Cancer Research Donn Young  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mo, Y.-Y.
Right arrow Articles by Beck, W. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mo, Y.-Y.
Right arrow Articles by Beck, W. T.
[Cancer Research 64, 2793-2798, April 15, 2004]
© 2004 American Association for Cancer Research


Regular Articles

Overexpression of a Dominant-Negative Mutant Ubc9 Is Associated with Increased Sensitivity to Anticancer Drugs

Yin-Yuan Mo1, Yanni Yu1, P. L. Rachel Ee1 and William T. Beck1,2,3

Departments of 1 Biopharmaceutical Sciences and 2 Biochemistry and Molecular Genetics, and 3 the Cancer Center, University of Illinois at Chicago, Chicago, Illinois


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ubc9 is an E2-conjugating enzyme required for sumoylation and has been implicated in regulating several critical cellular pathways. We have shown previously that Ubc9 is important for sumoylation and nucleolar delocalization of topoisomerase (topo) I in response to topo I inhibitors such as topotecan. However, the role for Ubc9 in tumor drug responsiveness is not clear. In this study, we found that although MCF7 cells expressing a Ubc9 dominant-negative mutant (Ubc9-DN) display decreased activity of topo I, these cells are more sensitive to the topo I inhibitor topotecan and other anticancer agents such as VM-26 and cisplatin. In addition, we found that alteration of Ubc9 expression correlates with drug responsiveness in tumor cell lines. To understand possible mechanisms of Ubc9-associated drug responsiveness, we examined several proteins that have been shown to interact with Ubc9 and that may be involved in drug responsiveness. One such protein is Daxx, which is a Fas-associated protein that plays a role in Fas-mediated apoptosis by participating in a caspase-independent pathway through activation of apoptosis signal-regulating kinase 1 and c-Jun NH2-terminal kinase. We found that cells expressing Ubc9-DN accumulate more cytoplasmic Daxx than the control cells. Because cytoplasmic Daxx is believed to participate in cellular apoptosis, we suggest that the interaction of Ubc9 with Daxx and subsequent alteration in the subcellular localization of Daxx may contribute to the increased sensitivity to anticancer drugs in the cells expressing Ubc9-DN. Finally, we found that overexpression of Daxx sensitizes cells to anticancer drugs possibly in part through alterations of the ratio of cytoplasmic and nuclear Daxx. Together, our results suggest a role for Ubc9 in tumor drug responsiveness.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ubc9 is an essential E2 enzyme required for small ubiquitin-related modifier conjugation or sumoylation (1 , 2) . Small ubiquitin-related modifier-1 is a 10 kDa protein that forms a covalent bond at a lysine residue of target proteins in a manner similar to ubiquitination (3) . However, unlike ubiquitination, which leads to degradation of conjugated proteins, sumoylation seems to stabilize the targeted proteins (4) . In addition, sumoylation is implicated in the regulation of transcriptional activity and protein subcellular localization (5 , 6) .

Many proteins involved in critical cellular pathways are sumoylated (5 , 6) . Among them is DNA topoisomerase I (topo I; 7 ), which plays a critical role in DNA metabolism and transcription. Topo I is a target for anticancer agents such as camptothecin and its clinically important derivatives, topotecan (TPT) and irinotecan (8 , 9) .

We have demonstrated recently that sumoylation of topo I is associated with its nucleolar delocalization in response to treatment of topo I inhibitors (10) , suggesting that sumoylation serves as an addressing tag for this protein. Furthermore, when the potential lysine sumoylaltion sites (K103/K117/K153) of topo I are mutated to arginines, the enzyme shows little sumoylation and is trapped in the nucleolus in the presence of camptothecin (11) . Thus, sumoylation seems to prevent topo I binding to sites in nucleoli. More recently, it was shown that arginine substitutions of two sumoylated sites (R117 and R153) reduced camptothecin-induced cleavable complexes without influencing its in vitro catalytic activity; the camptothecin-induced cleavable complexes of wild-type topo I increased in a sumoylation-dependent manner (12) . This finding implies that sumoylation of topo I enhances the cytotoxicity of topo I inhibitors.

Ubc9 is the sole E2-conjugating enzyme required for protein sumoylation (2) . Ubc9 is therefore believed to play a central role in the above-mentioned biological processes through sumoylation. Ubc9 physically interacts with topo I (7) , but whether this interaction has any effect on topo I activity is not known. Importantly, Ubc9 is implicated in apoptosis and DNA repair, because it interacts with such proteins as p53 and Rad51 (13, 14, 15, 16) . Moreover, Ubc9 is also required for normal mitosis and recovery from DNA damage or S-phase arrest in fission yeast (17 , 18) . Yeast expressing temperature-sensitive mutant Ubc9 are more sensitive to topo I inhibitors (7) . Ubc9 was shown recently to interact with proliferating cell nuclear antigen, thereby implicating it in the Rad6-mediated DNA repair pathway (19) . However, it is not clear whether Ubc9 plays any role in tumor drug responsiveness.

