale, CA). Results of scanning were processed using ImageQuant software (Amersham Biosciences, Amersham, United Kingdom) and plotted.

Plasmid Construction.
PATCHED-luc consists of a 4.4-kb fragment of the 5'-regulatory region of human PTCH1 (21) controlling the firefly luciferase reporter gene in pGL3-Basic vector (Promega, Madison, WI). PP1-luc, PP2-luc, and PP3-luc were constructed by insertion upstream of the luciferase gene in pGL3-Enhancer vector (Promega) of various fragments of the 5'-regulatory region of human PATCHED1 (nucleotides 1–1526, 1447–2907, and 2843–4404, respectively), which were prepared by PCR. PP2–3, which encompasses nucleotides 1729–4404, was constructed by deletion of a fragment of PATCHED-luc. K5-luc was constructed by insertion of a 0.9-kb fragment of the 5'-regulatory region of human cytokeratin K5 (22) upstream of the luciferase gene in pGL3-Enhancer vector (Promega). Human K5 promoter gene was a generous gift from Dr. M. Blumenberg (New York University School of Medicine, New York, NY).

Transient Transfection Assays.
Keratinocytes were seeded 48 h before transfection at 1.1 x 104 cells/cm2. Twenty-four h before transfection, cells were rinsed with PBS and fed with keratinocyte serum-free medium (GIBCO/BRL, Bethesda, MD) containing 30 µg/ml bovine pituitary extract, 0.1 ng/ml epidermal growth factor, 0.1 mM CaCl2, 20 IU/ml penicillin-streptomycin, and 0.5 µg/ml fungizone. Immediately before transfection, the medium was changed for keratinocyte serum-free medium containing 0.1 mM CaCl2. MEFs were seeded 24 h before transfection at 3.3 x 104 cells/cm2.

The plasmid ratio was determined so that gene reporter activities range in measurable values (PATCHED-luc/RSV-ß-Gal, 1000/200; K5-luc/RSB-ß-Gal/pSK+, 15/500/700; PPX-luc/RSV-ß-Gal, 100/1000; PATCHED-luc/CMV-ß-Gal/RSV-AP-1 member, 1000/100/1000). Plasmids were transfected using FuGENE 6 reagent (Roche). Irradiation and sham irradiation were performed 24 h after transfection. Luciferase and ß-galactosidase (ß-Gal) activities were measured using the luciferase assay system and ß-Gal enzyme assay system kits (Promega). The transcriptional activity of the human PATCHED 5'-regulatory region was calculated as normalized light units in treated cells/normalized light units in sham-treated cells x 100. All transfections were repeated at least twice, in duplicates, thus representing at least four experimental points.

Western Blot Analysis.
Ten µg of protein extract were separated by a 12% acrylamide-SDS electrophoresis. Protein samples were then transferred onto polyvinylidene difluoride membrane (Amersham Biosciences) and probed with a polyclonal anti-c-JUN antibody (sc-45; dilution, 1:1000; Santa Cruz Biotechnology, Santa Cruz, CA). Blots were revealed using electrochemiluminescence reagents according to the manufacturer’s instructions (Amersham Biosciences).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
UVB-Induced Decrease of PATCHED mRNA in Normal Epidermis and Differentiated Cultures of Keratinocytes.
To study the impact of UVB on PATCHED mRNA accumulation, RT-PCR was performed on RNA extracted from postconfluent cultures of human wild-type epidermal keratinocytes at various times after irradiation. A single UVB irradiation (500 J/m2; i.e., about 70% cell survival; Ref. 23 ) resulted in a marked decrease in PATCHED mRNA level 4–8 h after irradiation. Under these circumstances, the level of PATCHED mRNA was fully recovered 24 h after irradiation (Fig. 1, A and B)Citation .



View larger version (45K):
[in this window]
[in a new window]
  		Fig. 1. PATCHED mRNA decreases after UVB irradiation of human epidermis and cultured primary keratinocytes. RNA was extracted from either confluent cultures of primary normal human keratinocytes (A and B) or explants of freshly biopsed epidermis (C) at the indicated times after exposure to a single dose of UVB. PATCHED and GAPDH cDNA were amplified by PCR as described in "Materials and Methods." A, separation of reverse transcription-PCR products on 2% agarose gels. Wild-type keratinocytes A and B refer to two independent primary human normal keratinocyte strains tested. B, levels of PATCHED to GAPDH in irradiated keratinocytes (500 J/m2) relative to that obtained in nonirradiated cultures are plotted. C, levels of PATCHED to GAPDH in irradiated human skin samples (1000 J/m2) relative to that obtained in nonirradiated ones are plotted. B, gray line, wt keratinocytes A; black line, wt keratinocytes B. C, dotted line, volunteer no. 1; dashed line, volunteer no. 2; black line, volunteer no. 3.