In the present study, we found that overexpression of a dominant-negative Ubc9 (Ubc9-DN) sensitized tumor cells to anticancer drugs such as inhibitors of topo I (TPT) and topo II (VM-26). Of interest, we observed that compared with the vector control, the Ubc9-DN-expressing cells accumulated more cytoplasmic Daxx, a Fas-associated protein implicated in Fas-induced apoptosis (20 , 21) , than the vector control. Furthermore, we found that overexpression of Daxx increased the sensitivity of cells to anticancer drugs such as TPT, suggesting a role for Ubc9 in tumor drug responsiveness in part through regulation of subcellular distribution of Daxx.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
HeLa cells (obtained from American Type Cell Collection, Manassas, VA) were grown in DMEM (BioWhittaker, Walkersville, MD). MCF7 cells (American Type Cell Collection) and mouse mammary cancer cells CRL2116 (American Type Cell Collection) were grown in RPMI (BioWhittaker). All media were supplemented with 10% fetal bovine serum, 2 mML-glutamine, 100 units of penicillin/ml and 100 µg of streptomycin/ml. Cells were incubated at 37°C in a humidified chamber supplemented with 5% CO2.

Plasmids.
Human Ubc9 wild type and a DN mutant that carries the C93S mutation were cloned into the pCMV-Myc vector (Clontech, Palo Alto, CA) as described previously (10) . A plasmid carrying glutathione S-transferase (GST)-Ubc9 (pGEX-Ubc9) was constructed by PCR amplification of the full-length gene and cloned into pCR2.1. After verification of the sequence by DNA sequencing, the fragment was cloned into pGEX-2T (Amersham, Piscataway, NJ) at BamHI and EcoRI sites. The PCR primers were Ubc9–5.1, GGATCCTCGGGGATCGCCCTCAGCA (sense) and Ubc9–3.1, CTTATGAGGGCGCAAACTTCTTG (antisense). To construct enhanced green fluorescent protein (EGFP)-Daxx fusions, the Daxx coding region (minus start codon ATG) was amplified by reverse transcription-PCR from HeLa cells and cloned into pEGFP-C3 by standard procedures.

Transfection.
Transfection of MCF7 cells was performed by electroporation using the electroporator II with extender II (Bio-Rad, Hercules, CA) following a published protocol (22) with a slight modification. In brief, exponentially growing MCF7 cells (~6 million) were harvested and resuspended in 0.4 ml of electroporation buffer (22) . After mixing with plasmid DNA, the cells were incubated for 10 min at room temperature in the hood. The cells were then subjected to a pulse at 220 V and 950 µF of capacity. To establish stably transfected cell lines, Ubc9-DN was introduced into MCF7 cells along with pTK-Hg (Clontech) as above, and was selected in the presence of 200 µg of hygromycin/ml (Invitrogen, Carlsbad, CA). The expression of the exogenous Ubc9-DN gene was determined by Western blot using antibodies specific to either Ubc9 or Myc-tag. The vector control was a pool of over 20 individual clones. To generate stable transfectants of EGFP-Daxx, MCF7 cells expressing EGFP-Daxx were selected in the presence of G418 (1 mg/ml). Positive clones were confirmed by fluorescence microscopy and Western blot analysis. It should be noted that the vector control was also a pool of over 20 individual clones.

GST Pull-Down Assays.
Isolation and purification of the GST fusion protein (GST or GST-Ubc9) were performed as described previously (23) . For pull-down assays, total protein was isolated from different cell lines with the pull-down buffer. After removal of cell debris by centrifugation, 500 µg of protein was mixed with beads carrying GST or GST-Ubc9 and incubated for 2 h at 4°C. After three washes with PBS, proteins were solublized in 1 x SDS protein sample buffer and separated in 8% SDS polyacrylamide gels.

Isolation of Cytoplasmic and Nuclear Proteins.
Cells were harvested and resuspended in cellular lysis buffer [0.1% NP40, 10 mM Tris (pH 7.9), 10 mM MgCl2, and 15 mM NaCl] on ice for 10 min. After brief centrifugation, the supernatant was saved as the cytoplasmic fraction, and the nuclear pellet was lysed in nuclear lysis buffer [0.5 M NaCl, 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) (pH 7.9), 20% glycerol] on ice for 15 min. Protein concentration was determined by Bio-Rad protein assay kit (Bio-Rad) per the manufacturer’s instruction.

Western Blot.
Western blot analysis was carried out as described previously (24) . Topo I-specific antibody TI-I (25) was used to detect topo I. Anti-Myc antibody (Zymed, South San Francisco, CA) was used to detect overexpression of Ubc9-DN protein, and the same anti-Ubc9 antibody was used to detect both endogenous and Ubc9-DN.

Fluorescence Microscopy.
To detect the nuclear localization of EGFP-Daxx, MCF7 cells were transfected with plasmid DNA and then examined in a fluorescence microscope (Carl Zeiss, Thornwood, NY) equipped with a filter for EGFP. To determine the transfection efficiency in transient transfection experiments, we used pEGFP-C3 as a reporter, and a total of 200 cells were counted for each transfection.

Cytotoxicity Assays.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide (MTT) assays were used to determine the response of tumor cells to anticancer drugs according to standard methods. Briefly, cells were seeded in 96-well plates and treated with drugs at concentrations indicated and incubated at 37°C for 4 days.

Topo I Relaxation Assays.
Relaxation assays for topo I activity were described previously (26) . Briefly, MCF7 cells transfected with either vector alone or Ubc9-DN were harvested at 70% confluence, and nuclear protein was extracted using 0.5 M salt lysis buffer. The nuclear protein was adjusted to 100 ng/µl, from which 2-fold serial of dilutions were made. Two µl of such nuclear protein extract were added to 18 µl of relaxation buffer containing 10 ng pSK/µl and incubated at 37°C for 15 min.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Overexpression of Ubc9-DN Decreases Sumoylation and Catalytic Activity of Topo I.
We have shown previously that overexpression of Ubc9-DN reduces sumoylation of topo I in response to TPT in HeLa cells (10) . Consistent with these results, we have found reduction of topo I sumoylation by Ubc9-DN in MCF7 cells (Fig. 1A)Citation . Accordingly, we asked whether overexpression of Ubc9-DN has any effect on topo I activity. We initially used cells transiently transfected with Ubc9-DN and found that Ubc9-DN decreased topo I activity by about 2-fold when compared with the vector control (not shown). We then generated several stable Ubc9-DN transfectants in MCF7 cells and selected two (Ubc9-DN-7 and Ubc9-DN-8) of over a dozen clones. Expression of the exogenous gene in these two clones was detected by Western blot (Fig. 2A)Citation . As with the transient transfectants, relaxation assays with the stable transfectants revealed a lower activity of topo I in both clones compared with the vector control (Fig. 1B)Citation . Because overexpression of Ubc9-DN reduces sumoylation of topo I, the results suggest that Ubc9-DN-associated decrease in topo I activity is possibly attributable to decreased sumoylation of topo I.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Effect of Ubc9 dominant-negative mutant (Ubc9-DN) on sumoylation of topoisomerase I (topo I) and its activity. A, detection of sumoylation of topo I by Western blot. MCF7 cells were transiently transfected with vector alone (Lane 1) or Ubc9-DN (Lane 2), and then treated with 10 µM topotecan for 15 min. Total protein was extracted as described in "Materials and Methods." The membrane was probed with antitopo I antibody. Sumoylated topo I was identified by multiple bands as indicated. B, detection of topo I activity by relaxation assay. Nuclear protein was extracted from MCF7-vector (MCF7-V) or MCF7-Ubc9-DN cells (clones 7 and 8). Relaxation assays were performed as detailed in "Materials and Methods." The assay shown here is a representative of three experiments. The amount of protein used for assays is as indicated. NE, nuclear extract; SC, supercoiled; RF, relaxed forms.

 


View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Overexpression of Ubc9 dominant-negative mutant (Ubc9-DN) sensitizes MCF7 cells to topotecan (TPT) and VM-26. A, detection of Ubc9-DN in MCF7 cells by Western blot. Total protein was extracted from MCF7 cells carrying vector alone or Ubc9-DN (clones 7 and 8). The membrane was probed with anti-Ubc9 antibody, which recognized both the endogenous Ubc9 and Ubc9-DN. The Ubc9-DN band was about 3 kDa larger than the endogenous Ubc9 because of the Myc-tag and was confirmed by anti-Myc antibody (not shown). B-C, response of MCF7 cells to anticancer drugs as determined by 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide assays. The same cells lines as in A were tested for their sensitivity to TPT (B) or VM-26 (C). Relative cell survival was expressed as A570 nm of treatment compared with that of DMSO as 100%. The values are averages ± SE of three independent experiments.

 
MCF7 Cells Expressing Ubc9-DN Display Increased Drug Sensitivity.
Because topo I activity is directly correlated with the sensitivity to topo I inhibitors, the decreased topo I activity in MCF7 cells expressing Ubc9-DN is expected to make the cells more resistant to topo I inhibitors. To test the effect of Ubc9-DN on drug responsiveness, we tested these two Ubc9-DN clones (Ubc9-DN-7 and Ubc9-DN-8) for their response to TPT. Unexpectedly, MTT assays revealed that these Ubc9-DN cells are in fact more sensitive to the drug (Fig. 2B)Citation , suggesting that mechanisms other than reduction of topo I activity are likely to be responsible for the increased sensitivity to TPT. Indeed, these Ubc9-DN-expressing cells are also more sensitive to VM-26 (Fig. 2C)Citation , a topo II inhibitor, as well as cisplatin, a DNA alkylating agent (not shown). In fact, these data are consistent with the observation that yeast temperature-sensitive Ubc9 mutants were more sensitive to DNA-damaging agents (7) , supporting the notion that drug responsiveness is multifactorial. Hence, the results suggest that Ubc9/small ubiquitin-related modifier interact with many other proteins in addition to topo I and affect their activities or their subcellular localization, which ultimately contribute to drug responsiveness.