 
To determine whether the decrease of PATCHED mRNA after UVB was relevant to the in vivo situation, freshly biopsied skin of several normal volunteers in the same phototype range was maintained in explant cultures and irradiated or not irradiated (Fig. 1C)Citation . In the absence of UV irradiation, the PATCHED mRNA level was similarly expressed at a fairly low (about 2–3 times less than that in postconfluent keratinocyte cultures as shown in Fig. 1ACitation ) but detectable level in all three individuals tested. Exposure to a moderate dose of UVB (1000 J/m2) resulted in a dramatic decrease (about 80%) of PATCHED mRNA levels relative to those of the GAPDH control gene, which remained unchanged. The maximal repression of the PATCHED mRNA level was found between 4 and 8 h after irradiation. In these three samples, PATCHED mRNA level returned to its initial value 24–48 h after UVB irradiation. These data indicated that (a) PATCHED is expressed at a low level in the epidermis, (b) PATCHED mRNA level decreases after UVB irradiation, and (c) the half-life of PATCHED mRNA is quite short.

Dose-Dependent PATCHED Transcriptional Repression after UVB Irradiation.
To monitor possible effects of UVB on PATCHED gene transcription, we used a reporter construct harboring 4.4 kb of the 5'-regulatory region of the human PATCHED gene. Primary cultures of normal human epidermal keratinocytes were transfected with this construct and exposed to a single UVB dose (1600 J/m2) corresponding to the IC10 in these cells (23) . The relative level of reporter gene activity was then measured at various times after irradiation (Fig. 2)Citation . UVB induced a sharp decrease in the transcriptional activity of the PATCHED promoter. The minimal value was observed 10–15 h after irradiation, where it was about 30% of that of sham-irradiated controls. Transcriptional activity of the reporter was fully restored 30 h after irradiation. We also performed irradiation at doses ranging from 100 to 1600 J/m2 and measured the reporter activity 10 and 30 h after irradiation. As shown in Fig. 3Citation , this experiment underlines the dose-dependent repression of UVB irradiation on PATCHED promoter. To verify that these observations did not result from alteration of the firefly luciferase activity by UVB, keratinocytes were also transfected with a reporter plasmid bearing the human K5 keratin gene promoter upstream of the same reporter gene and irradiated under the same conditions. Relative activity of the K5 promoter remained constant after UVB irradiation (Fig. 3)Citation , pointing out the specificity of UVB-induced repression of PATCHED gene transcription.



View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2. UVB represses PATCHED mRNA accumulation through a transcriptional mechanism. Keratinocytes cotransfected with the PATCHED-luc reporter and the RSV-ß-Gal control vectors were exposed or not exposed (sham irradiation) to a single 1600 J/m2 UVB irradiation. Cells were then harvested at the indicated times after irradiation. The relative transcriptional activity of the PATCHED promoter was calculated after normalization of transfection efficiency using ß-galactosidase values as standard (see "Materials and Methods").

 


View larger version (44K):
[in this window]
[in a new window]
  		Fig. 3. UVB-induced PATCHED transcriptional repression is specific and dose dependent. Keratinocytes cotransfected with either the PATCHED-luc reporter and RSV-ß-Gal control vectors (PATCHED) or the K5-luc and RSV-ß-Gal control vectors (K5) were exposed or not exposed (sham irradiation) to a single increasing UVB dose as indicated. Cells were then harvested 10 or 30 h after irradiation as indicated.

 
Functional Dissection of the PATCHED Gene Regulatory Region.
To delineate which of the promoter regions are responsible for UVB-induced PATCHED repression, three overlapping fragments (PP1, nucleotides 1–1526; PP2, nucleotides 1447–2907; and PP3, nucleotides 2843–4404) of the 4.4-kb regulatory region of the PATCHED gene were inserted upstream of the reporter gene (Fig. 4A)Citation . Their respective reporter activities were measured in keratinocytes after transfection and UVB irradiation (1600 J/m2) followed by a 15-h postirradiation period (a time necessary to reach maximal down-regulation of the 4.4-kb promoter activity; Fig. 2Citation ). Reporter activity of PP1-luc was slightly (about 20%) increased by UVB. In contrast, activities of both PP2-luc and PP3-luc were repressed by 30%. A fourth fragment (PP2–3, nucleotides 1729–4404) encompassing PP2 and PP3 was then constructed, and its response to UVB was analyzed. Activity of PP2–3-luc was repressed by 60% after UVB irradiation, suggesting additive responses of PP2 and PP3 to UVB (see Fig. 4BCitation ).