Altered Expression of Ubc9 in Tumor Cells Correlates with Their Sensitivity to Anticancer Agents.
In light of the above findings, we tested some ovarian tumor cell lines with different levels of intrinsic sensitivity to cisplatin for Ubc9 expression. For instance, OVCAR3 cells were 3- and 5-fold (at the IC50) more sensitive to cisplatin than OVCAR5 and OVCAR8 cells, respectively. As shown in Fig. 3ACitation , the level of Ubc9 in OVCAR3 cells was about 3-fold less than that of OVCAR5 or OVCAR8 cells. This correlation was also supported by semi-quantitative reverse transcription-PCR data (not shown), suggesting that Ubc9 could be a contributing factor to drug responsiveness. In support of this notion, we found a similar relationship between Ubc9 and resistance to VM-26 in CEM and its sublines, CEM/VM-1 and CEM/VM-1–5 (27) , where the most resistant CEM/VM-1–5 (to VM-26) cells expressed the highest level of Ubc9 (Fig. 3B)Citation , which was twice as much as in CEM cells.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Altered expression of Ubc9 in tumor cells correlates with their sensitivity to anticancer agents. Log phase cells were harvested and total protein was extracted. The membrane was probed with anti-Ubc9 antibody. ß-actin serves as a loading control. A, ovarian cancer cell lines. B, leukemia cell lines.

 
Detection of More Cytoplasmic Daxx in MCF7 Cells Expressing Ubc9-DN by Cellular Fractionations.
To determine possible mechanisms underlying the increased drug sensitivity of MCF7 cells expressing Ubc9-DN, we examined proteins that have potential roles in drug responsiveness, including those associated with apoptosis and DNA repair. One such protein is Daxx, a Fas death domain-associated protein implicated in Fas-induced apoptosis (20 , 21) . Daxx has been shown to interact with Ubc9 (28) and is a substrate for sumoylation (29) . Because Ubc9 is implicated in regulating the subcellular localization of proteins, we first examined the interaction of Ubc9 with Daxx by GST pull-down assays. As shown in Fig. 4ACitation , Ubc9 binds to Daxx in all of the cell lines tested (MCF7, CRL-2116, and HeLa). We then examined the subcellular distribution of Daxx in parental MCF7 cells. Although the majority of Daxx is present in the nucleus, we detected about 5% of Daxx in the cytoplasm (Fig. 4B)Citation . To determine the effect of Ubc9-DN on Daxx, we examined the total level of Daxx as well as its subcellular distribution. Although there was no obvious difference in the Daxx protein from total extracts among different cell lines (not shown), we detected more cytoplasmic Daxx in both the Ubc9-DN-7 and Ubc9-DN-8 cells than in the vector control cells (Fig. 4C)Citation . Similarly, no difference was seen for nuclear Daxx between controls and Ubc9-DN cells presumably because only a small portion of nuclear Daxx moves out in these Ubc9-DN cells. Cytoplasmic Daxx is believed to participate in the caspase-independent apoptosis pathway (30) . Hence, an increase in the cytoplasmic Daxx suggests that these Ubc9-DN-expressing cells are more prone to apoptosis, and thus, would be more sensitive to TPT and other anticancer drugs.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effect of Ubc9 dominant-negative mutant (Ubc9-DN) on the subcellular localization of Daxx. A, detection of interaction of Ubc9 with Daxx by glutathione S-transferase (GST) pulldown assays. Total protein was isolated from MCF7, CRL-2116, and HeLa cells, respectively, and incubated with GST-Ubc9 as described in "Materials and Methods." The membrane was probed with anti-Daxx antibody. Amount of protein extract for the input was about half of that used in the pull-down assays. B-C, subcellular distribution of Daxx in parental MCF7 cells (B) and MCF7 cells expressing vector alone or Ubc9-DN (C). Cytoplasmic and nuclear protein was isolated from MCF7 cells as described in "Materials and Methods." About 50 µg of protein were loaded per lane. Topoisomerase I (topo I) serves as a nuclear marker, in addition to serving as a loading control; {alpha}-tubulin serves as a cytoplasmic marker as well as a loading control. Shown here (C) is a representative of more than three separate experiments. Note about a 2-fold increase in the cytoplasmic Daxx in Ubc9-DN-expressing MCF7 cells. D, subnuclear distribution of enhanced green fluorescent protein (EGFP)-Daxx as detected by a fluorescence microscope.

 
Because previous studies suggested that the nuclear Daxx can also be recruited to promyelocytic leukemia oncogenic domain, which requires sumoylation of promyelocytic leukemia (31 , 32) , we also examined subnuclear distribution of Daxx in these cells by using EGFP-Daxx. However, we did not detect any alteration of subnuclear distribution of Daxx between Ubc9-DN cells and the vector control cells (Fig. 4D)Citation . Although we cannot exclude the possibility that suppression of the endogenous Ubc9 by Ubc9-DN is insufficient to detect any difference in the subnuclear distribution of Daxx, it appears that Ubc9 has no detectable effect here. Finally, we used the same pEGFP-Daxx construct and monitored the subcellular localization of the fusion protein. However, we did not detect differences in the subcellular localization between the vector control and Ubc9-DN cells.