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 4. Functional dissection of the 5'-regulatory region of the human PATCHED gene. In silico analyses predicted the presence of four putative activator protein (AP)-1 sequences (A). The possible implication of these sequences was then assessed by dividing the PATCHED gene 5'-regulatory region into three subfragments (PP1, PP2, and PP3) cloned upstream of the luciferase reporter gene. A fourth fragment encompassing PP2 and PP3 (PP2–3) and containing all four of the putative AP-1 sequences identified was also constructed. Nucleotide delineating ends of each DNA fragments are indicated. In B, keratinocytes cotransfected with the indicated PPX-luc reporter and the RSV-ß-Gal control vectors were exposed or not exposed (sham irradiation) to a single 1600 J/m2 UVB irradiation 30 h after transfection. Cells were then harvested 15 h after irradiation.

 
Role of AP-1 in PATCHED UVB-Induced Repression.
To assess a priori which regulatory transcriptional pathway could be involved in UVB-induced repression of PATCHED gene expression, we performed in silico analyses. Among numerous putative regulatory DNA sequences, we paid special attention to four sequences resembling the AP-1 canonical binding sequence [TGA(C/G)TCA] located in the PATCHED regulatory region. AP-1 is a complex transcriptional factor known to mediate UVB-modulated gene expression. Two putative variant AP-1-binding sequences were found in the PP2 promoter DNA fragment (AP-1-1, 2124: TGAGTAA; AP-1-2, 2313: TGAAT-CA—numbers indicate the 5'nucleotide of the AP-1 binding sequence in the PATCHED promoter), whereas the two others were located in the PP3 promoter fragment [AP-1-3, 3461: TGAGTGA; AP-1-4, 4303: TAATTCA (Fig. 4A)Citation ].

To test the functionality of those putative variant AP-1 sites, transcriptional activity of the full-length PATCHED promoter was measured in cotransfection experiments using expression vectors for AP-1 members [i.e., c-FOS, FOSB, FRA-1, and FRA-2 and c-JUN, JUN-B, and JUN-D, which belong to the FOS and JUN family, respectively]. Fig. 5ACitation shows that overexpression of c-FOS and c-JUN induced a 60% decrease of PATCHED promoter activity. Overexpression of JUN-D and JUN-B resulted in a more modest but clear (up to 30–40%) decrease of PATCHED promoter activity. To the contrary, transfection of FRA-1 or FRA-2 resulted in a 75% and 35% increase of PATCHED promoter transcriptional activity, respectively (see Fig. 5BCitation ). These observations strongly suggest that c-JUN and c-FOS proteins play an essential role in UVB-induced transcriptional repression of PATCHED gene expression. To confirm that activation of the AP-1 pathway occurs in our cellular system, we analyzed the level of c-JUN proteins after a moderate dose of UVB irradiation (500 J/m2) by Western blot. As shown in Fig. 5CCitation , the c-JUN level was strongly increased as early as 1 h after irradiation. The high level of c-JUN persisted up to 4 h postirradiation, and the level of c-JUN returned to its initial value 48 h postirradiation.



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 5. Activator protein (AP)-1 proto-oncoproteins modulate PATCHED gene transcription. Keratinocytes were cotransfected with the PATCHED-luc reporter and vectors encoding AP-1 members, as indicated. Cells were harvested 72 h after transfection. AP-1 family members resulting in transcriptional repression (A) and transcriptional activation (B) of PATCHED promoter are indicated. C, Western blot analysis of c-JUN expression after transfection (+) or no transfection (–) of its expression plasmid. ni represents c-JUN expression in extracts from nonirradiated keratinocytes; numbers 1–72 indicate c-JUN expression at various times after a single UVB exposure at a 500 J/m2 dose. Star indicates a nonspecific band. Arrow indicates the specific c-JUN band.

 
JNK phosphorylates JUN proteins after UVB irradiation (24) and thereby enhances their capacity to regulate target gene transcription. This kinase thus plays a pivotal role in UVB-induced AP-1 activation. To confirm the AP-1 requirement for PATCHED UV-induced transcriptional repression, PATCHED transcriptional activity was measured in cells in which JNK activity was abrogated either stably by genetic manipulations or transiently by chemical inhibition.