Overexpression of Daxx Increases Drug Sensitivity.
To evaluate the role of Daxx in drug-induced cell death, we overexpressed pEGFP-Daxx in MCF7 cells and generated several stable cell lines expressing EGFP-Daxx. Expression of the fusion protein for one such clone (EGFP-Daxx-1) was detected by Western blot, as shown in Fig. 5ACitation . Although microscopic examination of these cells revealed that the fusion protein was predominantly nuclear (Fig. 5B)Citation , cellular fractionation indicated a higher ratio of cytoplasmic versus nuclear EGFP-Daxx than that of the endogenous Daxx (Fig. 5C)Citation . For instance, whereas we detected about 5% of endogenous Daxx in the cytoplasm, we detected about 35% (as measured by densitometry) of EGFP-Daxx in the cytoplasm (Fig. 5C)Citation .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Overexpression of Daxx increases the cell’s sensitivity to anticancer drugs. A, detection of expression of enhanced green fluorescent protein (EGFP)-Daxx from total cellular extract by Western blot analysis. Shown here is one of several stable cell lines expressing EGFP-Daxx. The membrane was probed with anti-Daxx antibody. B, the EGFP-Daxx fusion protein is seen by a fluorescence microscope, with predominant nuclear localization. C, subcellular distribution of EGFP-Daxx as detected by cellular fractionation and Western blot. The membrane was probed by anti-Daxx antibody. D and E, response of the transfected cells to topotecan (TPT; D) or VM-26 (E) as determined by 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide (MTT) assays. The values are averages ± SE of three separate experiments.

 
MTT assays indicated that the EGFP-Daxx-expressing MCF7 cells are more sensitive to TPT (~7-fold at the IC50; Fig. 5DCitation ) and to VM-26 (~5-fold at the IC50; Fig. 5ECitation ) than the vector alone. Similar responses were seen for other EGFP-Daxx clones (not shown). Because this increase in drug sensitivity correlated with a higher ratio of cytoplasmic versus nuclear EGFP-Daxx than that of the endogenous Daxx (Fig. 5C)Citation , we suggest that more cytoplasmic EGFP-Daxx may contribute to the increased drug sensitivity of these cells.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Protein sumoylation has been implicated in the regulation of protein stability, subcellular localization, and the activity of transcription factors (5 , 6) . Because Ubc9 is the sole E2-conjugating enzyme required for sumoylation (2) , it is believed to play a central role in these processes. Although some evidence suggests that Ubc9 may be involved in a DNA repair pathway in yeast (17 , 19) , little is known about whether Ubc9 plays any role in tumor drug responsiveness. In the present study, we found that overexpression of Ubc9-DN decreases topo I sumoylation, sensitizes tumor cells to a variety of anticancer agents including TPT, VM-26, and others, suggesting that Ubc9-dependent sumoylation plays a role in drug responsiveness. Moreover, we found a good correlation between Ubc9 levels and drug resistance in ovarian cancer and acute lymphoblastic leukemia cell lines, further supporting this notion.

Although the MCF7 cells expressing Ubc9-DN display a reduced topo I activity, they are paradoxically more sensitive to antitumor agents. To determine molecular mechanisms underlying the alteration of drug response in these Ubc9-DN-expressing MCF7 cells, we examined the Fas-associated protein, Daxx, which is implicated in Fas-mediated apoptosis. Intriguingly, we found that more cytoplasmic Daxx is accumulated in MCF7 cells expressing Ubc9-DN, implying that Ubc9 plays a role in regulating the subcellular localization of Daxx. Although fluorescence microscopy did not indicate any change of subcellular localization of Daxx by Ubc9-DN, cellular fractionation combined with Western blot revealed such changes. Despite several possibilities for this discrepancy, we postulate that the cytoplasmic Daxx may associate only loosely with nuclear membrane. When the cells are intact, the cytoplasmic Daxx surrounds the nucleus and thus appears to be in the nucleus; however, once cells are lysed, Daxx dissociates from the nuclear membrane and is released into the cytoplasmic fraction. Although it is possible that the cytoplasmic fraction prepared in this study may be contaminated with the nuclear Daxx, because we did not detect topo I, an abundant nuclear protein in the cytoplasmic fraction, this is not likely to be the case. Daxx has been shown to be sumoylated (29) , so overexpression of Ubc9-DN should affect sumoylation of Daxx. However, we detected no difference in Daxx sumoylation between controls and transfectants. This is presumably because sumoylated Daxx is only detected when Daxx, small ubiquitin-related modifier-1, and Ubc9 are all overexpressed, and the ratio of sumoylated versus nonsumoylated Daxx is only ~1–2% (29) .

Because Daxx is a component of the Fas-induced apoptosis pathway (20) , the increase of the cytoplasmic Daxx may explain in part why these Ubc9-DN-expressing cells are more sensitive to drugs. Given that Ubc9 plays a role in regulating the subcellular localization of interacting proteins (33 , 34) , we suggest that Daxx is another member of such Ubc9-mediated proteins.

As shown in Fig. 6Citation , Fas/Fas ligand is one of the key elements of a well-defined apoptotic pathway (35 , 36) . Interaction of Fas/Fas ligand leads to the recruitment of death-associated proteins to the cytoplasmic domain of Fas. Depending on which adaptor protein associates with Fas, two distinct Fas-mediated pathways have been identified (i.e., caspase dependent and caspase independent). Fas-associated death domain mediates a caspase-dependent pathway through recruitment of procaspase-8 (34 , 35) , whereas Daxx mediates a caspase-independent pathway by activating a proapoptotic kinase, apoptosis signal-regulating kinase 1 (Ask1; 37 ). Although the Fas-associated death domain pathway plays a major role at an early stage of apoptosis, the Daxx pathway is believed to play a role in a late stage of apoptosis (20) .



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. A working model for the role of Ubc9 in drug responsiveness. See text for explanation. FADD, Fas-associated death domain; DD, death domain; Ask1, apoptosis signal-regulating kinase 1; JNK, c-Jun NH2-terminal kinase; SUMO, small ubiquitin-related modifier; PML, promyelocytic leukemia; POD, promyelocytic leukemia oncogenic domain.

 
Daxx resides in both the cytoplasm and nucleus and has a dual function (Fig. 6)Citation . Although the cytoplasmic Daxx participates in Fas-induced apoptosis, the nuclear Daxx acts as a negative transcriptional regulator (38) . In the cytoplasm, Daxx interacts with the death domain of Fas and Ask1, and activation of Ask1 by binding to Daxx leads to activation of c-Jun NH2-terminal kinase (36) . By contrast, the nuclear Daxx controls expression of several proteins such as PAX3 (38) , a transcription factor that is involved in development. Sequestration of Daxx from the nucleoplasm and into promyelocytic leukemia oncogenic domain leads to relief of the repressive activity of Daxx (32) .

Regulation of Daxx in enhancing Fas-mediated apoptosis is complex, and several factors have been shown to be involved in this process (39, 40, 41) . For instance, although Fas activation leads to the accumulation of cytoplasmic Daxx, HSP27 is able to block Fas-induced translocation of Daxx from the nucleus to the cytoplasm and Fas-induced, Daxx-dependent, and Ask1-dependent apoptosis (30) . Phosphorylated dimers of HSP27 interact with Daxx, preventing the interaction of Daxx with both Ask1 and Fas and thus block Daxx-mediated apoptosis (30) . On the other hand, overexpression of Ask1 causes translocation of Daxx from the nucleus to the cytoplasm and formation of Fas/Daxx/Ask1 complexes, leading to cell death through Daxx-dependent apoptosis (39 , 40) . Because overexpression of Ubc9-DN causes accumulation of cytoplasmic Daxx, this suggests that Ubc9 could be another factor regulating the subcellular localization of Daxx.

Nevertheless, alteration of the subcellular localization of Daxx may not be the only explanation for the observed increased sensitivity to a variety of anticancer drugs in these Ubc9-DN cells. It is well known that drug responsiveness is a consequence of multiple cellular factors. For instance, alterations in DNA repair pathways can also contribute to tumor drug responsiveness. Anticancer drugs such as TPT and VM-26 cause DNA damage by stabilizing DNA-protein complexes (8 , 9) . Ubc9 has been shown to be important for DNA repair (19) , and it has been speculated that sumoylation of topo I could be a DNA damage-rescuing mechanism (7) . We have found previously that nucleolar delocalized topo I formed nuclear body-like structures (10) , which could be nuclear foci where DNA repair takes place (Fig. 6)Citation . Furthermore, Ubc9 was originally identified through its involvement in the degradation of cyclins in yeast (42) , implicating its role in cell cycle control, although there is no biochemical evidence to support this notion. If this occurs in mammalian cells, Ubc9 could also contribute to the responsiveness of cells to DNA-damaging agents such as TPT through regulation of the cell cycle. Nevertheless, the present study suggests that Ubc9 could impact the response of the cells to anticancer drugs through alteration of the subcellular localization of Daxx.


    FOOTNOTES
 
Grant support: Supported by Grant DAMD17-99-1-9220 from Department of Defense, Army Breast Cancer Research Program; in part by Grants CA40570 and CA30103 from the National Cancer Institute, NIH, Department of Health and Human Services; and in part by the University of Illinois at Chicago.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Y-Y. Mo is currently at the Department of Medical Microbiology and Immunology, and the Cancer Institute, Southern Illinois University School of Medicine, Springfield, IL 62794.

Requests for reprints: Yin-Yuan Mo, Department of Medical Microbiology and Immunology, and the Cancer Institute, Southern Illinois University School of Medicine, 911 N. Rutledge 1330A, Springfield, IL 62794, Phone: (217) 545-8508; E-mail:ymo{at}siumed.edu