First, PATCHED transcriptional activity was evaluated after exposure to UVB of MEFs from either wild-type embryos or embryos in which JNKs 1 and 2 have been inactivated by knockout experiments. As shown in Fig. 6ACitation , down-regulation of PATCHED transcription after UVB irradiation occurred in wild-type MEFs, but was abolished in JNK1/2–/– MEFs. As a control, we checked that UVB regulation of PATCHED transcription was maintained in MEFs with disrupted IKK{gamma} gene (NEMO–/– MEFs), which encodes an essential component of the nuclear factor-{kappa}B transduction pathway (25) . These data indicate that the AP-1 pathway, but not the nuclear factor-{kappa}B pathway, is an essential component of UVB-induced down-regulation of PATCHED gene transcription.



View larger version (26K):
[in this window]
[in a new window]
  		Fig. 6. Functional activity of c-JUN NH2-terminal kinase is essential to UVB-induced transcriptional repression of PATCHED. A, mouse embryonic fibroblasts with the indicated genotypes (JNK+/+, –/–; NEMO+/+, –/–) cotransfected with the PATCHED-luc reporter and RSV-ß-Gal control vectors were exposed or not exposed (sham irradiation) to a single 1600 J/m2 UVB irradiation 30 h after transfection. Cells were then harvested 15 h after irradiation. B, human normal keratinocytes were cotransfected with reporter vector (PATCHED-luc) and control vectors (RSV-ß-Gal). Fifteen h before irradiation, cultures were fed with serum-free medium containing either the JNK inhibitor SP600125 (10 µM) in 0.1% DMSO or 0.1% DMSO alone (Vehicle). Cells were then irradiated with a 1600 J/m2 dose of UVB or sham-irradiated and lysed 10 h later.

 
Second, PATCHED transcriptional activity was measured in keratinocytes preincubated with a selective inhibitor of JNK (SP600125) for 15 h before irradiation. Under these conditions, UVB-induced repression of PATCHED promoter was no longer observed, underscoring the requirement of c-JUN activation for this UV-induced response (Fig. 6B)Citation .


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
UV irradiation and, in particular, the UVB wavelength play a major role in the modulation of protein abundance, regulating transcriptional, posttranscriptional, and posttranslational mechanisms (26) . In response to the UV mutagenic insult, various and complex pathways are regulated to ensure adequate control of the cell cycle, leading to inhibition of proliferation and allowing DNA repair mechanisms to proceed.

Exposure to UV light has been clearly established in the etiology of skin tumors from keratinocyte origin. Most notably, the high frequency of mutations in the PATCHED tumor suppressor gene in BCCs has put forth the SHH pathway as a key player in epidermal homeostasis (27) , and this has been confirmed by analysis of the effects of SHH on the proliferation capacity of keratinocyte cultures (28) . However, because a possible role of this pathway in the response of epidermal cells to UV irradiation has remained unexplored, we attempted to determine whether exposure of human epidermis and cultured keratinocytes to UVB radiation may affect PATCHED gene expression.

Down-Regulation of PATCHED Gene Expression Seems Linked to Cell Proliferation.
Exposure of human epidermis and keratinocytes in culture to a moderate dose of UVB resulted in a sharp and rapid (4–8 h after irradiation) decrease of PATCHED mRNA level. The UVB dose (500 J/m2) used to irradiate keratinocytes in culture led to about 70% keratinocyte survival as measured by clonal analysis. Using a 4.4-kb-long 5'-regulatory region of the human PATCHED gene, we showed that decrease of PATCHED mRNA accumulation results, at least in part, from transcriptional repression. Mean inhibition of PATCHED transcription measured using luciferase assay (i.e., in preconfluent cultures for efficient transfection) occurred 10–15 h after irradiation and was about 60% (Fig. 2)Citation , whereas decrease of PATCHED mRNA accumulation in postconfluent keratinocyte cultures was almost total 4–8 h after exposure to 500 J/m2 UVB irradiation (Fig. 1B)Citation . It was then worth noting that both kinetics and amplitude of regulation were slightly different, depending on whether analyses were carried out by RT-PCR or by transfection-mediated luciferase assay. Differential kinetics of regulation could result from different mRNA half-life of endogenous PATCHED and luciferase transcripts. In addition, the luciferase assay reflects the activity of the reporter protein, the production of which may be delayed compared with that of the endogenous PATCHED transcript. Also, differential amplitudes of regulation of mRNA accumulation and transcription assay could be linked to differences in rates of keratinocyte proliferation inherent to experimental conditions of either RT-PCR (postconfluent cultures) or transfection analyses (preconfluent cultures). Indeed, preliminary experiments indicated that the decrease of PATCHED mRNA accumulation in preconfluent cultures was much lower (about 60%; data not shown) than that seen in postconfluent cultures of normal keratinocytes.

AP-1 Oncoproteins Mediate UVB-Induced Transcriptional Repression of PATCHED through Variant TREs.
In silico analyses of a 4.4-kb 5'-regulatory region of the PATCHED gene revealed four putative AP-1 sequences (AP-1-1 to AP-1-4; Fig. 4ACitation ). A major actor of the AP-1 family is c-JUN, which is one of the earliest UV-responsive genes (29) . Transcriptional activation of AP-1 target genes (including c-JUN itself) requires rapid phosphorylation of c-JUN by stress-activated JNKs 1 and 2. Indeed, the amount of the c-JUN protein was dramatically and rapidly increased after UVB irradiation (Fig. 5B)Citation , probably as a consequence of increased transcription and its activation by stress-activated JNK. The pivotal role in UVB-induced transcriptional repression of PATCHED after UVB could be demonstrated by complementary approaches based on transfection of AP-1 members, use of JNK1/2 knockout mouse embryonic fibroblasts, and use of the pharmacological SP600125 JNK inhibitor. In addition, ionizing radiation failed to modulate PATCHED gene transcription (data not shown). The latter observation was in agreement with the lack of JNK activation in mouse fibroblasts exposed to ionizing radiation (30) and indicated that the prominent role of AP-1 activation in UVB-induced transcriptional repression of PATCHED exhibits some specificity.

AP-1 has been mostly characterized by its capacity to transactivate target genes (31) . However, it has also been shown to act as a transcriptional repressor of target genes through its direct binding to canonical (TGAC/GTCA) or variant 12-O-tetradecanoylphorbol-13 acetate (TPA)-responsive sequences. As an example, c-JUN down-regulates transcription of the human P53 gene promoter through its direct binding to a variant AP-1 DNA sequence called PF1 (TGACTCT; Ref. 32 ). Thus, both the spectrum of DNA sequences being recognized by AP-1 factors and their effects on gene transcription may vary according to target genes and cellular context. Our cotransfection experiments showed that overexpression of c-FOS, JUN-B, and JUN-D leads to down-regulation of PATCHED promoter, whereas overexpression of FRA-1 and FRA-2 results in its up-regulation. First, these differences may be explained by the fact that each AP-1 member harbors a specific function. Indeed, it is known that different AP-1 dimers exhibit different transcriptional activities (33 , 34) . Second, AP-1 members exhibit an activation specificity. JNKs phosphorylate c-JUN and, to a lesser extent, JUN-D and do not phosphorylate JUN-B (35) . c-FOS (36) and FRA-1 (37) activation requires activity of the extracellular signal-related kinases. Basal activity levels of JNKs and extracellular signal-related kinases without UV stimulation may differ in our cultures conditions and thereby lead to differential activation of transfected AP-1 members.

Physiological Impact of UVB-Induced Transcriptional Repression of PATCHED.
Transcriptional repression of tumor suppressor gene after exposure to a genotoxic stress such as UV radiation may appear paradoxical. However, the example of dual opposite regulation (i.e., transcriptional and posttranslational) of the prototypic tumor suppressor gene P53 by UV radiation sheds much light in this respect. c-JUN constitutively represses P53 gene transcription (32) , suggesting that UVB-induced activation of c-JUN may result in repression of P53 transcription. However, the P53 protein accumulates after UV irradiation of normal cells and in cells lacking c-JUN (32) , suggesting the requirement of an AP-1-independent process for this stabilization. On one hand, P53 accumulation ensures quasi-immediate G1-S block, allowing DNA repair of UV-induced lesions to proceed. On the other hand, transcriptional repression of P53 may limit production of aberrant proteins from lesion-bearing mRNAs.

Like P53, PATCHED contributes to regulation of the cell cycle. PATCHED physically and functionally interacts with cyclin B1, an M-phase promoting factor. In the absence of stimulatory signal (SHH) of the SHH pathway, PATCHED binding to cyclin B1 inhibits its nuclear translocation and thus its cell cycle resumption activity. PATCHED-induced repression of cyclin B1 is released by its binding to SHH (38) . UV-induced DNA damage is known to prevent cyclin B1 nuclear translocation (39) , a process expected to limit cell proliferation. In this context, it will be very important to determine the fate of the PATCHED protein after UV irradiation. However, the lack of any reliable antibody able to specifically recognize the endogenous PATCHED protein remains a strong limitation in this regard.