Received 8/ 4/03. Revised 2/ 9/04. Accepted 2/13/04.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Johnson ES, Blobel G. Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J Biol Chem, 272: 26799-802, 1997.[Abstract/Free Full Text]
  2. Schwarz SE, Matuschewski K, Liakopoulos D, Scheffner M, Jentsch S. The ubiquitin-like proteins SMT3 and SUMO-1 are conjugated by the UBC9 E2 enzyme. Proc Natl Acad Sci USA, 95: 560-4, 1998.[Abstract/Free Full Text]
  3. Mahajan R, Delphin C, Guan T, Gerace L, Melchior F. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell, 88: 97-107, 1997.[CrossRef][Medline]
  4. Desterro JM, Rodriguez MS, Hay RT. SUMO-1 modification of I{kappa}B{alpha} inhibits NF-{kappa}B activation. Mol Cell, 2: 233-9, 1998.[CrossRef][Medline]
  5. Melchior F. SUMO-nonclassical ubiquitin. Annu Rev Cell Dev Biol, 16: 591-626, 2000.[CrossRef][Medline]
  6. Muller S, Hoege C, Pyrowolakis G, Jentsch S. SUMO, ubiquitin’s mysterious cousin. Nat Rev Mol Cell Biol, 2: 202-10, 2001.[CrossRef][Medline]
  7. Mao Y, Sun M, Desai SD, Liu LF. SUMO-1 conjugation to topoisomerase I: a possible repair response to topoisomerase-mediated DNA damage. Proc Natl Acad Sci USA, 97: 4046-51, 2000.[Abstract/Free Full Text]
  8. Wang JC. DNA topoisomerases. Annu Rev Biochem, 65: 635-92, 1996.[CrossRef][Medline]
  9. Li TK, Liu LF. Tumor cell death induced by topoisomerase-targeting drugs. Annu Rev Pharmacol Toxicol, 41: 53-77, 2001.[CrossRef][Medline]
  10. Mo YY, Yu Y, Shen Z, Beck WT. Nucleolar delocalization of human topoisomerase I in response to topotecan correlates with sumoylation of the protein. J Biol Chem, 277: 2958-64, 2002.[Abstract/Free Full Text]
  11. Rallabhandi P, Hashimoto K, Mo YY, Beck WT, Moitra PK, D’Arpa P. Sumoylation of topoisomerase I is involved in its partitioning between nucleoli and nucleoplasm and its clearing from nucleoli in response to camptothecin. J Biol Chem, 277: 40020-6, 2002.[Abstract/Free Full Text]
  12. Horie K, Tomida A, Sugimoto Y, et al SUMO-1 conjugation to intact DNA topoisomerase I amplifies cleavable complex formation induced by camptothecin. Oncogene, 21: 7913-22, 2002.[CrossRef][Medline]
  13. Rodriguez MS, Thompson J, Hay RT, Dargemont C. Nuclear retention of I{kappa}B{alpha} protects it from signal-induced degradation and inhibits nuclear factor {kappa}B transcriptional activation. J Biol Chem, 274: 9108-15, 1999.[Abstract/Free Full Text]
  14. Gostissa M, Hengstermann A, Fogal V, et al Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. EMBO J, 18: 6462-71, 1999.[CrossRef][Medline]
  15. Shen Z, Pardington-Purtymun PE, Comeaux JC, Moyzis RK, Chen DJ. UBL1, a human ubiquitin-like protein associating with human RAD51/RAD52 proteins. Genomics, 36: 271-9, 1996.[CrossRef][Medline]
  16. Schmidt D, Muller S. Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc Natl Acad Sci USA, 99: 2872-7, 2002.[Abstract/Free Full Text]
  17. Spence J, Sadis S, Haas AL, Finley D. A ubiquitin mutant with specific defects in DNA repair and multiubiquitination. Mol Cell Biol, 15: 1265-73, 1995.[Abstract]
  18. al-Khodairy F, Enoch T, Hagan IM, Carr AM. The Schizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugating enzyme required for normal mitosis. J Cell Sci, 108: 475-86, 1995.[Abstract]
  19. Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S. RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature (Lond), 419: 135-41, 2002.[CrossRef][Medline]
  20. Yang X, Khosravi-Far R, Chang HY, Baltimore D. Daxx, a novel Fas-binding protein that activates JNK and apoptosis. Cell, 89: 1067-76, 1997.[CrossRef][Medline]
  21. Kiriakidou M, Driscoll DA, Lopez-Guisa JM, Strauss JF, III. Cloning and expression of primate Daxx cDNAs and mapping of the human gene to chromosome 6p21.3 in the MHC region. DNA Cell Biol, 16: 1289-98, 1997.[Medline]
  22. Agami R, Bernards R. Distinct initiation and maintenance mechanisms cooperate to induce G1 cell cycle arrest in response to DNA damage. Cell, 102: 55-66, 2000.[CrossRef][Medline]
  23. Bhat UG, Raychaudhuri P, Beck WT. Functional interaction between human topoisomerase II{alpha} and retinoblastoma protein. Proc Natl Acad Sci USA, 96: 7859-64, 1999.[Abstract/Free Full Text]
  24. Mo YY, Wang P, Beck WT. Functional expression of human DNA topoisomerase I and its subcellular localization in HeLa cells. Exp Cell Res, 256: 480-90, 2000.[CrossRef][Medline]
  25. Baker SD, Wadkins RM, Stewart CF, Beck WT, Danks MK. Cell cycle analysis of amount and distribution of nuclear DNA topoisomerase I as determined by fluorescence digital imaging microscopy. Cytometry, 19: 134-45, 1995.[CrossRef][Medline]
  26. Hann C, Evans DL, Fertala J, Benedetti P, Bjornsti MA, Hall DJ. Increased camptothecin toxicity induced in mammalian cells expressing Saccharomyces cerevisiae DNA topoisomerase I. J Biol Chem, 273: 8425-33, 1998.[Abstract/Free Full Text]
  27. Danks MK, Schmidt CA, Cirtain MC, Suttle DP, Beck WT. Altered catalytic activity of and DNA cleavage by DNA topoisomerase II from human leukemic cells selected for resistance to VM-26. Biochemistry, 27: 8861-9, 1988.[CrossRef][Medline]
  28. Ryu SW, Chae SK, Kim E. Interaction of Daxx, a Fas binding protein, with sentrin and Ubc9. Biochem Biophys Res Commun, 279: 6-10, 2000.[CrossRef][Medline]
  29. Jang MS, Ryu SW, Kim E. Modification of Daxx by small ubiquitin-related modifier-1. Biochem Biophys Res Commun, 295: 495-500, 2002.[CrossRef][Medline]
  30. Charette SJ, Lavoie JN, Lambert H, Landry J. Inhibition of Daxx-mediated apoptosis by heat shock protein 27. Mol Cell Biol, 20: 7602-12, 2000.[Abstract/Free Full Text]
  31. Best JL, Ganiatsas S, Agarwal S, et al SUMO-1 protease-1 regulates gene transcription through PML. Mol Cell, 10: 843-55, 2002.[CrossRef][Medline]
  32. Li H, Leo C, Zhu J, et al Sequestration and inhibition of Daxx-mediated transcriptional repression by PML. Mol Cell Biol, 20: 1784-96, 2000.[Abstract/Free Full Text]
  33. Kurtzman AL, Schechter N. Ubc9 interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-1 independent of SUMO-1 modification. Proc Natl Acad Sci USA, 98: 5602-7, 2001.[Abstract/Free Full Text]
  34. Wilson VG, Rangasamy D. Intracellular targeting of proteins by sumoylation. Exp Cell Res, 271: 57-65, 2001.[CrossRef][Medline]
  35. Ju ST, Panka DJ, Cui H, et al Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature (Lond), 373: 444-8, 1995.[CrossRef][Medline]
  36. Nagata S, Golstein P. The Fas death factor. Science (Wash D C), 267: 1449-56, 1995.
  37. Chang HY, Nishitoh H, Yang X, Ichijo H, Baltimore D. Activation of apoptosis signal-regulating kinase 1 (ASK1) by the adapter protein Daxx. Science (Wash D C), 281: 1860-3, 1998.
  38. Hollenbach AD, Sublett JE, McPherson CJ, Grosveld G. The Pax3-FKHR oncoprotein is unresponsive to the Pax3-associated repressor hDaxx. EMBO J, 18: 3702-11, 1999.[CrossRef][Medline]
  39. Ko YG, Kang YS, Park H, et al Apoptosis signal-regulating kinase 1 controls the proapoptotic function of death-associated protein (Daxx) in the cytoplasm. J Biol Chem, 276: 39103-6, 2001.[Abstract/Free Full Text]
  40. Charette SJ, Lambert H, Landry J. A kinase-independent function of Ask1 in caspase-independent cell death. J Biol Chem, 276: 36071-4, 2001.[Abstract/Free Full Text]
  41. Song JJ, Lee YJ. Role of the ASK1-SEK1-JNK1-HIPK1 signal in Daxx trafficking and ASK1 oligomerization. J Biol Chem, 278: 47245-52, 2003.[Abstract/Free Full Text]
  42. Seufert W, Futcher B, Jentsch S. Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature (Lond), 373: 78-81, 1995.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. W. Leavenworth, X. Ma, Y.-y. Mo, and M. E. Pauza
SUMO Conjugation Contributes to Immune Deviation in Nonobese Diabetic Mice by Suppressing c-Maf Transactivation of IL-4
J. Immunol., July 15, 2009; 183(2): 1110 - 1119.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Wu, S. Zhu, Y. Ding, W. T. Beck, and Y.-Y. Mo
MicroRNA-mediated Regulation of Ubc9 Expression in Cancer Cells
Clin. Cancer Res., March 1, 2009; 15(5): 1550 - 1557.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
F. Wu, S. Chiocca, W. T. Beck, and Y.-Y. Mo
Gam1-associated alterations of drug responsiveness through activation of apoptosis
Mol. Cancer Ther., June 1, 2007; 6(6): 1823 - 1830.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R.-Y. Huang, D. Kowalski, H. Minderman, N. Gandhi, and E. S. Johnson
Small Ubiquitin-Related Modifier Pathway Is a Major Determinant of Doxorubicin Cytotoxicity in Saccharomyces cerevisiae
Cancer Res., January 15, 2007; 67(2): 765 - 772.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Muromoto, M. Ishida, K. Sugiyama, Y. Sekine, K. Oritani, K. Shimoda, and T. Matsuda
Sumoylation of Daxx Regulates IFN-Induced Growth Suppression of B Lymphocytes and the Hormone Receptor-Mediated Transactivation
J. Immunol., July 15, 2006; 177(2): 1160 - 1170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. R. Jacquiau, R. C. A. M. van Waardenburg, R. J. D. Reid, M. H. Woo, H. Guo, E. S. Johnson, and M.-A. Bjornsti
Defects in SUMO (Small Ubiquitin-related Modifier) Conjugation and Deconjugation Alter Cell Sensitivity to DNA Topoisomerase I-induced DNA Damage
J. Biol. Chem., June 24, 2005; 280(25): 23566 - 23575.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mo, Y.-Y.
Right arrow Articles by Beck, W. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mo, Y.-Y.
Right arrow Articles by Beck, W. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online