Proliferation versus Differentiation: Is c-JUN a Dual Modulator of Epidermal Homeostasis?
In most tissues studied, AP-1 subunits have been shown to promote cell proliferation. In this context, it may appear paradoxical to observe that in the epidermal compartment of skin, AP-1 subunits have been described rather as transcriptional factors implicated in the differentiation process. c-JUN and c-FOS have been detected predominantly in suprabasal (i.e., postmitotic) epidermal layers (40) . Accordingly, most AP-1 target genes identified thus far encode suprabasal markers of keratinocyte differentiation including transglutaminase (41) , loricrin (42) , or K6 cytokeratin (43) .

However, P53, the prototype suppressor gene whose inactivating mutations are associated with more than 50% of BCC and squamous cell carcinoma (44) , is expressed in the basal epidermal layer (45) . In turn, P53 transcriptional activity is directly repressed after c-JUN activation, allowing exit from P53-imposed growth arrest (46) . c-JUN and P53 activities on cell cycle regulation must then necessarily operate within keratinocytes of the basal epidermal layer. These data suggest an important role for c-JUN in the control of proliferation of basal epidermal keratinocytes. Similarly, a high level of PATCHED mutations has been reported in BCC (27) , an epidermal tumor presumably originating from cells residing in the hair follicle area or basal epidermis. Our present demonstration that c-JUN also represses PATCHED transcription further strengthens the hypothesis that c-JUN plays a dual role in the epidermis by constitutively regulating suprabasal differentiation, on one hand, and inducibly (e.g., after UV) controlling cell cycle actors in basal keratinocytes, on the other hand.

UV Regulation of PATCHED Expression in NBCCS Patients: Clues to BCC Development?
Patients suffering from NBCCS bear a mutated allele of PATCHED that most often encodes a truncated, presumably inactivated PATCHED protein (47) . If transcriptional repression of PATCHED expression results in a decreased amount of the PATCHED protein, exposure of NBCCS keratinocytes to UV irradiation could result in exacerbated haploinsufficiency. Such a mechanism could explain the high proneness of NBCCS patients to BCCs, especially in sun-exposed body areas. To limit spontaneous and UV-induced skin tumorigenesis, NBCCS patients are often treated with retinoic acid (48) , a well-characterized inhibitor of the AP-1 pathway (49) . Our present finding identifying AP-1 as a key regulator of PATCHED gene expression thus sheds light onto molecular regulations contributing to BCC development in NBCCS patients as well as in the general population and may help improve the prevention and treatment of sporadic and familial BCCs.


   ACKNOWLEDGMENTS
 
We thank Erwin F. Wagner for the gift of JNK–/– and JNK+/+ MEFs and Manolis Pasparakis for the gift of NEMO–/– and NEMO+/+ MEFs.


   FOOTNOTES
 
Grant support: Grants from the Ligue contre le Cancer and funds from Centre National de la Recherche Scientifique. F. Brellier was the recipient of a doctoral Centre National de la Recherche Scientifique fellowship. T. Magnaldo is supported by funds from the Association pour la Recherche sur le Cancer (9500). R. Toftgard is supported by grants from the Swedish Cancer Fund.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Thierry Magnaldo, Laboratory of Genetic Instability and Cancer, Centre National de la Recherche Scientifique UPR2169, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805, Villejuif Cedex 05, France.

Received 11/ 6/03. Revised 1/12/04. Accepted 2/12/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hahn H, Christiansen J, Wicking C, et al A mammalian patched homolog is expressed in target tissues of sonic hedgehog and maps to a region associated with developmental abnormalities. J Biol Chem, 271: 12125-8, 1996.[Abstract/Free Full Text]
  2. Johnson R, Rothman A, Xie J, et al Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science (Wash DC), 272: 1668-71, 1996.[Abstract]
  3. Hooper J, Scott M. The Drosophila patched gene encodes a putative membrane protein required for segmental patterning. Cell, 59: 751-65, 1989.[CrossRef][Medline]
  4. Nakano Y, Guerrero I, Hidalgo A, et al A protein with several possible membrane-spanning domains encoded by the Drosophila segment polarity gene patched. Nature (Lond), 341: 508-13, 1989.[CrossRef][Medline]
  5. Marigo V, Davey RA, Zuo Y, Cunningham JM, Tabin CJ. Biochemical evidence that patched is the Hedgehog receptor. Nature (Lond), 384: 176-9, 1996.[CrossRef][Medline]
  6. Stone DM, Hynes M, Armanini M, et al The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature (Lond), 384: 129-34, 1996.[CrossRef][Medline]
  7. Denef N, Neubuser D, Perez L, Cohen SM. Hedgehog induces opposite changes in turnover and subcellular localization of patched and smoothened. Cell, 102: 521-31, 2000.[CrossRef][Medline]
  8. Unden AB, Zaphiropoulos PG, Bruce K, Toftgard R, Stahle-Backdahl M. Human patched (PTCH) mRNA is overexpressed consistently in tumor cells of both familial and sporadic basal cell carcinoma. Cancer Res, 57: 2336-40, 1997.[Abstract/Free Full Text]
  9. Oro AE, Higgins KM, Hu Z, et al Basal cell carcinomas in mice overexpressing sonic hedgehog. Science (Wash DC), 276: 817-21, 1997.[Abstract/Free Full Text]
  10. Goodrich LV, Milenkovic L, Higgins KM, Scott MP. Altered neural cell fates and medulloblastoma in mouse patched mutants. Science (Wash DC), 277: 1109-13, 1997.[Abstract/Free Full Text]
  11. Hahn H, Wojnowski L, Zimmer AM, et al Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nat Med, 4: 619-22, 1998.[CrossRef][Medline]
  12. Daya-Grosjean L, Sarasin A. UV-specific mutations of the human patched gene in basal cell carcinomas from normal individuals and xeroderma pigmentosum patients. Mutat Res, 450: 193-9, 2000.[Medline]
  13. Bodak N, Queille S, Avril MF, et al High levels of patched gene mutations in basal-cell carcinomas from patients with xeroderma pigmentosum. Proc Natl Acad Sci USA, 96: 5117-22, 1999.[Abstract/Free Full Text]
  14. Maltzman W, Czyzyk L. UV irradiation stimulates levels of p53 cellular tumor antigen in nontransformed mouse cells. Mol Cell Biol, 4: 1689-94, 1984.[Abstract/Free Full Text]
  15. Bernerd F, Asselineau D. Successive alteration and recovery of epidermal differentiation and morphogenesis after specific UVB-damages in skin reconstructed in vitro. Dev Biol, 183: 123-38, 1997.[CrossRef][Medline]
  16. Rheinwald JG, Green H. Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell, 6: 331-44, 1975.[CrossRef][Medline]
  17. Hochedlinger K, Wagner E, Sabapathy K. Differential effects of JNK1 and JNK2 on signal specific induction of apoptosis. Oncogene, 21: 2441-5, 2002.[CrossRef][Medline]
  18. Schmidt-Supprian M, Bloch W, Courtois G, et al NEMO/IKK {gamma}-deficient mice model incontinentia pigmenti. Mol Cell, 5: 981-92, 2000.[CrossRef][Medline]
  19. Robert C, Muel B, Benoit A, et al Cell survival and shuttle vector mutagenesis induced by ultraviolet A and ultraviolet B radiation in a human cell line. J Investig Dermatol, 106: 721-8, 1996.[CrossRef][Medline]
  20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem, 162: 156-9, 1987.[Medline]
  21. Shin S, Kogerman P, Lindstrom E, Toftgard R, Biesecker L. GLI3 mutations in human disorders mimic Drosophila cubitus interruptus protein functions and localization. Proc Natl Acad Sci USA, 96: 2880-4, 1999.[Abstract/Free Full Text]
  22. Ohtsuki M, Tomic-Canic M, Freedberg IM, Blumenberg M. Nuclear proteins involved in transcription of the human K5 keratin gene. J Investig Dermatol, 99: 206-15, 1992.[CrossRef][Medline]
  23. Arnaudeau-Bégard C, Brellier F, Chevallier-Lagente O, et al Genetic correction of DNA repair deficient/cancer prone xeroderma pigmentosum group C keratinocytes. Hum Gene Ther, 14: 983-96, 2003.[CrossRef][Medline]
  24. Hibi M, Lin A, Smeal T, Minden A, Karin M. Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev, 7: 2135-48, 1993.[Abstract/Free Full Text]
  25. Li X, Fang X, Gaynor R. Role of IKK{gamma}/nemo in assembly of the I{kappa}B kinase complex. J Biol Chem, 276: 4494-500, 2001.[Abstract/Free Full Text]
  26. Bender K, Blattner C, Knebel A, et al UV-induced signal transduction. J Photochem Photobiol B Biol, 37: 1-17, 1997.[CrossRef][Medline]
  27. Unden AB, Holmberg E, Lundh-Rozell B, et al Mutations in the human homologue of Drosophila patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms of PTCH inactivation. Cancer Res, 56: 4562-5, 1996.[Abstract/Free Full Text]
  28. Fan H, Khavari PA. Sonic hedgehog opposes epithelial cell cycle arrest. J Cell Biol, 147: 71-6, 1999.[Abstract/Free Full Text]
  29. Devary Y, Gottlieb R, Lau L, Karin M. Rapid and preferential activation of the c-jun gene during the mammalian UV response. Mol Cell Biol, 11: 2804-11, 1991.[Abstract/Free Full Text]
  30. Shaulian E, Karin M. Stress-induced JNK activation is independent of Gadd45 induction. J Biol Chem, 274: 29595-8, 1999.[Abstract/Free Full Text]
  31. Angel P, Karin M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta, 1072: 129-57, 1991.[Medline]
  32. Schreiber M, Kolbus A, Piu F, et al Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev, 13: 607-19, 1999.[Abstract/Free Full Text]
  33. Chiu R, Angel P, Karin M. Jun-B differs in its biological properties from, and is a negative regulator of c-Jun. Cell, 59: 979-86, 1989.[CrossRef][Medline]
  34. Hirai S, Bourachot B, Yaniv M. Jun and Fos contribute to transcription activation by the heterodimer. Oncogene, 5: 39-46, 1990.[Medline]
  35. Kallunki T, Deng T, Hibi M, Karin M. c-Jun can recruit JNK to phosphorylate dimerization partners via specific docking interactions. Cell, 87: 929-39, 1996.[CrossRef][Medline]
  36. Price M, Cruzalegui F, Treisman R. The p38 and ERK MAP kinase pathways cooperate to activate ternary complex factors and c-fos transcription in response to UV light. EMBO J, 15: 6552-63, 1996.[Medline]
  37. Young M, Nair R, Bucheimer N, et al Transactivation of Fra-1 and consequent activation of AP-1 occur extracellular signal-regulated kinase dependently. Mol Cell Biol, 22: 587-98, 2002.[Abstract/Free Full Text]
  38. Barnes E, Kong M, Ollendorff V, Donoghue D. Patched1 interacts with cyclin B1 to regulate cell cycle progression. EMBO J, 20: 2214-23, 2001.[CrossRef][Medline]
  39. Toyoshima F, Moriguchi T, Wada A, Fukuda M, Nishida E. Nuclear export of cyclin B1 and its possible role in the DNA damage-induced G2 checkpoint. EMBO J, 17: 2728-35, 1998.[CrossRef][Medline]
  40. Basset-Seguin N, Escot C, Moles J, et al C-fos and c-jun proto-oncogene expression is decreased in psoriasis: an in situ quantitative analysis. J Investig Dermatol, 97: 672-8, 1991.[CrossRef][Medline]
  41. Yamada K, Yamanishi K, Kakizuka A, et al Transcriptional regulation of human transglutaminase1 gene by signaling systems of protein kinase C, RAR/RXR and Jun/Fos in keratinocytes. Biochem Mol Biol Int, 34: 827-36, 1994.[Medline]
  42. DiSepio D, Jones A, Longley M, et al The proximal promoter of the mouse loricrin gene contains a functional AP-1 element and directs keratinocyte-specific but not differentiation-specific expression. J Biol Chem, 270: 10792-9, 1995.[Abstract/Free Full Text]
  43. Bernerd F, Magnaldo T, Freedberg IM, Blumenberg M. Expression of the carcinoma-associated keratin K6 and the role of AP-1 proto-oncoproteins. Gene Expr, 3: 187-99, 1993.[Medline]
  44. Giglia-Mari G, Sarasin A. TP53 mutations in human skin cancer. Hum Mutat, 21: 217-28, 2003.[CrossRef][Medline]
  45. Ponten F, Lindman H, Bostrom A, Berne B, Bergh J. Induction of p53 expression in skin by radiotherapy and UV radiation: a randomized study. J Natl Cancer Inst (Bethesda), 93: 128-33, 2001.[Abstract/Free Full Text]
  46. Shaulian E, Schreiber M, Piu F, et al The mammalian UV response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell, 103: 897-907, 2000.[CrossRef][Medline]
  47. Wicking C, Shanley S, Smyth I, et al Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein, and no genotype-phenotype correlations are evident. Am J Hum Genet, 60: 21-6, 1997.[Medline]
  48. Gorlin R. Nevoid basal-cell carcinoma syndrome. Medicine (Baltimore), 66: 98-113, 1987.[Medline]
  49. Dong Z, Birrer M, Watts R, Matrisian L, Colburn N. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc Natl Acad Sci USA, 91: 609-13, 1994.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brellier, F.
Right arrow Articles by Magnaldo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brellier, F.
Right arrow Articles by Magnaldo, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online